Incidental Mutation 'R9083:Zfp592'
ID 690395
Institutional Source Beutler Lab
Gene Symbol Zfp592
Ensembl Gene ENSMUSG00000005621
Gene Name zinc finger protein 592
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.930) question?
Stock # R9083 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 80993681-81045164 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 81024896 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 536 (M536K)
Ref Sequence ENSEMBL: ENSMUSP00000102976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107353]
AlphaFold Q8BHZ4
Predicted Effect possibly damaging
Transcript: ENSMUST00000107353
AA Change: M536K

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102976
Gene: ENSMUSG00000005621
AA Change: M536K

DomainStartEndE-ValueType
low complexity region 170 180 N/A INTRINSIC
low complexity region 200 211 N/A INTRINSIC
low complexity region 314 333 N/A INTRINSIC
low complexity region 343 369 N/A INTRINSIC
low complexity region 484 500 N/A INTRINSIC
low complexity region 514 525 N/A INTRINSIC
ZnF_C2H2 587 612 8.98e0 SMART
ZnF_C2H2 615 639 2.61e1 SMART
low complexity region 664 686 N/A INTRINSIC
ZnF_C2H2 711 731 1.24e2 SMART
ZnF_C2H2 740 762 2.82e0 SMART
ZnF_C2H2 768 792 4.99e1 SMART
ZnF_C2H2 799 822 1.73e0 SMART
ZnF_C2H2 827 850 7.89e0 SMART
ZnF_C2H2 892 915 3.89e-3 SMART
low complexity region 924 935 N/A INTRINSIC
low complexity region 965 979 N/A INTRINSIC
ZnF_C2H2 983 1006 4.11e-2 SMART
ZnF_C2H2 1013 1036 7.37e-4 SMART
ZnF_C2H2 1043 1069 7.68e0 SMART
ZnF_C2H2 1124 1146 1.51e0 SMART
ZnF_C2H2 1153 1176 1.23e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is thought to play a role in a complex developmental pathway and the regulation of genes involved in cerebellar development. Mutations in this gene have been associated with autosomal recessive spinocerebellar ataxia. [provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A T 6: 128,557,561 S844R possibly damaging Het
Adig C A 2: 158,505,789 probably benign Het
Aspm A G 1: 139,493,698 N3106S possibly damaging Het
Bcas1 A T 2: 170,348,161 probably benign Het
Bco1 A C 8: 117,117,404 I286L probably benign Het
Bnc1 C T 7: 81,974,898 V194I probably benign Het
Bptf G A 11: 107,068,350 R1912W probably damaging Het
Cacna1a A G 8: 84,617,882 I1858V probably benign Het
Ccdc155 G A 7: 45,204,634 R24C unknown Het
Chdh T C 14: 30,031,746 F204S probably damaging Het
Cic A G 7: 25,286,045 T1212A probably damaging Het
Cpne7 C T 8: 123,130,212 P402L probably damaging Het
Cts8 A G 13: 61,249,222 Y295H probably damaging Het
Cyp1a2 T C 9: 57,680,289 T333A probably benign Het
Cyp2a12 T C 7: 27,036,519 F451S probably damaging Het
Dmxl2 T C 9: 54,409,264 I1613V probably benign Het
Eme1 A G 11: 94,650,132 L260S probably damaging Het
Ermp1 A C 19: 29,646,015 S192A probably benign Het
Fam186a T C 15: 99,945,198 Q1055R probably benign Het
Fat1 C T 8: 45,013,090 T1462M possibly damaging Het
Fat1 A G 8: 45,038,299 N3822S probably benign Het
