Incidental Mutation 'R9083:Olfr146'
ID 690405
Institutional Source Beutler Lab
Gene Symbol Olfr146
Ensembl Gene ENSMUSG00000058820
Gene Name olfactory receptor 146
Synonyms GA_x6K02T2PVTD-32715386-32714466, MOR171-10, M15
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock # R9083 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 39018073-39023377 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 39018720 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 274 (S274P)
Ref Sequence ENSEMBL: ENSMUSP00000149294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073671] [ENSMUST00000214369] [ENSMUST00000214410] [ENSMUST00000215383]
AlphaFold Q60884
Predicted Effect probably damaging
Transcript: ENSMUST00000073671
AA Change: S274P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000073352
Gene: ENSMUSG00000058820
AA Change: S274P

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 7.6e-54 PFAM
Pfam:7tm_1 41 290 8.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214369
Predicted Effect probably damaging
Transcript: ENSMUST00000214410
AA Change: S274P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000215383
Meta Mutation Damage Score 0.4213 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A T 6: 128,557,561 S844R possibly damaging Het
Adig C A 2: 158,505,789 probably benign Het
Aspm A G 1: 139,493,698 N3106S possibly damaging Het
Bcas1 A T 2: 170,348,161 probably benign Het
Bco1 A C 8: 117,117,404 I286L probably benign Het
Bnc1 C T 7: 81,974,898 V194I probably benign Het
Bptf G A 11: 107,068,350 R1912W probably damaging Het
Cacna1a A G 8: 84,617,882 I1858V probably benign Het
Ccdc155 G A 7: 45,204,634 R24C unknown Het
Chdh T C 14: 30,031,746 F204S probably damaging Het
Cic A G 7: 25,286,045 T1212A probably damaging Het
Cpne7 C T 8: 123,130,212 P402L probably damaging Het
Cts8 A G 13: 61,249,222 Y295H probably damaging Het
Cyp1a2 T C 9: 57,680,289 T333A probably benign Het
Cyp2a12 T C 7: 27,036,519 F451S probably damaging Het
Dmxl2 T C 9: 54,409,264 I1613V probably benign Het
Eme1 A G 11: 94,650,132 L260S probably damaging Het
Ermp1 A C 19: 29,646,015 S192A probably benign Het
Fam186a T C 15: 99,945,198 Q1055R probably benign Het
Fat1 C T 8: 45,013,090 T1462M possibly damaging Het
Fat1 A G 8: 45,038,299 N3822S probably benign Het
Gm340 G T 19: 41,586,400 R1198L probably damaging Het
Gm884 A C 11: 103,619,004 S713A unknown Het
Gm973 A G 1: 59,636,158 T225A Het
Gnl2 A G 4: 125,047,564 Y367C probably damaging Het
Golga5 T A 12: 102,492,217 S640T probably benign Het
Inafm1 A G 7: 16,273,271 V7A unknown Het
Irx2 A G 13: 72,629,273 D71G possibly damaging Het
Kif13a T C 13: 46,812,787 Y448C probably damaging Het
Ldlrad4 A T 18: 68,064,675 N10I probably benign Het
Lix1 T C 17: 17,457,130 Y196H possibly damaging Het
Mon1a A G 9: 107,902,636 Y468C probably damaging Het
Mroh4 A T 15: 74,626,291 I177N probably damaging Het
Mterf4 A T 1: 93,301,793 Y236* probably null Het
Myo1f T A 17: 33,594,062 I614N probably damaging Het
Nbas T A 12: 13,335,855 S707T possibly damaging Het
Ncl A T 1: 86,351,461 S577T possibly damaging Het
Olfr120 T A 17: 37,726,169 N48K probably damaging Het
Olfr607 T C 7: 103,460,689 D173G Het
