Incidental Mutation 'R9083:Zfp592'
ID 690395
Institutional Source Beutler Lab
Gene Symbol Zfp592
Ensembl Gene ENSMUSG00000005621
Gene Name zinc finger protein 592
Synonyms A730014M16Rik
MMRRC Submission 068902-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.926) question?
Stock # R9083 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 80643432-80694912 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 80674644 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 536 (M536K)
Ref Sequence ENSEMBL: ENSMUSP00000102976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107353]
AlphaFold Q8BHZ4
Predicted Effect possibly damaging
Transcript: ENSMUST00000107353
AA Change: M536K

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102976
Gene: ENSMUSG00000005621
AA Change: M536K

DomainStartEndE-ValueType
low complexity region 170 180 N/A INTRINSIC
low complexity region 200 211 N/A INTRINSIC
low complexity region 314 333 N/A INTRINSIC
low complexity region 343 369 N/A INTRINSIC
low complexity region 484 500 N/A INTRINSIC
low complexity region 514 525 N/A INTRINSIC
ZnF_C2H2 587 612 8.98e0 SMART
ZnF_C2H2 615 639 2.61e1 SMART
low complexity region 664 686 N/A INTRINSIC
ZnF_C2H2 711 731 1.24e2 SMART
ZnF_C2H2 740 762 2.82e0 SMART
ZnF_C2H2 768 792 4.99e1 SMART
ZnF_C2H2 799 822 1.73e0 SMART
ZnF_C2H2 827 850 7.89e0 SMART
ZnF_C2H2 892 915 3.89e-3 SMART
low complexity region 924 935 N/A INTRINSIC
low complexity region 965 979 N/A INTRINSIC
ZnF_C2H2 983 1006 4.11e-2 SMART
ZnF_C2H2 1013 1036 7.37e-4 SMART
ZnF_C2H2 1043 1069 7.68e0 SMART
ZnF_C2H2 1124 1146 1.51e0 SMART
ZnF_C2H2 1153 1176 1.23e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is thought to play a role in a complex developmental pathway and the regulation of genes involved in cerebellar development. Mutations in this gene have been associated with autosomal recessive spinocerebellar ataxia. [provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A T 6: 128,534,524 (GRCm39) S844R possibly damaging Het
Adig C A 2: 158,347,709 (GRCm39) probably benign Het
Aspm A G 1: 139,421,436 (GRCm39) N3106S possibly damaging Het
Bcas1 A T 2: 170,190,081 (GRCm39) probably benign Het
Bco1 A C 8: 117,844,143 (GRCm39) I286L probably benign Het
Bnc1 C T 7: 81,624,646 (GRCm39) V194I probably benign Het
Bptf G A 11: 106,959,176 (GRCm39) R1912W probably damaging Het
Cacna1a A G 8: 85,344,511 (GRCm39) I1858V probably benign Het
Chdh T C 14: 29,753,703 (GRCm39) F204S probably damaging Het
Cic A G 7: 24,985,470 (GRCm39) T1212A probably damaging Het
Cpne7 C T 8: 123,856,951 (GRCm39) P402L probably damaging Het
Cts8 A G 13: 61,397,036 (GRCm39) Y295H probably damaging Het
Cyp1a2 T C 9: 57,587,572 (GRCm39) T333A probably benign Het
Cyp2a12 T C 7: 26,735,944 (GRCm39) F451S probably damaging Het
Dmxl2 T C 9: 54,316,548 (GRCm39) I1613V probably benign Het
Eme1 A G 11: 94,540,958 (GRCm39) L260S probably damaging Het
Ermp1 A C 19: 29,623,415 (GRCm39) S192A probably benign Het
Fam186a T C 15: 99,843,079 (GRCm39) Q1055R probably benign Het
Fat1 C T 8: 45,466,127 (GRCm39) T1462M possibly damaging Het
Fat1 A G 8: 45,491,336 (GRCm39) N3822S probably benign Het
Gm973 A G 1: 59,675,317 (GRCm39) T225A Het
Gnl2 A G 4: 124,941,357 (GRCm39) Y367C probably damaging Het
Golga5 T A 12: 102,458,476 (GRCm39) S640T probably benign Het
Inafm1 A G 7: 16,007,196 (GRCm39) V7A unknown Het