Gm340 G T 19: 41,586,400 R1198L probably damaging Het
Gm884 A C 11: 103,619,004 S713A unknown Het
Gm973 A G 1: 59,636,158 T225A Het
Gnl2 A G 4: 125,047,564 Y367C probably damaging Het
Golga5 T A 12: 102,492,217 S640T probably benign Het
Inafm1 A G 7: 16,273,271 V7A unknown Het
Irx2 A G 13: 72,629,273 D71G possibly damaging Het
Kif13a T C 13: 46,812,787 Y448C probably damaging Het
Ldlrad4 A T 18: 68,064,675 N10I probably benign Het
Lix1 T C 17: 17,457,130 Y196H possibly damaging Het
Mon1a A G 9: 107,902,636 Y468C probably damaging Het
Mroh4 A T 15: 74,626,291 I177N probably damaging Het
Mterf4 A T 1: 93,301,793 Y236* probably null Het
Myo1f T A 17: 33,594,062 I614N probably damaging Het
Nbas T A 12: 13,335,855 S707T possibly damaging Het
Ncl A T 1: 86,351,461 S577T possibly damaging Het
Olfr120 T A 17: 37,726,169 N48K probably damaging Het
Olfr146 A G 9: 39,018,720 S274P probably damaging Het
Olfr607 T C 7: 103,460,689 D173G Het
Olfr769 A T 10: 129,112,023 M134K probably damaging Het
Olfr822 A T 10: 130,075,072 M221L probably benign Het
Olfr822 G C 10: 130,075,100 S230T probably benign Het
Olfr829 A T 9: 18,857,254 I201F probably benign Het
Padi1 C A 4: 140,832,291 probably null Het
Patj G A 4: 98,513,634 V1004M probably benign Het
Pcdhb9 A T 18: 37,402,717 D588V probably damaging Het
Pdzph1 C A 17: 58,954,400 R879L possibly damaging Het
Pla2g2c G A 4: 138,736,067 V91I probably benign Het
Plin4 T C 17: 56,109,345 D53G possibly damaging Het
Poll T C 19: 45,557,878 Q241R probably benign Het
Recql5 A T 11: 115,894,649 L674M possibly damaging Het
Shroom3 G A 5: 92,950,674 G1338S probably damaging Het
Slc38a8 C T 8: 119,486,041 V294I probably benign Het
Slc4a1ap T C 5: 31,527,113 V31A probably benign Het
Tln2 G A 9: 67,362,645 P489S probably damaging Het
Trappc9 G A 15: 72,736,777 R928* probably null Het
Uba7 C A 9: 107,977,967 T343N probably benign Het
Vasn C T 16: 4,650,007 T606I probably benign Het
Xrn2 T A 2: 147,038,279 D507E probably damaging Het
Zfp932 A T 5: 110,009,234 H266L probably damaging Het
Other mutations in Zfp592
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01331:Zfp592 APN 7 81041548 nonsense probably null
IGL01984:Zfp592 APN 7 81038644 missense probably benign 0.00
IGL02079:Zfp592 APN 7 81039230 missense probably benign 0.20
IGL02096:Zfp592 APN 7 81025048 missense probably damaging 1.00
IGL02125:Zfp592 APN 7 81038184 missense probably benign 0.00
IGL02374:Zfp592 APN 7 81024983 missense probably damaging 1.00
IGL02419:Zfp592 APN 7 81038245 missense probably damaging 1.00
IGL02466:Zfp592 APN 7 81023998 missense probably damaging 1.00
IGL02485:Zfp592 APN 7 81037970 splice site probably benign
IGL02500:Zfp592 APN 7 81041726 missense probably benign
IGL02876:Zfp592 APN 7 81038127 missense probably benign 0.01
IGL02940:Zfp592 APN 7 81024827 missense probably damaging 1.00
R0326:Zfp592 UTSW 7 81024889 missense possibly damaging 0.83
R0634:Zfp592 UTSW 7 81038071 missense probably damaging 1.00
