Incidental Mutation 'R8754:Nin'
ID690308
Institutional Source Beutler Lab
Gene Symbol Nin
Ensembl Gene ENSMUSG00000021068
Gene Nameninein
Synonyms3110068G20Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8754 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location70011435-70113717 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 70031013 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021468] [ENSMUST00000085314] [ENSMUST00000095666] [ENSMUST00000169074] [ENSMUST00000220689] [ENSMUST00000222237] [ENSMUST00000222835] [ENSMUST00000223257]
AlphaFold Q61043
Predicted Effect probably benign
Transcript: ENSMUST00000021468
SMART Domains Protein: ENSMUSP00000021468
Gene: ENSMUSG00000021068

DomainStartEndE-ValueType
internal_repeat_1 7 67 7.83e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 7.83e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1980 2013 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085314
SMART Domains Protein: ENSMUSP00000082422
Gene: ENSMUSG00000021068

DomainStartEndE-ValueType
internal_repeat_1 7 67 4.15e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 4.15e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1971 2045 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095666
SMART Domains Protein: ENSMUSP00000093327
Gene: ENSMUSG00000021068

DomainStartEndE-ValueType
internal_repeat_1 7 67 7.83e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 7.83e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1980 2013 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169074
SMART Domains Protein: ENSMUSP00000129648
Gene: ENSMUSG00000021068

