Incidental Mutation 'R9083:Xrn2'
ID 690382
Institutional Source Beutler Lab
Gene Symbol Xrn2
Ensembl Gene ENSMUSG00000027433
Gene Name 5'-3' exoribonuclease 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock # R9083 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 147012996-147078000 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 147038279 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 507 (D507E)
Ref Sequence ENSEMBL: ENSMUSP00000028921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028921]
AlphaFold Q9DBR1
Predicted Effect probably damaging
Transcript: ENSMUST00000028921
AA Change: D507E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028921
Gene: ENSMUSG00000027433
AA Change: D507E

DomainStartEndE-ValueType
Pfam:XRN_N 1 254 1.5e-104 PFAM
ZnF_C2HC 262 278 7.99e-1 SMART
low complexity region 415 427 N/A INTRINSIC
PDB:3FQD|A 469 785 8e-75 PDB
low complexity region 913 932 N/A INTRINSIC
Meta Mutation Damage Score 0.1153 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 5'-3' exonuclease that promotes transcription termination at cotranscriptional cleavage sites. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A T 6: 128,557,561 S844R possibly damaging Het
Adig C A 2: 158,505,789 probably benign Het
Aspm A G 1: 139,493,698 N3106S possibly damaging Het
Bcas1 A T 2: 170,348,161 probably benign Het
Bco1 A C 8: 117,117,404 I286L probably benign Het
Bnc1 C T 7: 81,974,898 V194I probably benign Het
Bptf G A 11: 107,068,350 R1912W probably damaging Het
Cacna1a A G 8: 84,617,882 I1858V probably benign Het
Ccdc155 G A 7: 45,204,634 R24C unknown Het
Chdh T C 14: 30,031,746 F204S probably damaging Het
Cic A G 7: 25,286,045 T1212A probably damaging Het
Cpne7 C T 8: 123,130,212 P402L probably damaging Het
Cts8 A G 13: 61,249,222 Y295H probably damaging Het
Cyp1a2 T C 9: 57,680,289 T333A probably benign Het
Cyp2a12 T C 7: 27,036,519 F451S probably damaging Het
Dmxl2 T C 9: 54,409,264 I1613V probably benign Het
Eme1 A G 11: 94,650,132 L260S probably damaging Het
Ermp1 A C 19: 29,646,015 S192A probably benign Het
Fam186a T C 15: 99,945,198 Q1055R probably benign Het
Fat1 C T 8: 45,013,090 T1462M possibly damaging Het
Fat1 A G 8: 45,038,299 N3822S probably benign Het
Gm340 G T 19: 41,586,400 R1198L probably damaging Het
Gm884 A C 11: 103,619,004 S713A unknown Het
Gm973 A G 1: 59,636,158 T225A Het
Gnl2 A G 4: 125,047,564 Y367C probably damaging Het
Golga5 T A 12: 102,492,217 S640T probably benign Het
Inafm1 A G 7: 16,273,271 V7A unknown Het
Irx2 A G 13: 72,629,273 D71G possibly damaging Het
Kif13a T C 13: 46,812,787 Y448C probably damaging Het
Ldlrad4 A T 18: 68,064,675 N10I probably benign Het
Lix1 T C 17: 17,457,130 Y196H possibly damaging Het
Mon1a A G 9: 107,902,636 Y468C probably damaging Het
Mroh4 A T 15: 74,626,291 I177N probably damaging Het
Mterf4 A T 1: 93,301,793 Y236* probably null Het
Myo1f T A 17: 33,594,062 I614N probably damaging Het
Nbas T A 12: 13,335,855 S707T possibly damaging Het
Ncl A T 1: 86,351,461 S577T possibly damaging Het
Olfr120 T A 17: 37,726,169 N48K probably damaging Het
Olfr146 A G 9: 39,018,720 S274P probably damaging Het
Olfr607 T C 7: 103,460,689 D173G Het
Olfr769 A T 10: 129,112,023 M134K probably damaging Het
Olfr822 A T 10: 130,075,072 M221L probably benign Het
Olfr822 G C 10: 130,075,100 S230T probably benign Het
Olfr829 A T 9: 18,857,254 I201F probably benign Het
Padi1 C A 4: 140,832,291 probably null Het
Patj G A 4: 98,513,634 V1004M probably benign Het
Pcdhb9 A T 18: 37,402,717 D588V probably damaging Het
Pdzph1 C A 17: 58,954,400 R879L possibly damaging Het
Pla2g2c G A 4: 138,736,067 V91I probably benign Het
Plin4 T C 17: 56,109,345 D53G possibly damaging Het