Irx2 A G 13: 72,777,392 (GRCm39) D71G possibly damaging Het
Kash5 G A 7: 44,854,058 (GRCm39) R24C unknown Het
Kif13a T C 13: 46,966,263 (GRCm39) Y448C probably damaging Het
Lcor G T 19: 41,574,839 (GRCm39) R1198L probably damaging Het
Ldlrad4 A T 18: 68,197,746 (GRCm39) N10I probably benign Het
Lix1 T C 17: 17,677,392 (GRCm39) Y196H possibly damaging Het
Lrrc37 A C 11: 103,509,830 (GRCm39) S713A unknown Het
Mon1a A G 9: 107,779,835 (GRCm39) Y468C probably damaging Het
Mroh4 A T 15: 74,498,140 (GRCm39) I177N probably damaging Het
Mterf4 A T 1: 93,229,515 (GRCm39) Y236* probably null Het
Myo1f T A 17: 33,813,036 (GRCm39) I614N probably damaging Het
Nbas T A 12: 13,385,856 (GRCm39) S707T possibly damaging Het
Ncl A T 1: 86,279,183 (GRCm39) S577T possibly damaging Het
Or10al4 T A 17: 38,037,060 (GRCm39) N48K probably damaging Het
Or52d13 T C 7: 103,109,896 (GRCm39) D173G Het
Or6c2b A T 10: 128,947,892 (GRCm39) M134K probably damaging Het
Or6c69c A T 10: 129,910,941 (GRCm39) M221L probably benign Het
Or6c69c G C 10: 129,910,969 (GRCm39) S230T probably benign Het
Or7g17 A T 9: 18,768,550 (GRCm39) I201F probably benign Het
Or8g17 A G 9: 38,930,016 (GRCm39) S274P probably damaging Het
Padi1 C A 4: 140,559,602 (GRCm39) probably null Het
Patj G A 4: 98,401,871 (GRCm39) V1004M probably benign Het
Pcdhb9 A T 18: 37,535,770 (GRCm39) D588V probably damaging Het
Pdzph1 C A 17: 59,261,395 (GRCm39) R879L possibly damaging Het
Pla2g2c G A 4: 138,463,378 (GRCm39) V91I probably benign Het
Plin4 T C 17: 56,416,345 (GRCm39) D53G possibly damaging Het
Poll T C 19: 45,546,317 (GRCm39) Q241R probably benign Het
Recql5 A T 11: 115,785,475 (GRCm39) L674M possibly damaging Het
Shroom3 G A 5: 93,098,533 (GRCm39) G1338S probably damaging Het
Slc38a8 C T 8: 120,212,780 (GRCm39) V294I probably benign Het
Slc4a1ap T C 5: 31,684,457 (GRCm39) V31A probably benign Het
Tln2 G A 9: 67,269,927 (GRCm39) P489S probably damaging Het
Trappc9 G A 15: 72,608,626 (GRCm39) R928* probably null Het
Uba7 C A 9: 107,855,166 (GRCm39) T343N probably benign Het
Vasn C T 16: 4,467,871 (GRCm39) T606I probably benign Het
Xrn2 T A 2: 146,880,199 (GRCm39) D507E probably damaging Het
Zfp932 A T 5: 110,157,100 (GRCm39) H266L probably damaging Het
Other mutations in Zfp592
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01331:Zfp592 APN 7 80,691,296 (GRCm39) nonsense probably null
IGL01984:Zfp592 APN 7 80,688,392 (GRCm39) missense probably benign 0.00
IGL02079:Zfp592 APN 7 80,688,978 (GRCm39) missense probably benign 0.20
IGL02096:Zfp592 APN 7 80,674,796 (GRCm39) missense probably damaging 1.00
IGL02125:Zfp592 APN 7 80,687,932 (GRCm39) missense probably benign 0.00
IGL02374:Zfp592 APN 7 80,674,731 (GRCm39) missense probably damaging 1.00
IGL02419:Zfp592 APN 7 80,687,993 (GRCm39) missense probably damaging 1.00
IGL02466:Zfp592 APN 7 80,673,746 (GRCm39) missense probably damaging 1.00
IGL02485:Zfp592 APN 7 80,687,718 (GRCm39) splice site probably benign
IGL02500:Zfp592 APN 7 80,691,474 (GRCm39) missense probably benign
IGL02876:Zfp592 APN 7 80,687,875 (GRCm39) missense probably benign 0.01
IGL02940:Zfp592 APN 7 80,674,575 (GRCm39) missense probably damaging 1.00
R0326:Zfp592 UTSW 7 80,674,637 (GRCm39) missense possibly damaging 0.83
R0634:Zfp592 UTSW 7 80,687,819 (GRCm39) missense probably damaging 1.00
R0684:Zfp592 UTSW 7 80,687,623 (GRCm39) missense probably benign 0.00