DomainStartEndE-ValueType
internal_repeat_1 7 67 7.83e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 7.83e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1980 2013 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220689
Predicted Effect probably benign
Transcript: ENSMUST00000221579
Predicted Effect probably benign
Transcript: ENSMUST00000222237
Predicted Effect probably benign
Transcript: ENSMUST00000222835
Predicted Effect probably benign
Transcript: ENSMUST00000223257
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the proteins important for centrosomal function. This protein is important for positioning and anchoring the microtubules minus-ends in epithelial cells. Localization of this protein to the centrosome requires three leucine zippers in the central coiled-coil domain. Multiple alternatively spliced transcript variants that encode different isoforms have been reported. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,066,037 V329A probably benign Het
A830018L16Rik G T 1: 11,545,248 K148N probably benign Het
Actn3 A G 19: 4,863,460 F648L probably damaging Het
Amotl2 A G 9: 102,720,159 D39G possibly damaging Het
Anks1 C A 17: 27,996,010 T477K possibly damaging Het
Brix1 A T 15: 10,476,578 S271T probably benign Het
Ccdc88b T C 19: 6,855,845 E278G probably damaging Het
Cdc40 C T 10: 40,841,484 D404N probably damaging Het
Chrna6 T C 8: 27,407,201 H216R probably damaging Het
Col6a3 C G 1: 90,767,606 probably benign Het
Copa C T 1: 172,108,359 R423W probably damaging Het
Cttnbp2 A C 6: 18,434,038 I607R possibly damaging Het
Depdc5 A T 5: 32,979,537 T1384S probably benign Het
Dlat G T 9: 50,649,667 A360E probably damaging Het
Dusp26 C T 8: 31,091,777 probably benign Het
Fam135a G A 1: 24,028,488 T1100M probably benign Het
Fuca1 T C 4: 135,925,578 L171P probably damaging Het
Gm21936 T A 12: 87,795,799 N96K possibly damaging Het
Gpr158 G A 2: 21,576,882 V391I probably benign Het
Gtf2h5 C CA 17: 6,084,558 probably null Het
Heatr1 T A 13: 12,413,294 Y771N probably damaging Het
Il17ra A G 6: 120,481,456 T523A probably benign Het
Kcnv1 G A 15: 45,114,469 Q58* probably null Het
Kdm5d T C Y: 941,594 V1265A probably damaging Het
Kifc3 A T 8: 95,102,396 L726Q probably damaging Het
Klk1b21 T A 7: 44,106,488 I247N probably benign Het
Kntc1 T A 5: 123,759,052 N159K probably benign Het
Krtap4-7 G T 11: 99,643,841 C65* probably null Het
Lama2 C T 10: 27,001,151 V2680M possibly damaging Het
Lipe T A 7: 25,388,582 M61L probably benign Het
Med17 A G 9: 15,277,600 M123T possibly damaging Het
Mrpl37 T C 4: 107,064,414 N206S probably benign Het
Muc4 A T 16: 32,781,986 N1390Y Het
Muc5ac C T 7: 141,800,271 A869V possibly damaging Het
Nckap5l A G 15: 99,429,409 V133A probably benign Het
Nr1h2 C T 7: 44,551,344 A287T probably damaging Het
Olfr894 A T 9: 38,219,569 I246L possibly damaging Het
Patl1 A G 19: 11,922,534 E230G probably damaging Het
Pbxip1 T C 3: 89,447,928 S585P probably damaging Het
Pde3b T A 7: 114,416,043 W165R possibly damaging Het
Pdia4 A C 6: 47,796,530 D628E probably benign Het
Pigo T A 4: 43,024,724 H125L probably benign Het
Platr25 A T 13: 62,700,110 *313K probably null Het
Plxdc1 A T 11: 97,955,511 M169K possibly damaging Het
Pxk T C 14: 8,151,496 I437T probably damaging Het
Rlf T C 4: 121,146,813 T1767A possibly damaging Het
Rnf123 T A 9: 108,071,164 D110V probably damaging Het
Rnf185 A T 11: 3,418,052 F209I probably benign Het
Rpl4 A T 9: 64,174,960 N47I probably damaging Het
Rsl1d1 A T 16: 11,199,648 F151L probably damaging Het
Sema3d T C 5: 12,553,224 probably null Het
Serhl A G 15: 83,101,925 N80D probably benign Het
Sh3tc1 C A 5: 35,706,458 R795L probably benign Het
Slc2a12 A T 10: 22,645,217 T7S probably benign Het
Snrnp200 A G 2: 127,226,085 Y834C probably damaging Het
Ss18 G C 18: 14,640,959 Q258E probably damaging Het
Telo2 G A 17: 25,102,067 L725F probably damaging Het
Tnxb A G 17: 34,715,908 E2497G probably damaging Het
Tox2 A G 2: 163,321,440 D111G Het
Trim16 G A 11: 62,840,937 E545K probably benign Het
Trpm7 A G 2: 126,822,703 W919R probably damaging Het
Ttbk1 G T 17: 46,445,201 S1301* probably null Het
Txk T C 5: 72,731,779 N144S probably damaging Het
Ubqln4 T A 3: 88,565,783 V515E probably benign Het
Ush2a C T 1: 188,848,965 R3681* probably null Het
Ythdf3 A T 3: 16,203,974 N106I probably damaging Het
Zfp367 A T 13: 64,144,255 C187* probably null Het
Zfp735 A G 11: 73,712,174 D648G possibly damaging Het
Zic1 T C 9: 91,362,648 probably benign Het
Zik1 A G 7: 10,489,899 S424P probably damaging Het
Other mutations in Nin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00472:Nin APN 12 70030088 missense probably damaging 0.98
IGL00677:Nin APN 12 70026860 missense probably damaging 1.00
IGL00823:Nin APN 12 70014793 missense probably benign 0.01
IGL01103:Nin APN 12 70056758 missense probably damaging 0.99
IGL01113:Nin APN 12 70031779 missense probably damaging 1.00
IGL01420:Nin APN 12 70045414 missense probably benign 0.08
