Mutagenetix > Incidental Mutation

Incidental Mutation 'R9083:A2ml1'

690390

Institutional Source

Beutler Lab

Gene Symbol

A2ml1

Ensembl Gene

ENSMUSG00000047228

Gene Name

alpha-2-macroglobulin like 1

Synonyms

MMRRC Submission

Accession Numbers

Genbank: NM_001001179.3; Ensembl: ENSMUST00000060574

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9083 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

128539821-128581608 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 128557561 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 844 (S844R)

Ref Sequence

ENSEMBL: ENSMUSP00000059426 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060574]

AlphaFold

Q3UU35

Predicted Effect

possibly damaging
Transcript: ENSMUST00000060574
AA Change: S844R

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000059426
Gene: ENSMUSG00000047228
AA Change: S844R

Domain	Start	End	E-Value	Type
low complexity region	42	58	N/A	INTRINSIC
Pfam:A2M_N	120	213	6.3e-17	PFAM
A2M_N_2	448	594	2.95e-37	SMART
A2M	736	826	2.11e-33	SMART
Pfam:Thiol-ester_cl	959	988	3.1e-17	PFAM
Pfam:A2M_comp	1008	1255	2.3e-71	PFAM
A2M_recep	1361	1447	1.22e-29	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.5%

Validation Efficiency

100% (61/61)

Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adig	C	A	2: 158,505,789		probably benign	Het
Aspm	A	G	1: 139,493,698	N3106S	possibly damaging	Het
Bcas1	A	T	2: 170,348,161		probably benign	Het
Bco1	A	C	8: 117,117,404	I286L	probably benign	Het
Bnc1	C	T	7: 81,974,898	V194I	probably benign	Het
Bptf	G	A	11: 107,068,350	R1912W	probably damaging	Het
Cacna1a	A	G	8: 84,617,882	I1858V	probably benign	Het
Ccdc155	G	A	7: 45,204,634	R24C	unknown	Het
Chdh	T	C	14: 30,031,746	F204S	probably damaging	Het
Cic	A	G	7: 25,286,045	T1212A	probably damaging	Het
Cpne7	C	T	8: 123,130,212	P402L	probably damaging	Het
Cts8	A	G	13: 61,249,222	Y295H	probably damaging	Het
Cyp1a2	T	C	9: 57,680,289	T333A	probably benign	Het
Cyp2a12	T	C	7: 27,036,519	F451S	probably damaging	Het
Dmxl2	T	C	9: 54,409,264	I1613V	probably benign	Het
Eme1	A	G	11: 94,650,132	L260S	probably damaging	Het
Ermp1	A	C	19: 29,646,015	S192A	probably benign	Het
Fam186a	T	C	15: 99,945,198	Q1055R	probably benign	Het
Fat1	C	T	8: 45,013,090	T1462M	possibly damaging	Het
Fat1	A	G	8: 45,038,299	N3822S	probably benign	Het
Gm340	G	T	19: 41,586,400	R1198L	probably damaging	Het
Gm884	A	C	11: 103,619,004	S713A	unknown	Het
Gm973	A	G	1: 59,636,158	T225A		Het
Gnl2	A	G	4: 125,047,564	Y367C	probably damaging	Het
Golga5	T	A	12: 102,492,217	S640T	probably benign	Het
Inafm1	A	G	7: 16,273,271	V7A	unknown	Het
Irx2	A	G	13: 72,629,273	D71G	possibly damaging	Het
Kif13a	T	C	13: 46,812,787	Y448C	probably damaging	Het
Ldlrad4	A	T	18: 68,064,675	N10I	probably benign	Het
Lix1	T	C	17: 17,457,130	Y196H	possibly damaging	Het
Mon1a	A	G	9: 107,902,636	Y468C	probably damaging	Het
Mroh4	A	T	15: 74,626,291	I177N	probably damaging	Het
Mterf4	A	T	1: 93,301,793	Y236*	probably null	Het
Myo1f	T	A	17: 33,594,062	I614N	probably damaging	Het
Nbas	T	A	12: 13,335,855	S707T	possibly damaging	Het
Ncl	A	T	1: 86,351,461	S577T	possibly damaging	Het
Olfr120	T	A	17: 37,726,169	N48K	probably damaging	Het
Olfr146	A	G	9: 39,018,720	S274P	probably damaging	Het
Olfr607	T	C	7: 103,460,689	D173G		Het
Olfr769	A	T	10: 129,112,023	M134K	probably damaging	Het
Olfr822	A	T	10: 130,075,072	M221L	probably benign	Het
Olfr822	G	C	10: 130,075,100	S230T	probably benign	Het
Olfr829	A	T	9: 18,857,254	I201F	probably benign	Het
Padi1	C	A	4: 140,832,291		probably null	Het
Patj	G	A	4: 98,513,634	V1004M	probably benign	Het
Pcdhb9	A	T	18: 37,402,717	D588V	probably damaging	Het
Pdzph1	C	A	17: 58,954,400	R879L	possibly damaging	Het
Pla2g2c	G	A	4: 138,736,067	V91I	probably benign	Het
Plin4	T	C	17: 56,109,345	D53G	possibly damaging	Het
Poll	T	C	19: 45,557,878	Q241R	probably benign	Het
Recql5	A	T	11: 115,894,649	L674M	possibly damaging	Het
Shroom3	G	A	5: 92,950,674	G1338S	probably damaging	Het
Slc38a8	C	T	8: 119,486,041	V294I	probably benign	Het
Slc4a1ap	T	C	5: 31,527,113	V31A	probably benign	Het
Tln2	G	A	9: 67,362,645	P489S	probably damaging	Het
Trappc9	G	A	15: 72,736,777	R928*	probably null	Het
Uba7	C	A	9: 107,977,967	T343N	probably benign	Het
Vasn	C	T	16: 4,650,007	T606I	probably benign	Het
Xrn2	T	A	2: 147,038,279	D507E	probably damaging	Het
Zfp592	T	A	7: 81,024,896	M536K	possibly damaging	Het
Zfp932	A	T	5: 110,009,234	H266L	probably damaging	Het