Olfr769 A T 10: 129,112,023 M134K probably damaging Het
Olfr822 A T 10: 130,075,072 M221L probably benign Het
Olfr822 G C 10: 130,075,100 S230T probably benign Het
Olfr829 A T 9: 18,857,254 I201F probably benign Het
Padi1 C A 4: 140,832,291 probably null Het
Patj G A 4: 98,513,634 V1004M probably benign Het
Pcdhb9 A T 18: 37,402,717 D588V probably damaging Het
Pdzph1 C A 17: 58,954,400 R879L possibly damaging Het
Pla2g2c G A 4: 138,736,067 V91I probably benign Het
Plin4 T C 17: 56,109,345 D53G possibly damaging Het
Poll T C 19: 45,557,878 Q241R probably benign Het
Recql5 A T 11: 115,894,649 L674M possibly damaging Het
Shroom3 G A 5: 92,950,674 G1338S probably damaging Het
Slc38a8 C T 8: 119,486,041 V294I probably benign Het
Slc4a1ap T C 5: 31,527,113 V31A probably benign Het
Tln2 G A 9: 67,362,645 P489S probably damaging Het
Trappc9 G A 15: 72,736,777 R928* probably null Het
Uba7 C A 9: 107,977,967 T343N probably benign Het
Vasn C T 16: 4,650,007 T606I probably benign Het
Xrn2 T A 2: 147,038,279 D507E probably damaging Het
Zfp592 T A 7: 81,024,896 M536K possibly damaging Het
Zfp932 A T 5: 110,009,234 H266L probably damaging Het
Other mutations in Olfr146
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01533:Olfr146 APN 9 39018801 missense probably damaging 0.98
IGL01655:Olfr146 APN 9 39018918 missense probably benign 0.00
IGL01804:Olfr146 APN 9 39019401 missense probably benign 0.13
IGL02098:Olfr146 APN 9 39018891 missense probably damaging 1.00
IGL02719:Olfr146 APN 9 39019016 missense probably benign 0.11
R0531:Olfr146 UTSW 9 39019176 missense probably damaging 0.97
R1270:Olfr146 UTSW 9 39019247 missense possibly damaging 0.90
R1511:Olfr146 UTSW 9 39019025 missense probably benign 0.03
R1590:Olfr146 UTSW 9 39018957 missense probably benign 0.09
R1649:Olfr146 UTSW 9 39019480 missense probably benign 0.03
R3419:Olfr146 UTSW 9 39019076 missense probably benign 0.03
R4669:Olfr146 UTSW 9 39019379 missense probably benign 0.10
R4788:Olfr146 UTSW 9 39018921 missense probably benign 0.07
R5184:Olfr146 UTSW 9 39018702 missense probably damaging 0.98
R5581:Olfr146 UTSW 9 39018702 missense probably damaging 0.98
R6032:Olfr146 UTSW 9 39018965 missense probably benign 0.00
R6032:Olfr146 UTSW 9 39018965 missense probably benign 0.00
R6319:Olfr146 UTSW 9 39019514 missense probably damaging 1.00
R6626:Olfr146 UTSW 9 39019106 missense possibly damaging 0.63
R6693:Olfr146 UTSW 9 39018801 missense probably damaging 0.98
R7165:Olfr146 UTSW 9 39023270 start gained probably benign
R7947:Olfr146 UTSW 9 39019451 missense probably damaging 0.99
R7957:Olfr146 UTSW 9 39019053 missense probably benign
R8052:Olfr146 UTSW 9 39019487 missense probably damaging 0.99
R8162:Olfr146 UTSW 9 39018953 missense probably benign 0.01
R9004:Olfr146 UTSW 9 39019284 missense probably benign 0.01
R9584:Olfr146 UTSW 9 39019166 missense probably damaging 1.00
Z1088:Olfr146 UTSW 9 39018789 missense probably damaging 1.00
Z1191:Olfr146 UTSW 9 39018933 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAACTCATACTATGTAGTAGCCC -3'
(R):5'- TGTGCATCAGCTCATGTAGG -3'

Sequencing Primer
(F):5'- GCCCTAGATTATGAGCTAATGAGAC -3'
(R):5'- TGATCAACCATTATTTCTGTGACC -3'
Posted On 2021-12-30