Mutagenetix > Incidental Mutation

Incidental Mutation 'R8824:Zeb1'

690361

Institutional Source

Beutler Lab

Gene Symbol

Zeb1

Ensembl Gene

ENSMUSG00000024238

Gene Name

zinc finger E-box binding homeobox 1

Synonyms

3110032K11Rik, Tw, MEB1, Zfhx1a, Zfhep, ZEB, AREB6, Zfx1a, Tcf18, Nil2, Tcf8, [delta]EF1

MMRRC Submission

Accession Numbers

Genbank: NM_011546; MGI: 1344313

Essential gene?

Probably essential (E-score: 0.956) question?

Stock #

R8824 (G1)

Quality Score

193.009

Status

Validated

Chromosome

Chromosomal Location

5591860-5775467 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 5748680 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000135125 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025081] [ENSMUST00000159390] [ENSMUST00000160910] [ENSMUST00000175925]

AlphaFold

Q64318

Predicted Effect

probably benign
Transcript: ENSMUST00000025081

SMART Domains

Protein: ENSMUSP00000025081
Gene: ENSMUSG00000024238

Domain	Start	End	E-Value	Type
low complexity region	13	30	N/A	INTRINSIC
ZnF_C2H2	150	173	3.16e-3	SMART
ZnF_C2H2	180	202	3.21e-4	SMART
ZnF_C2H2	220	242	4.87e-4	SMART
ZnF_C2H2	248	268	1.86e1	SMART
low complexity region	288	304	N/A	INTRINSIC
low complexity region	532	555	N/A	INTRINSIC
HOX	559	621	7.53e-3	SMART
low complexity region	730	742	N/A	INTRINSIC
low complexity region	766	783	N/A	INTRINSIC
ZnF_C2H2	882	904	1.18e-2	SMART
ZnF_C2H2	910	932	4.4e-2	SMART
ZnF_C2H2	938	959	1.89e-1	SMART
coiled coil region	1006	1077	N/A	INTRINSIC
low complexity region	1096	1112	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000159390

SMART Domains

Protein: ENSMUSP00000124395
Gene: ENSMUSG00000024238

Domain	Start	End	E-Value	Type
low complexity region	13	30	N/A	INTRINSIC
ZnF_C2H2	96	119	3.16e-3	SMART
ZnF_C2H2	126	148	3.21e-4	SMART
ZnF_C2H2	166	188	4.87e-4	SMART
ZnF_C2H2	194	214	1.86e1	SMART
low complexity region	234	250	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000160910

SMART Domains

Protein: ENSMUSP00000124815
Gene: ENSMUSG00000024238

Domain	Start	End	E-Value	Type
ZnF_C2H2	133	153	1.2e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000161295

Predicted Effect

probably benign
Transcript: ENSMUST00000175925

SMART Domains

Protein: ENSMUSP00000135125
Gene: ENSMUSG00000024238

Domain	Start	End	E-Value	Type
ZnF_C2H2	130	153	3.16e-3	SMART
ZnF_C2H2	160	182	3.21e-4	SMART
ZnF_C2H2	200	222	4.87e-4	SMART
ZnF_C2H2	228	248	1.86e1	SMART
low complexity region	268	284	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

100% (63/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger transcription factor. The encoded protein likely plays a role in transcriptional repression of interleukin 2. Mutations in this gene have been associated with posterior polymorphous corneal dystrophy-3 and late-onset Fuchs endothelial corneal dystrophy. Alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mutations at this locus affect thymus organization and homozygotes exhibit severe thymic T cell deficiency. Some mutations result in eye anomalies and extensive skeletal abnormalities. Homozygotes generally die at birth due to respiratory failure. [provided by MGI curators]

Allele List at MGI

All alleles(6) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(4)