Other mutations in A2ml1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00513:A2ml1	APN	6	128578156	missense	possibly damaging	0.78
IGL00596:A2ml1	APN	6	128570067	missense	probably damaging	0.99
IGL00912:A2ml1	APN	6	128552307	missense	probably benign	0.04
IGL01320:A2ml1	APN	6	128575588	missense	probably benign	0.00
IGL01470:A2ml1	APN	6	128580412	missense	probably damaging	0.96
IGL01576:A2ml1	APN	6	128554330	splice site	probably benign
IGL01761:A2ml1	APN	6	128546337	missense	possibly damaging	0.61
IGL01792:A2ml1	APN	6	128560679	missense	probably benign	0.04
IGL01843:A2ml1	APN	6	128553338	splice site	probably benign
IGL01946:A2ml1	APN	6	128570479	missense	possibly damaging	0.81
IGL02016:A2ml1	APN	6	128558335	missense	probably damaging	1.00
IGL02170:A2ml1	APN	6	128547210	missense	possibly damaging	0.58
IGL02269:A2ml1	APN	6	128553338	splice site	probably benign
IGL02589:A2ml1	APN	6	128581500	missense	probably benign	0.00
IGL02959:A2ml1	APN	6	128567060	missense	probably benign	0.04
IGL02970:A2ml1	APN	6	128569979	missense	probably damaging	1.00
IGL03206:A2ml1	APN	6	128553276	missense	possibly damaging	0.50
IGL03298:A2ml1	APN	6	128543960	missense	probably benign	0.00
1mM(1):A2ml1	UTSW	6	128580960	missense	probably benign	0.02
R0055:A2ml1	UTSW	6	128570094	splice site	probably benign
R0055:A2ml1	UTSW	6	128570094	splice site	probably benign
R0069:A2ml1	UTSW	6	128561562	missense	probably damaging	1.00
R0069:A2ml1	UTSW	6	128561562	missense	probably damaging	1.00
R0128:A2ml1	UTSW	6	128575639	splice site	probably benign
R0299:A2ml1	UTSW	6	128553232	splice site	probably benign
R0523:A2ml1	UTSW	6	128558326	missense	possibly damaging	0.92
R0565:A2ml1	UTSW	6	128568743	nonsense	probably null
R0599:A2ml1	UTSW	6	128552245	missense	probably damaging	1.00
R0626:A2ml1	UTSW	6	128550773	missense	probably damaging	0.99
R0732:A2ml1	UTSW	6	128546448	missense	probably damaging	1.00
R0880:A2ml1	UTSW	6	128560646	missense	possibly damaging	0.49
R1070:A2ml1	UTSW	6	128543300	missense	probably damaging	1.00
R1166:A2ml1	UTSW	6	128570917	missense	probably benign	0.00
R1278:A2ml1	UTSW	6	128558507	missense	probably damaging	1.00
R1421:A2ml1	UTSW	6	128543960	missense	probably benign	0.00
R1536:A2ml1	UTSW	6	128547233	nonsense	probably null
R1786:A2ml1	UTSW	6	128576260	missense	probably damaging	1.00
R1808:A2ml1	UTSW	6	128543299	missense	probably damaging	1.00
R1813:A2ml1	UTSW	6	128566273	missense	probably benign	0.34
R1863:A2ml1	UTSW	6	128550783	missense	probably damaging	0.99
R2007:A2ml1	UTSW	6	128542892	missense	probably benign	0.13
R2062:A2ml1	UTSW	6	128552308	missense	probably benign	0.08
R2127:A2ml1	UTSW	6	128558437	missense	probably damaging	1.00
R2130:A2ml1	UTSW	6	128576260	missense	probably damaging	1.00
R2131:A2ml1	UTSW	6	128576260	missense	probably damaging	1.00
R2201:A2ml1	UTSW	6	128547305	missense	probably null	0.34
R2319:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R2321:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R2322:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R2369:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R2370:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R2371:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R2372:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R2375:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R2893:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R2894:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R3438:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R3615:A2ml1	UTSW	6	128558294	missense	probably benign	0.07
R3616:A2ml1	UTSW	6	128558294	missense	probably benign	0.07
R3773:A2ml1	UTSW	6	128555083	missense	probably benign	0.02
R3785:A2ml1	UTSW	6	128544924	critical splice donor site	probably null