R0750:Zfp592 UTSW 7 80,674,493 (GRCm39) missense probably benign
R1346:Zfp592 UTSW 7 80,687,812 (GRCm39) missense possibly damaging 0.54
R1457:Zfp592 UTSW 7 80,674,227 (GRCm39) missense probably damaging 0.99
R1650:Zfp592 UTSW 7 80,687,848 (GRCm39) missense probably benign 0.04
R1804:Zfp592 UTSW 7 80,673,443 (GRCm39) missense probably damaging 1.00
R1918:Zfp592 UTSW 7 80,687,168 (GRCm39) nonsense probably null
R2114:Zfp592 UTSW 7 80,674,544 (GRCm39) missense probably damaging 1.00
R2144:Zfp592 UTSW 7 80,687,950 (GRCm39) missense probably benign 0.01
R2164:Zfp592 UTSW 7 80,691,186 (GRCm39) missense possibly damaging 0.87
R2246:Zfp592 UTSW 7 80,691,361 (GRCm39) missense possibly damaging 0.91
R3701:Zfp592 UTSW 7 80,687,159 (GRCm39) nonsense probably null
R3809:Zfp592 UTSW 7 80,674,280 (GRCm39) missense probably benign 0.00
R4574:Zfp592 UTSW 7 80,673,534 (GRCm39) missense possibly damaging 0.87
R4866:Zfp592 UTSW 7 80,691,607 (GRCm39) missense probably damaging 1.00
R5023:Zfp592 UTSW 7 80,674,095 (GRCm39) missense probably damaging 1.00
R5121:Zfp592 UTSW 7 80,673,309 (GRCm39) missense probably damaging 1.00
R5174:Zfp592 UTSW 7 80,688,073 (GRCm39) missense probably damaging 1.00
R5794:Zfp592 UTSW 7 80,674,781 (GRCm39) missense probably benign 0.00
R5946:Zfp592 UTSW 7 80,687,645 (GRCm39) missense possibly damaging 0.95
R6312:Zfp592 UTSW 7 80,673,184 (GRCm39) missense probably benign 0.05
R6657:Zfp592 UTSW 7 80,675,234 (GRCm39) missense possibly damaging 0.49
R6814:Zfp592 UTSW 7 80,673,576 (GRCm39) missense probably benign 0.02
R6872:Zfp592 UTSW 7 80,673,576 (GRCm39) missense probably benign 0.02
R7056:Zfp592 UTSW 7 80,673,067 (GRCm39) missense probably damaging 1.00
R7295:Zfp592 UTSW 7 80,674,070 (GRCm39) missense probably damaging 1.00
R7351:Zfp592 UTSW 7 80,691,439 (GRCm39) missense probably benign 0.00
R7475:Zfp592 UTSW 7 80,673,200 (GRCm39) missense probably damaging 0.99
R7509:Zfp592 UTSW 7 80,688,088 (GRCm39) missense probably damaging 0.99
R7552:Zfp592 UTSW 7 80,673,390 (GRCm39) missense probably benign 0.01
R7737:Zfp592 UTSW 7 80,674,941 (GRCm39) missense probably damaging 1.00
R7752:Zfp592 UTSW 7 80,674,469 (GRCm39) missense probably benign 0.13
R7901:Zfp592 UTSW 7 80,674,469 (GRCm39) missense probably benign 0.13
R8100:Zfp592 UTSW 7 80,673,940 (GRCm39) missense probably benign 0.05
R8440:Zfp592 UTSW 7 80,691,271 (GRCm39) missense possibly damaging 0.89
R8710:Zfp592 UTSW 7 80,673,321 (GRCm39) missense probably damaging 1.00
R8766:Zfp592 UTSW 7 80,674,353 (GRCm39) missense probably benign 0.00
R9141:Zfp592 UTSW 7 80,674,205 (GRCm39) missense probably damaging 1.00
R9194:Zfp592 UTSW 7 80,674,349 (GRCm39) missense probably benign
R9197:Zfp592 UTSW 7 80,674,067 (GRCm39) missense possibly damaging 0.73
R9246:Zfp592 UTSW 7 80,691,529 (GRCm39) missense probably benign 0.03
R9321:Zfp592 UTSW 7 80,691,226 (GRCm39) missense possibly damaging 0.65
R9426:Zfp592 UTSW 7 80,674,205 (GRCm39) missense probably damaging 1.00
R9785:Zfp592 UTSW 7 80,673,245 (GRCm39) missense probably damaging 1.00
X0022:Zfp592 UTSW 7 80,687,935 (GRCm39) nonsense probably null
X0028:Zfp592 UTSW 7 80,673,762 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCAAAAGGATCTGCCCTG -3'
(R):5'- CTCAGGCTCTTCTCTAAGGC -3'

Sequencing Primer
(F):5'- GGATCTGCCCTGAACTCACAG -3'
(R):5'- GGCTCTTCTCTAAGGCAAACG -3'
Posted On 2021-12-30