R0684:Zfp592 UTSW 7 81037875 missense probably benign 0.00
R0750:Zfp592 UTSW 7 81024745 missense probably benign
R1346:Zfp592 UTSW 7 81038064 missense possibly damaging 0.54
R1457:Zfp592 UTSW 7 81024479 missense probably damaging 0.99
R1650:Zfp592 UTSW 7 81038100 missense probably benign 0.04
R1804:Zfp592 UTSW 7 81023695 missense probably damaging 1.00
R1918:Zfp592 UTSW 7 81037420 nonsense probably null
R2114:Zfp592 UTSW 7 81024796 missense probably damaging 1.00
R2144:Zfp592 UTSW 7 81038202 missense probably benign 0.01
R2164:Zfp592 UTSW 7 81041438 missense possibly damaging 0.87
R2246:Zfp592 UTSW 7 81041613 missense possibly damaging 0.91
R3701:Zfp592 UTSW 7 81037411 nonsense probably null
R3809:Zfp592 UTSW 7 81024532 missense probably benign 0.00
R4574:Zfp592 UTSW 7 81023786 missense possibly damaging 0.87
R4866:Zfp592 UTSW 7 81041859 missense probably damaging 1.00
R5023:Zfp592 UTSW 7 81024347 missense probably damaging 1.00
R5121:Zfp592 UTSW 7 81023561 missense probably damaging 1.00
R5174:Zfp592 UTSW 7 81038325 missense probably damaging 1.00
R5794:Zfp592 UTSW 7 81025033 missense probably benign 0.00
R5946:Zfp592 UTSW 7 81037897 missense possibly damaging 0.95
R6312:Zfp592 UTSW 7 81023436 missense probably benign 0.05
R6657:Zfp592 UTSW 7 81025486 missense possibly damaging 0.49
R6814:Zfp592 UTSW 7 81023828 missense probably benign 0.02
R6872:Zfp592 UTSW 7 81023828 missense probably benign 0.02
R7056:Zfp592 UTSW 7 81023319 missense probably damaging 1.00
R7295:Zfp592 UTSW 7 81024322 missense probably damaging 1.00
R7351:Zfp592 UTSW 7 81041691 missense probably benign 0.00
R7475:Zfp592 UTSW 7 81023452 missense probably damaging 0.99
R7509:Zfp592 UTSW 7 81038340 missense probably damaging 0.99
R7552:Zfp592 UTSW 7 81023642 missense probably benign 0.01
R7737:Zfp592 UTSW 7 81025193 missense probably damaging 1.00
R7752:Zfp592 UTSW 7 81024721 missense probably benign 0.13
R7901:Zfp592 UTSW 7 81024721 missense probably benign 0.13
R8100:Zfp592 UTSW 7 81024192 missense probably benign 0.05
R8440:Zfp592 UTSW 7 81041523 missense possibly damaging 0.89
R8710:Zfp592 UTSW 7 81023573 missense probably damaging 1.00
R8766:Zfp592 UTSW 7 81024605 missense probably benign 0.00
R9141:Zfp592 UTSW 7 81024457 missense probably damaging 1.00
R9194:Zfp592 UTSW 7 81024601 missense probably benign
R9197:Zfp592 UTSW 7 81024319 missense possibly damaging 0.73
R9246:Zfp592 UTSW 7 81041781 missense probably benign 0.03
R9321:Zfp592 UTSW 7 81041478 missense possibly damaging 0.65
R9426:Zfp592 UTSW 7 81024457 missense probably damaging 1.00
R9785:Zfp592 UTSW 7 81023497 missense probably damaging 1.00
X0022:Zfp592 UTSW 7 81038187 nonsense probably null
X0028:Zfp592 UTSW 7 81024014 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCAAAAGGATCTGCCCTG -3'
(R):5'- CTCAGGCTCTTCTCTAAGGC -3'

Sequencing Primer
(F):5'- GGATCTGCCCTGAACTCACAG -3'
(R):5'- GGCTCTTCTCTAAGGCAAACG -3'
Posted On 2021-12-30