R3803:A2ml1	UTSW	6	128545070	missense	probably benign	0.17
R3824:A2ml1	UTSW	6	128568763	missense	probably damaging	0.99
R3878:A2ml1	UTSW	6	128554361	missense	probably benign	0.05
R4176:A2ml1	UTSW	6	128545037	missense	possibly damaging	0.68
R4229:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R4230:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R4348:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R4351:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R4352:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R4353:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R4427:A2ml1	UTSW	6	128545046	missense	probably benign	0.00
R4971:A2ml1	UTSW	6	128547227	missense	probably damaging	0.98
R5014:A2ml1	UTSW	6	128543933	missense	probably benign	0.00
R5369:A2ml1	UTSW	6	128568833	missense	probably damaging	0.97
R5532:A2ml1	UTSW	6	128553330	critical splice acceptor site	probably null
R5860:A2ml1	UTSW	6	128541061	missense	probably benign	0.15
R5872:A2ml1	UTSW	6	128561526	missense	probably damaging	1.00
R5926:A2ml1	UTSW	6	128560645	missense	probably benign
R5977:A2ml1	UTSW	6	128581122	missense	probably damaging	1.00
R5980:A2ml1	UTSW	6	128567055	missense	possibly damaging	0.82
R6014:A2ml1	UTSW	6	128571985	missense	probably damaging	1.00
R6032:A2ml1	UTSW	6	128549836	nonsense	probably null
R6032:A2ml1	UTSW	6	128549836	nonsense	probably null
R6061:A2ml1	UTSW	6	128568712	missense	probably damaging	1.00
R6327:A2ml1	UTSW	6	128558692	splice site	probably null
R6331:A2ml1	UTSW	6	128552236	missense	probably damaging	0.96
R6465:A2ml1	UTSW	6	128541078	missense	probably damaging	1.00
R6640:A2ml1	UTSW	6	128553285	missense	probably benign	0.41
R6792:A2ml1	UTSW	6	128546329	nonsense	probably null
R6793:A2ml1	UTSW	6	128546329	nonsense	probably null
R7207:A2ml1	UTSW	6	128550771	missense	probably benign	0.04
R7378:A2ml1	UTSW	6	128546247	critical splice donor site	probably null
R7556:A2ml1	UTSW	6	128569964	missense	probably damaging	1.00
R8010:A2ml1	UTSW	6	128580340	missense	probably benign	0.08
R8017:A2ml1	UTSW	6	128581447	critical splice donor site	probably null
R8019:A2ml1	UTSW	6	128581447	critical splice donor site	probably null
R8035:A2ml1	UTSW	6	128553280	missense	probably damaging	0.99
R8094:A2ml1	UTSW	6	128572082	missense	probably damaging	1.00
R8144:A2ml1	UTSW	6	128569999	missense	possibly damaging	0.84
R8365:A2ml1	UTSW	6	128580955	nonsense	probably null
R8382:A2ml1	UTSW	6	128560682	missense	probably benign	0.01
R8388:A2ml1	UTSW	6	128571974	missense	probably benign	0.03
R8717:A2ml1	UTSW	6	128566995	missense	probably benign	0.00
R8947:A2ml1	UTSW	6	128552256	missense	probably damaging	1.00
R8970:A2ml1	UTSW	6	128568763	missense	probably damaging	0.99
R9025:A2ml1	UTSW	6	128557582	missense	possibly damaging	0.49
R9129:A2ml1	UTSW	6	128546260	missense	probably damaging	1.00
R9145:A2ml1	UTSW	6	128559069	missense	probably benign
R9165:A2ml1	UTSW	6	128560669	missense	probably benign
R9285:A2ml1	UTSW	6	128549793	missense	probably benign
R9408:A2ml1	UTSW	6	128545067	missense	probably damaging	0.98
R9486:A2ml1	UTSW	6	128569979	missense	probably damaging	0.99
R9781:A2ml1	UTSW	6	128542897	missense	probably benign	0.01
RF014:A2ml1	UTSW	6	128570068	missense	probably damaging	0.96
X0063:A2ml1	UTSW	6	128572012	missense	probably benign
Z1176:A2ml1	UTSW	6	128571977	missense	probably benign	0.09
Z1177:A2ml1	UTSW	6	128545076	missense	probably benign
Z1177:A2ml1	UTSW	6	128561616	nonsense	probably null
Z1177:A2ml1	UTSW	6	128575607	missense	possibly damaging	0.80

Predicted Primers

PCR Primer
(F):5'- AACGAATGGAGATCTGTTCCAC -3'
(R):5'- TGAAGACATCAAAGAAACCACTGTG -3'

Sequencing Primer
(F):5'- TGCTCTTGCAGAAGACCTG -3'
(R):5'- CCACTGTGCAATAAGTTGTAGG -3'

Posted On

2021-12-30