Incidental Mutation 'R8998:Treml2'
ID 690303
Institutional Source Beutler Lab
Gene Symbol Treml2
Ensembl Gene ENSMUSG00000071068
Gene Name triggering receptor expressed on myeloid cells-like 2
Synonyms LOC328833
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock # R8998 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 48300038-48312534 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 48302747 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 69 (D69G)
Ref Sequence ENSEMBL: ENSMUSP00000128215 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170941]
AlphaFold Q2LA85
Predicted Effect possibly damaging
Transcript: ENSMUST00000170941
AA Change: D69G

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128215
Gene: ENSMUSG00000071068
AA Change: D69G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 31 129 3.13e-5 SMART
low complexity region 181 199 N/A INTRINSIC
transmembrane domain 268 290 N/A INTRINSIC
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TREML2 is located in a gene cluster on chromosome 6 with the single Ig variable (IgV) domain activating receptors TREM1 (MIM 605085) and TREM2 (MIM 605086), but it has distinct structural and functional properties (Allcock et al., 2003 [PubMed 12645956]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aloxe3 A G 11: 69,142,225 K575R probably benign Het
Atp10b T A 11: 43,259,899 *1475R probably null Het
Baz2b T C 2: 59,969,264 D237G probably benign Het
Cacna2d4 A C 6: 119,242,915 Q215H possibly damaging Het
Capn15 G A 17: 25,963,081 R651C probably damaging Het
Ccdc28b A G 4: 129,622,678 V29A probably benign Het
Cyb5rl A G 4: 107,080,960 T170A possibly damaging Het
D330020A13Rik A G 6: 120,294,929 T189A unknown Het
Emsy C A 7: 98,619,305 V524F possibly damaging Het
Eppk1 T A 15: 76,102,736 N3315I probably damaging Het
Erich2 T G 2: 70,531,620 probably benign Het
Fkbp15 T C 4: 62,324,128 D529G probably damaging Het
Gbx2 C A 1: 89,929,023 G215V possibly damaging Het
Gzmd T A 14: 56,130,687 Y105F possibly damaging Het
Hpse G A 5: 100,692,243 T336M probably damaging Het
Hrg A G 16: 22,953,705 D88G probably damaging Het
Kif20b G A 19: 34,936,853 probably benign Het
Kmt2a A G 9: 44,821,877 M2381T unknown Het
Krtap5-3 T A 7: 142,202,196 C257S unknown Het
Met C T 6: 17,491,535 R99W probably benign Het
Nlrp4b A G 7: 10,715,702 R611G probably null Het
Olfr1154 T A 2: 87,902,845 Y277F probably damaging Het
Olfr32 C T 2: 90,139,128 V4I probably benign Het
Olfr516 A C 7: 108,845,810 S67A probably benign Het
Olfr905 T C 9: 38,473,491 V248A probably benign Het
Papd5 A G 8: 88,250,722 H384R probably benign Het
Pclo A G 5: 14,677,496 I2123V unknown Het
Phf10 G C 17: 14,950,621 A350G probably benign Het
Pira2 T C 7: 3,842,491 Y298C probably damaging Het
Pkhd1 A T 1: 20,364,201 Y2338N probably damaging Het
Psme4 C T 11: 30,838,957 L1120F possibly damaging Het
Safb2 A T 17: 56,563,391 H934Q possibly damaging Het
Slc4a7 T A 14: 14,775,346 L884Q probably damaging Het
Smc4 A C 3: 69,027,561 probably benign Het
Spag16 T C 1: 69,896,547 V311A probably benign Het
Spert T C 14: 75,583,214 E357G probably damaging Het
Sprr2j-ps T C 3: 92,418,869 V17A unknown Het
Tenm3 T C 8: 48,276,687 Y1428C probably damaging Het
Ttn T C 2: 76,827,933 K12368E unknown Het
Usp17le T C 7: 104,768,762 D391G probably benign Het
Usp28 G A 9: 49,037,839 R911Q probably benign Het
Wdfy3 A C 5: 101,845,192 S3274R probably benign Het
Ythdc2 T C 18: 44,864,304 V976A probably benign Het
Zfp334 A G 2: 165,381,488 S212P possibly damaging Het
Other mutations in Treml2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01767:Treml2 APN 17 48302810 missense probably benign
IGL02797:Treml2 APN 17 48302711 missense possibly damaging 0.73
Cottonwood UTSW 17 48302747 missense possibly damaging 0.89
poplar UTSW 17 48302734 nonsense probably null
R0105:Treml2 UTSW 17 48302828 missense probably damaging 0.99
R0105:Treml2 UTSW 17 48302828 missense probably damaging 0.99
R0670:Treml2 UTSW 17 48307836 splice site probably null
R1538:Treml2 UTSW 17 48302758 missense possibly damaging 0.77
R1796:Treml2 UTSW 17 48309502 makesense probably null
R4396:Treml2 UTSW 17 48308114 missense probably benign 0.00
R4679:Treml2 UTSW 17 48308175 missense probably benign 0.36
R4687:Treml2 UTSW 17 48309397 splice site probably null
R4801:Treml2 UTSW 17 48309159 missense probably benign 0.18
R4802:Treml2 UTSW 17 48309159 missense probably benign 0.18
R5314:Treml2 UTSW 17 48300573 missense probably damaging 0.99
R6791:Treml2 UTSW 17 48309219 missense probably benign 0.24
R6818:Treml2 UTSW 17 48302897 missense probably damaging 1.00
R6958:Treml2 UTSW 17 48308152 missense probably damaging 1.00
R7250:Treml2 UTSW 17 48309127 missense probably benign 0.05
R7535:Treml2 UTSW 17 48302819 missense probably damaging 1.00
R7850:Treml2 UTSW 17 48308140 missense probably benign 0.01
R8049:Treml2 UTSW 17 48302734 nonsense probably null
R9012:Treml2 UTSW 17 48308062 missense possibly damaging 0.86
R9208:Treml2 UTSW 17 48307894 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCGACCTTGGTCAGAAAAGTC -3'
(R):5'- ACCATTGTTCCATGATCCCG -3'

Sequencing Primer
(F):5'- GACCTTGGTCAGAAAAGTCCTGTC -3'
(R):5'- AGGTCTGCTCACCTGGATACAC -3'
Posted On 2021-11-19