Incidental Mutation 'R9083:Cyp2a12'
ID 690393
Institutional Source Beutler Lab
Gene Symbol Cyp2a12
Ensembl Gene ENSMUSG00000060407
Gene Name cytochrome P450, family 2, subfamily a, polypeptide 12
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock # R9083 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 27029081-27037375 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 27036519 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 451 (F451S)
Ref Sequence ENSEMBL: ENSMUSP00000074990 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075552]
AlphaFold P56593
Predicted Effect probably damaging
Transcript: ENSMUST00000075552
AA Change: F451S

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000074990
Gene: ENSMUSG00000060407
AA Change: F451S

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:p450 33 489 7.3e-153 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A T 6: 128,557,561 S844R possibly damaging Het
Aspm A G 1: 139,493,698 N3106S possibly damaging Het
Bco1 A C 8: 117,117,404 I286L probably benign Het
Bnc1 C T 7: 81,974,898 V194I probably benign Het
Bptf G A 11: 107,068,350 R1912W probably damaging Het
Cacna1a A G 8: 84,617,882 I1858V probably benign Het
Ccdc155 G A 7: 45,204,634 R24C unknown Het
Chdh T C 14: 30,031,746 F204S probably damaging Het
Cic A G 7: 25,286,045 T1212A probably damaging Het
Cpne7 C T 8: 123,130,212 P402L probably damaging Het
Cts8 A G 13: 61,249,222 Y295H probably damaging Het
Cyp1a2 T C 9: 57,680,289 T333A probably benign Het
Dmxl2 T C 9: 54,409,264 I1613V probably benign Het
Eme1 A G 11: 94,650,132 L260S probably damaging Het
Ermp1 A C 19: 29,646,015 S192A probably benign Het
Fam186a T C 15: 99,945,198 Q1055R probably benign Het
Fat1 C T 8: 45,013,090 T1462M possibly damaging Het
Fat1 A G 8: 45,038,299 N3822S probably benign Het
Gm340 G T 19: 41,586,400 R1198L probably damaging Het
Gm884 A C 11: 103,619,004 S713A unknown Het
Gm973 A G 1: 59,636,158 T225A Het
Gnl2 A G 4: 125,047,564 Y367C probably damaging Het
Golga5 T A 12: 102,492,217 S640T probably benign Het
Inafm1 A G 7: 16,273,271 V7A unknown Het
Irx2 A G 13: 72,629,273 D71G possibly damaging Het
Kif13a T C 13: 46,812,787 Y448C probably damaging Het
Ldlrad4 A T 18: 68,064,675 N10I probably benign Het
Lix1 T C 17: 17,457,130 Y196H possibly damaging Het
Mon1a A G 9: 107,902,636 Y468C probably damaging Het
Mroh4 A T 15: 74,626,291 I177N probably damaging Het
Mterf4 A T 1: 93,301,793 Y236* probably null Het
Myo1f T A 17: 33,594,062 I614N probably damaging Het
Nbas T A 12: 13,335,855 S707T possibly damaging Het
Ncl A T 1: 86,351,461 S577T possibly damaging Het
Olfr120 T A 17: 37,726,169 N48K probably damaging Het
Olfr146 A G 9: 39,018,720 S274P probably damaging Het
Olfr607 T C 7: 103,460,689 D173G Het
Olfr769 A T 10: 129,112,023 M134K probably damaging Het
Olfr822 A T 10: 130,075,072 M221L probably benign Het
Olfr822 G C 10: 130,075,100 S230T probably benign Het
Olfr829 A T 9: 18,857,254 I201F probably benign Het
Padi1 C A 4: 140,832,291 probably null Het
Patj G A 4: 98,513,634 V1004M probably benign Het
Pcdhb9 A T 18: 37,402,717 D588V probably damaging Het
Pdzph1 C A 17: 58,954,400 R879L possibly damaging Het
Pla2g2c G A 4: 138,736,067 V91I probably benign Het
Plin4 T C 17: 56,109,345 D53G possibly damaging Het
Poll T C 19: 45,557,878 Q241R probably benign Het
Recql5 A T 11: 115,894,649 L674M possibly damaging Het