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Accsl	A	T	2: 93,862,850	V260D	probably damaging	Het
Adora2a	G	A	10: 75,326,179	A51T	probably damaging	Het
Afg1l	G	A	10: 42,438,387	P128S	possibly damaging	Het
Ago4	C	A	4: 126,507,184	V623L	probably benign	Het
Akap11	A	T	14: 78,516,347	N112K		Het
C1ra	A	T	6: 124,517,695	I306F	probably damaging	Het
Ccdc73	A	G	2: 104,991,877	N724D	possibly damaging	Het
Cd248	A	G	19: 5,069,617	I498V	probably benign	Het
Clrn1	A	T	3: 58,884,893	S50T	probably benign	Het
Col7a1	A	G	9: 108,967,025	K1553R	unknown	Het
Cxcr6	A	C	9: 123,810,941	T343P	probably benign	Het
Cyp11b2	T	A	15: 74,856,065	Q56L	probably damaging	Het
Dip2a	A	G	10: 76,278,486		probably null	Het
Dnmbp	A	G	19: 43,849,837	V742A	probably benign	Het
Dusp16	A	T	6: 134,739,769	S192T	probably benign	Het
Ehbp1	A	T	11: 22,232,053	D87E	probably damaging	Het
Fgl1	A	G	8: 41,199,711	V150A	probably benign	Het
Flt3	T	C	5: 147,334,863	D873G	probably damaging	Het
Gart	T	C	16: 91,630,703	D469G	possibly damaging	Het
Gm28168	T	G	1: 117,947,895	S85A	probably benign	Het
Golgb1	A	G	16: 36,915,689	D1807G	probably benign	Het
Grm8	A	G	6: 27,761,352	L291S	probably damaging	Het
Gucy2d	C	T	7: 98,443,469	P18S	possibly damaging	Het
Ifna15	C	T	4: 88,557,761	C162Y	probably damaging	Het
Iqub	C	A	6: 24,479,308	E412*	probably null	Het
Krt4	T	A	15: 101,920,642	D312V		Het
Krtap26-1	A	T	16: 88,647,415	I106N	probably damaging	Het
Krtap26-1	T	C	16: 88,647,436	Y99C	probably damaging	Het
Lipn	T	C	19: 34,084,716	I357T	probably benign	Het
Lrrc14b	A	G	13: 74,363,949	L4P	probably damaging	Het
Mrgpra9	A	T	7: 47,235,293	C209S	probably benign	Het
Myh7b	A	G	2: 155,630,381	N1291D	probably benign	Het
Myo5a	A	G	9: 75,167,046	T746A	probably damaging	Het
Myom2	A	C	8: 15,114,169	E1021D	possibly damaging	Het
Ncoa2	C	T	1: 13,177,185	R338H	probably benign	Het
Ncor2	A	G	5: 125,118,757	F91L		Het
Neb	C	G	2: 52,216,911	A4407P	probably damaging	Het
Olfr1135	T	C	2: 87,671,960	M136V	possibly damaging	Het
Olfr1272	A	G	2: 90,296,012	I283T	probably damaging	Het
Olfr347	A	T	2: 36,735,191	Y290F	probably damaging	Het
Olfr502	T	G	7: 108,523,143	Y269S	probably benign	Het
Olfr74	A	G	2: 87,974,003	F221L	probably benign	Het
Olfr819	C	T	10: 129,965,792	V297M	probably damaging	Het
Peg10	T	TCCC	6: 4,756,451		probably benign	Het
Piwil4	C	A	9: 14,727,475	K298N	probably benign	Het
Prkcz	G	A	4: 155,344,828		probably benign	Het
Prkg2	G	A	5: 98,942,208	P691L	possibly damaging	Het
Ptprc	T	A	1: 138,113,708	K89*	probably null	Het
Rapgef3	C	T	15: 97,766,908	A25T	probably benign	Het
Rreb1	C	T	13: 37,930,516	T617I	probably damaging	Het
Rsph1	A	C	17: 31,273,376	V72G	possibly damaging	Het
Shc2	A	G	10: 79,637,702	V50A	probably benign	Het
Slc38a9	G	A	13: 112,701,487	R262H	probably benign	Het
Slco6c1	T	A	1: 97,128,159	N6Y	possibly damaging	Het
Smarca5	A	G	8: 80,705,332	F886L	probably benign	Het
Tas1r2	A	G	4: 139,653,763		probably benign	Het
Tnrc6c	T	A	11: 117,739,854		probably benign	Het
Trim30b	T	A	7: 104,357,906		probably benign	Het
Trim55	T	C	3: 19,672,962	S398P	probably benign	Het
Ttc39c	T	A	18: 12,686,946		probably benign	Het
Ubxn10	A	G	4: 138,735,867		probably null	Het
Usf3	A	G	16: 44,215,613	N152S	probably benign	Het
Vps13b	T	A	15: 35,533,299	V839E	probably damaging	Het
Zfp780b	T	C	7: 27,963,468	Y554C	probably benign	Het
Zhx2	C	T	15: 57,821,280	T15I	probably damaging	Het