IGL01556:Nin APN 12 70043188 missense probably benign 0.01
IGL01663:Nin APN 12 70043665 missense possibly damaging 0.72
IGL02002:Nin APN 12 70062699 nonsense probably null
IGL02030:Nin APN 12 70045268 missense probably damaging 1.00
IGL02202:Nin APN 12 70055436 missense probably damaging 1.00
IGL02207:Nin APN 12 70056657 missense probably damaging 0.99
IGL02257:Nin APN 12 70102691 missense possibly damaging 0.71
IGL02394:Nin APN 12 70044031 missense probably damaging 1.00
IGL02531:Nin APN 12 70020932 missense probably benign 0.02
IGL03028:Nin APN 12 70035270 missense probably benign 0.13
IGL03155:Nin APN 12 70031770 missense probably damaging 1.00
IGL03197:Nin APN 12 70026810 missense probably benign 0.03
IGL02835:Nin UTSW 12 70056738 missense probably damaging 1.00
R0131:Nin UTSW 12 70051141 missense probably damaging 1.00
R0131:Nin UTSW 12 70051141 missense probably damaging 1.00
R0132:Nin UTSW 12 70051141 missense probably damaging 1.00
R0211:Nin UTSW 12 70014875 missense probably damaging 1.00
R0211:Nin UTSW 12 70014875 missense probably damaging 1.00
R0734:Nin UTSW 12 70030113 missense probably benign 0.01
R0947:Nin UTSW 12 70061186 missense probably damaging 1.00
R1085:Nin UTSW 12 70020962 missense possibly damaging 0.91
R1367:Nin UTSW 12 70043929 missense probably damaging 0.99
R1452:Nin UTSW 12 70017650 nonsense probably null
R1477:Nin UTSW 12 70044184 missense possibly damaging 0.87
R1518:Nin UTSW 12 70014773 missense probably benign 0.27
R1566:Nin UTSW 12 70054479 missense probably damaging 0.99
R1572:Nin UTSW 12 70038750 missense probably damaging 1.00
R1583:Nin UTSW 12 70031738 missense probably benign
R1584:Nin UTSW 12 70042669 missense probably benign 0.03
R1699:Nin UTSW 12 70030938 missense probably benign 0.40
R1699:Nin UTSW 12 70045563 missense possibly damaging 0.87
R1765:Nin UTSW 12 70042891 missense probably damaging 1.00
R1794:Nin UTSW 12 70043795 nonsense probably null
R1952:Nin UTSW 12 70030926 missense probably damaging 1.00
R2004:Nin UTSW 12 70025477 missense probably benign 0.01
R2025:Nin UTSW 12 70030008 missense probably damaging 1.00
R2060:Nin UTSW 12 70042418 missense possibly damaging 0.64
R2213:Nin UTSW 12 70045354 missense probably damaging 1.00
R2224:Nin UTSW 12 70061230 missense probably damaging 1.00
R2247:Nin UTSW 12 70054545 missense probably damaging 1.00
R2972:Nin UTSW 12 70062713 missense probably damaging 1.00
R3776:Nin UTSW 12 70038682 missense possibly damaging 0.71
R3881:Nin UTSW 12 70042541 missense probably benign 0.00
R3930:Nin UTSW 12 70078242 missense probably damaging 1.00
R3959:Nin UTSW 12 70050752 missense probably damaging 1.00
R4229:Nin UTSW 12 70051210 missense probably damaging 0.99
R4359:Nin UTSW 12 70014938 missense probably benign 0.00
R4423:Nin UTSW 12 70042978 missense probably damaging 1.00
R4461:Nin UTSW 12 70042585 missense probably benign 0.37
R4639:Nin UTSW 12 70038601 missense probably damaging 0.97
R4791:Nin UTSW 12 70043807 missense possibly damaging 0.94
R4839:Nin UTSW 12 70090551 missense possibly damaging 0.46
R4912:Nin UTSW 12 70044063 missense probably damaging 1.00
R5712:Nin UTSW 12 70042769 missense probably damaging 1.00
R5726:Nin UTSW 12 70078179 missense probably damaging 1.00
R5804:Nin UTSW 12 70045601 missense possibly damaging 0.58
R5874:Nin UTSW 12 70030918 missense possibly damaging 0.94
R5992:Nin UTSW 12 70045524 missense possibly damaging 0.83
R6077:Nin UTSW 12 70019232 missense probably damaging 1.00
R6184:Nin UTSW 12 70043737 missense probably damaging 1.00
R6307:Nin UTSW 12 70014857 missense possibly damaging 0.91
R6315:Nin UTSW 12 70045615 missense probably damaging 1.00
R6326:Nin UTSW 12 70045181 missense possibly damaging 0.95
R6492:Nin UTSW 12 70054534 missense probably benign 0.22
R6562:Nin UTSW 12 70055954 missense probably damaging 1.00
R6578:Nin UTSW 12 70061194 missense probably damaging 0.99
R6613:Nin UTSW 12 70030954 missense probably damaging 1.00
R7112:Nin UTSW 12 70102799 missense
R7170:Nin UTSW 12 70044239 missense
R7324:Nin UTSW 12 70043734 missense
R7338:Nin UTSW 12 70044064 missense
R7372:Nin UTSW 12 70056029 missense
R7431:Nin UTSW 12 70078223 missense
R7577:Nin UTSW 12 70062706 missense
R7655:Nin UTSW 12 70042768 missense
R7656:Nin UTSW 12 70042768 missense
R7683:Nin UTSW 12 70078182 missense
R7769:Nin UTSW 12 70043230 missense
R7981:Nin UTSW 12 70042817 missense
R8138:Nin UTSW 12 70042898 missense
R8141:Nin UTSW 12 70030021 missense
R8790:Nin UTSW 12 70021019 missense
R8899:Nin UTSW 12 70030936 missense probably damaging 1.00
R8974:Nin UTSW 12 70078158 missense
R9085:Nin UTSW 12 70030012 nonsense probably null
R9143:Nin UTSW 12 70090575 missense
Z1176:Nin UTSW 12 70049164 critical splice acceptor site probably null
Z1177:Nin UTSW 12 70044095 missense
Z1177:Nin UTSW 12 70054426 missense
Predicted Primers PCR Primer
(F):5'- CCTGGGCCTTTCTTTGGAAG -3'
(R):5'- ACTTCCTGCCCTCAAAATAGG -3'

Sequencing Primer
(F):5'- CCTTTCTTTGGAAGGTGAAAGTAC -3'
(R):5'- CTGCCCTCAAAATAGGATATGCTGG -3'
Posted On2021-11-22