Shroom3 G A 5: 92,950,674 G1338S probably damaging Het
Slc38a8 C T 8: 119,486,041 V294I probably benign Het
Slc4a1ap T C 5: 31,527,113 V31A probably benign Het
Tln2 G A 9: 67,362,645 P489S probably damaging Het
Trappc9 G A 15: 72,736,777 R928* probably null Het
Uba7 C A 9: 107,977,967 T343N probably benign Het
Vasn C T 16: 4,650,007 T606I probably benign Het
Xrn2 T A 2: 147,038,279 D507E probably damaging Het
Zfp592 T A 7: 81,024,896 M536K possibly damaging Het
Zfp932 A T 5: 110,009,234 H266L probably damaging Het
Other mutations in Cyp2a12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02191:Cyp2a12 APN 7 27036611 missense probably benign 0.00
IGL02306:Cyp2a12 APN 7 27032583 missense probably damaging 1.00
IGL02667:Cyp2a12 APN 7 27031158 missense probably damaging 1.00
IGL02943:Cyp2a12 APN 7 27032542 missense probably benign 0.07
IGL03025:Cyp2a12 APN 7 27031206 missense probably benign 0.00
IGL03230:Cyp2a12 APN 7 27029592 missense possibly damaging 0.48
PIT4243001:Cyp2a12 UTSW 7 27034773 missense probably benign 0.00
PIT4618001:Cyp2a12 UTSW 7 27034773 missense probably benign 0.00
R0655:Cyp2a12 UTSW 7 27036621 missense probably benign 0.15
R0659:Cyp2a12 UTSW 7 27034138 missense probably damaging 1.00
R0743:Cyp2a12 UTSW 7 27032542 missense probably benign 0.07
R0884:Cyp2a12 UTSW 7 27032542 missense probably benign 0.07
R2118:Cyp2a12 UTSW 7 27036646 makesense probably null
R2119:Cyp2a12 UTSW 7 27036646 makesense probably null
R2120:Cyp2a12 UTSW 7 27036646 makesense probably null
R2121:Cyp2a12 UTSW 7 27036646 makesense probably null
R2122:Cyp2a12 UTSW 7 27036646 makesense probably null
R2124:Cyp2a12 UTSW 7 27036646 makesense probably null
R2144:Cyp2a12 UTSW 7 27034769 missense possibly damaging 0.95
R2153:Cyp2a12 UTSW 7 27032617 missense probably benign 0.01
R2171:Cyp2a12 UTSW 7 27029632 missense probably damaging 1.00
R2182:Cyp2a12 UTSW 7 27031146 missense probably damaging 1.00
R2297:Cyp2a12 UTSW 7 27034632 missense possibly damaging 0.92
R4392:Cyp2a12 UTSW 7 27029275 missense probably damaging 0.98
R4900:Cyp2a12 UTSW 7 27031215 nonsense probably null
R4960:Cyp2a12 UTSW 7 27034150 missense probably benign 0.11
R5111:Cyp2a12 UTSW 7 27036621 missense possibly damaging 0.89
R5143:Cyp2a12 UTSW 7 27036611 missense probably benign 0.00
R5223:Cyp2a12 UTSW 7 27036463 critical splice acceptor site probably null
R5268:Cyp2a12 UTSW 7 27031218 missense probably benign 0.00
R5493:Cyp2a12 UTSW 7 27029125 missense unknown
R5524:Cyp2a12 UTSW 7 27031231 missense probably benign 0.00
R5806:Cyp2a12 UTSW 7 27029079 splice site probably null
R6320:Cyp2a12 UTSW 7 27031152 missense possibly damaging 0.75
R6823:Cyp2a12 UTSW 7 27034156 missense possibly damaging 0.77
R7958:Cyp2a12 UTSW 7 27029252 missense probably benign 0.13
R8093:Cyp2a12 UTSW 7 27036629 missense probably damaging 0.96
R8191:Cyp2a12 UTSW 7 27031104 missense probably benign 0.00
R8259:Cyp2a12 UTSW 7 27032658 nonsense probably null
R9084:Cyp2a12 UTSW 7 27036519 missense probably damaging 0.99
R9085:Cyp2a12 UTSW 7 27036519 missense probably damaging 0.99
R9086:Cyp2a12 UTSW 7 27036519 missense probably damaging 0.99
RF021:Cyp2a12 UTSW 7 27035360 missense possibly damaging 0.73
Z1088:Cyp2a12 UTSW 7 27035420 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- AACATTGGGGTTCTGAGAGAC -3'
(R):5'- TCTAGCACCACTTCAGGCTC -3'

Sequencing Primer
(F):5'- CTGAGAGACTTAGGAGCCTTTC -3'
(R):5'- ACCACTTCAGGCTCTCCCTC -3'
Posted On 2021-12-30