Other mutations in Zeb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00833:Zeb1	APN	18	5767774	missense	probably benign	0.00
IGL01139:Zeb1	APN	18	5705061	missense	possibly damaging	0.69
IGL01444:Zeb1	APN	18	5767906	missense	probably damaging	1.00
IGL01444:Zeb1	APN	18	5767138	missense	probably benign
IGL01806:Zeb1	APN	18	5767867	missense	possibly damaging	0.94
IGL01988:Zeb1	APN	18	5759037	nonsense	probably null
IGL02059:Zeb1	APN	18	5766892	missense	probably damaging	1.00
IGL03005:Zeb1	APN	18	5767150	missense	probably benign	0.03
IGL03153:Zeb1	APN	18	5770511	missense	probably damaging	1.00
Apes	UTSW	18	5761394	missense	probably damaging	1.00
cellophane	UTSW	18	5770554	nonsense	probably null
serpens	UTSW	18	5772455	missense	probably damaging	1.00
N/A - 293:Zeb1	UTSW	18	5767076	missense	possibly damaging	0.68
R0184:Zeb1	UTSW	18	5766808	missense	probably damaging	1.00
R0488:Zeb1	UTSW	18	5772455	missense	probably damaging	1.00
R0622:Zeb1	UTSW	18	5759123	nonsense	probably null
R0646:Zeb1	UTSW	18	5759027	missense	probably damaging	1.00
R0881:Zeb1	UTSW	18	5767138	missense	probably benign
R1251:Zeb1	UTSW	18	5705089	missense	probably damaging	1.00
R1257:Zeb1	UTSW	18	5772699	missense	possibly damaging	0.53
R1501:Zeb1	UTSW	18	5761399	missense	possibly damaging	0.95
R1547:Zeb1	UTSW	18	5767450	missense	possibly damaging	0.50
R1797:Zeb1	UTSW	18	5766298	nonsense	probably null
R1815:Zeb1	UTSW	18	5767898	missense	probably damaging	1.00
R2090:Zeb1	UTSW	18	5766458	missense	possibly damaging	0.65
R2129:Zeb1	UTSW	18	5767681	missense	possibly damaging	0.92
R2875:Zeb1	UTSW	18	5772859	small insertion	probably benign
R3888:Zeb1	UTSW	18	5748743	missense	probably damaging	1.00
R3941:Zeb1	UTSW	18	5767799	missense	probably benign	0.06
R3952:Zeb1	UTSW	18	5772716	missense	probably benign	0.17
R4271:Zeb1	UTSW	18	5758985	missense	probably damaging	0.99
R4512:Zeb1	UTSW	18	5759007	missense	probably damaging	1.00
R4514:Zeb1	UTSW	18	5759007	missense	probably damaging	1.00
R4677:Zeb1	UTSW	18	5766775	missense	probably damaging	0.97
R4729:Zeb1	UTSW	18	5767286	missense	probably damaging	1.00
R5839:Zeb1	UTSW	18	5767507	missense	probably benign
R5913:Zeb1	UTSW	18	5766765	missense	possibly damaging	0.49
R6248:Zeb1	UTSW	18	5766962	missense	probably damaging	1.00
R6354:Zeb1	UTSW	18	5772743	missense	possibly damaging	0.64
R6429:Zeb1	UTSW	18	5770498	missense	probably damaging	1.00
R6819:Zeb1	UTSW	18	5591917	missense	probably damaging	1.00
R7180:Zeb1	UTSW	18	5767867	missense	possibly damaging	0.94
R7193:Zeb1	UTSW	18	5772756	missense	probably damaging	0.98
R7199:Zeb1	UTSW	18	5767703	missense	probably benign	0.00
R7397:Zeb1	UTSW	18	5761394	missense	probably damaging	1.00
R7534:Zeb1	UTSW	18	5766611	missense	probably damaging	1.00
R7702:Zeb1	UTSW	18	5766802	missense	probably damaging	1.00
R7703:Zeb1	UTSW	18	5766917	missense	probably benign
R7934:Zeb1	UTSW	18	5748703	missense	probably benign	0.00
R8504:Zeb1	UTSW	18	5705127	missense	possibly damaging	0.94
R8539:Zeb1	UTSW	18	5748784	missense	probably damaging	0.99
R8716:Zeb1	UTSW	18	5767958	missense	probably damaging	0.99
R8772:Zeb1	UTSW	18	5770382	critical splice acceptor site	probably null
R9082:Zeb1	UTSW	18	5772557	missense	probably damaging	0.98
R9085:Zeb1	UTSW	18	5766716	missense	probably damaging	1.00
R9456:Zeb1	UTSW	18	5766709	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TCCAGCATCCACAGCACTTG -3'
(R):5'- CTGAGAACGAGGATCACGTG -3'

Sequencing Primer
(F):5'- GCACTTGAATCTAAAGCAAATGC -3'
(R):5'- AGGATCACGTGCTAAGCTGTACTC -3'

Posted On

2021-12-16