Poll T C 19: 45,557,878 Q241R probably benign Het
Recql5 A T 11: 115,894,649 L674M possibly damaging Het
Shroom3 G A 5: 92,950,674 G1338S probably damaging Het
Slc38a8 C T 8: 119,486,041 V294I probably benign Het
Slc4a1ap T C 5: 31,527,113 V31A probably benign Het
Tln2 G A 9: 67,362,645 P489S probably damaging Het
Trappc9 G A 15: 72,736,777 R928* probably null Het
Uba7 C A 9: 107,977,967 T343N probably benign Het
Vasn C T 16: 4,650,007 T606I probably benign Het
Zfp592 T A 7: 81,024,896 M536K possibly damaging Het
Zfp932 A T 5: 110,009,234 H266L probably damaging Het
Other mutations in Xrn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Xrn2 APN 2 147036750 missense probably benign 0.00
IGL00950:Xrn2 APN 2 147028146 nonsense probably null
IGL01323:Xrn2 APN 2 147034847 splice site probably benign
IGL01328:Xrn2 APN 2 147029930 missense possibly damaging 0.90
IGL01545:Xrn2 APN 2 147038179 missense probably benign
IGL01729:Xrn2 APN 2 147036797 critical splice donor site probably null
IGL01805:Xrn2 APN 2 147028143 missense probably damaging 0.98
IGL02326:Xrn2 APN 2 147047713 missense probably benign 0.32
IGL02332:Xrn2 APN 2 147026590 missense probably damaging 1.00
IGL02556:Xrn2 APN 2 147038296 splice site probably benign
IGL02609:Xrn2 APN 2 147050025 missense probably benign 0.00
IGL02941:Xrn2 APN 2 147026524 missense probably damaging 1.00
IGL03119:Xrn2 APN 2 147042872 missense probably damaging 1.00
R0052:Xrn2 UTSW 2 147040965 splice site probably benign
R0114:Xrn2 UTSW 2 147029779 missense probably damaging 0.98
R0196:Xrn2 UTSW 2 147047660 missense probably damaging 0.99
R0799:Xrn2 UTSW 2 147029898 missense probably benign 0.03
R0991:Xrn2 UTSW 2 147042082 missense probably benign 0.40
R1444:Xrn2 UTSW 2 147061488 missense probably damaging 0.99
R1727:Xrn2 UTSW 2 147061516 missense probably benign 0.00
R1735:Xrn2 UTSW 2 147061423 missense probably damaging 1.00
R1885:Xrn2 UTSW 2 147049361 nonsense probably null
R2199:Xrn2 UTSW 2 147024750 missense probably damaging 0.96
R2884:Xrn2 UTSW 2 147047656 missense probably damaging 1.00
R3730:Xrn2 UTSW 2 147024809 missense probably benign 0.09
R3771:Xrn2 UTSW 2 147061287 missense probably benign 0.12
R3772:Xrn2 UTSW 2 147061287 missense probably benign 0.12
R3773:Xrn2 UTSW 2 147061287 missense probably benign 0.12
R3816:Xrn2 UTSW 2 147028200 missense probably damaging 1.00
R3927:Xrn2 UTSW 2 147038189 missense probably benign
R4173:Xrn2 UTSW 2 147047692 missense probably damaging 0.96
R4659:Xrn2 UTSW 2 147061474 missense probably benign 0.01
R4928:Xrn2 UTSW 2 147051718 missense possibly damaging 0.80
R5452:Xrn2 UTSW 2 147024713 critical splice acceptor site probably null
R5527:Xrn2 UTSW 2 147029755 missense probably benign 0.02
R6297:Xrn2 UTSW 2 147026570 missense probably damaging 1.00
R6301:Xrn2 UTSW 2 147063342 missense probably benign 0.05
R6316:Xrn2 UTSW 2 147042010 missense probably damaging 1.00
R6705:Xrn2 UTSW 2 147036662 critical splice acceptor site probably null
R7173:Xrn2 UTSW 2 147042093 missense probably damaging 1.00
R7408:Xrn2 UTSW 2 147042097 critical splice donor site probably null
R7412:Xrn2 UTSW 2 147049346 missense probably damaging 0.99
R7501:Xrn2 UTSW 2 147029756 missense probably damaging 1.00
R7856:Xrn2 UTSW 2 147068473 splice site probably null
R8912:Xrn2 UTSW 2 147049993 missense probably benign 0.04
R8969:Xrn2 UTSW 2 147029384 missense probably damaging 1.00
R9179:Xrn2 UTSW 2 147013161 missense probably benign 0.04
Z1177:Xrn2 UTSW 2 147028206 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GCTGTTACCGTGAAACTTGG -3'
(R):5'- CAATAGCTTACACATCTCCCTGG -3'

Sequencing Primer
(F):5'- TACCGTGAAACTTGGTAAGTGG -3'
(R):5'- ACACATCTCCCTGGAATTAGTG -3'
Posted On 2021-12-30