Mutagenetix > Incidental Mutation

Incidental Mutation 'R9083:Trappc9'

690424

Institutional Source

Beutler Lab

Gene Symbol

Trappc9

Ensembl Gene

ENSMUSG00000047921

Gene Name

trafficking protein particle complex 9

Synonyms

TRS130, Nibp, 2900005P22Rik, 4632408O18Rik, 1810044A24Rik

MMRRC Submission

068902-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9083 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

72589620-73061204 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 72736777 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 928 (R928*)

Ref Sequence

ENSEMBL: ENSMUSP00000087202 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023276] [ENSMUST00000089770]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000023276
AA Change: R749*

SMART Domains

Protein: ENSMUSP00000023276
Gene: ENSMUSG00000047921
AA Change: R749*

Domain	Start	End	E-Value	Type
Pfam:TRAPPC9-Trs120	2	920	3.6e-239	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000089770
AA Change: R928*

SMART Domains

Protein: ENSMUSP00000087202
Gene: ENSMUSG00000047921
AA Change: R928*

Domain	Start	End	E-Value	Type
Pfam:TRAPPC9-Trs120	182	350	4.1e-20	PFAM
Pfam:TRAPPC9-Trs120	434	664	2.2e-16	PFAM
low complexity region	993	1004	N/A	INTRINSIC

Meta Mutation Damage Score

0.9756

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.5%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that likely plays a role in NF-kappa-B signaling. Mutations in this gene have been associated with autosomal-recessive mental retardation. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2ml1	A	T	6: 128,557,561	S844R	possibly damaging	Het
Adig	C	A	2: 158,505,789		probably benign	Het
Aspm	A	G	1: 139,493,698	N3106S	possibly damaging	Het
Bcas1	A	T	2: 170,348,161		probably benign	Het
Bco1	A	C	8: 117,117,404	I286L	probably benign	Het
Bnc1	C	T	7: 81,974,898	V194I	probably benign	Het
Bptf	G	A	11: 107,068,350	R1912W	probably damaging	Het
Cacna1a	A	G	8: 84,617,882	I1858V	probably benign	Het
Ccdc155	G	A	7: 45,204,634	R24C	unknown	Het
Chdh	T	C	14: 30,031,746	F204S	probably damaging	Het
Cic	A	G	7: 25,286,045	T1212A	probably damaging	Het
Cpne7	C	T	8: 123,130,212	P402L	probably damaging	Het
Cts8	A	G	13: 61,249,222	Y295H	probably damaging	Het
Cyp1a2	T	C	9: 57,680,289	T333A	probably benign	Het
Cyp2a12	T	C	7: 27,036,519	F451S	probably damaging	Het
Dmxl2	T	C	9: 54,409,264	I1613V	probably benign	Het
Eme1	A	G	11: 94,650,132	L260S	probably damaging	Het
Ermp1	A	C	19: 29,646,015	S192A	probably benign	Het
Fam186a	T	C	15: 99,945,198	Q1055R	probably benign	Het
Fat1	A	G	8: 45,038,299	N3822S	probably benign	Het
Fat1	C	T	8: 45,013,090	T1462M	possibly damaging	Het
Gm340	G	T	19: 41,586,400	R1198L	probably damaging	Het
Gm884	A	C	11: 103,619,004	S713A	unknown	Het
Gm973	A	G	1: 59,636,158	T225A		Het
Gnl2	A	G	4: 125,047,564	Y367C	probably damaging	Het
Golga5	T	A	12: 102,492,217	S640T	probably benign	Het
Inafm1	A	G	7: 16,273,271	V7A	unknown	Het
Irx2	A	G	13: 72,629,273	D71G	possibly damaging	Het
Kif13a	T	C	13: 46,812,787	Y448C	probably damaging	Het
Ldlrad4	A	T	18: 68,064,675	N10I	probably benign	Het
Lix1	T	C	17: 17,457,130	Y196H	possibly damaging	Het
Mon1a	A	G	9: 107,902,636	Y468C	probably damaging	Het
Mroh4	A	T	15: 74,626,291	I177N	probably damaging	Het
Mterf4	A	T	1: 93,301,793	Y236*	probably null	Het
Myo1f	T	A	17: 33,594,062	I614N	probably damaging	Het
Nbas	T	A	12: 13,335,855	S707T	possibly damaging	Het
Ncl	A	T	1: 86,351,461	S577T	possibly damaging	Het
Olfr120	T	A	17: 37,726,169	N48K	probably damaging	Het
Olfr146	A	G	9: 39,018,720	S274P	probably damaging	Het
Olfr607	T	C	7: 103,460,689	D173G		Het
Olfr769	A	T	10: 129,112,023	M134K	probably damaging	Het
Olfr822	A	T	10: 130,075,072	M221L	probably benign	Het
Olfr822	G	C	10: 130,075,100	S230T	probably benign	Het
Olfr829	A	T	9: 18,857,254	I201F	probably benign	Het
Padi1	C	A	4: 140,832,291		probably null	Het
Patj	G	A	4: 98,513,634	V1004M	probably benign	Het
Pcdhb9	A	T	18: 37,402,717	D588V	probably damaging	Het
Pdzph1	C	A	17: 58,954,400	R879L	possibly damaging	Het
Pla2g2c	G	A	4: 138,736,067	V91I	probably benign	Het
Plin4	T	C	17: 56,109,345	D53G	possibly damaging	Het
Poll	T	C	19: 45,557,878	Q241R	probably benign	Het
Recql5	A	T	11: 115,894,649	L674M	possibly damaging	Het
Shroom3	G	A	5: 92,950,674	G1338S	probably damaging	Het
Slc38a8	C	T	8: 119,486,041	V294I	probably benign	Het
Slc4a1ap	T	C	5: 31,527,113	V31A	probably benign	Het
Tln2	G	A	9: 67,362,645	P489S	probably damaging	Het
Uba7	C	A	9: 107,977,967	T343N	probably benign	Het
Vasn	C	T	16: 4,650,007	T606I	probably benign	Het
Xrn2	T	A	2: 147,038,279	D507E	probably damaging	Het
Zfp592	T	A	7: 81,024,896	M536K	possibly damaging	Het
Zfp932	A	T	5: 110,009,234	H266L	probably damaging	Het

Other mutations in Trappc9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Trappc9	APN	15	73026026	missense	possibly damaging	0.79
IGL01348:Trappc9	APN	15	72937009	missense	possibly damaging	0.64
IGL01367:Trappc9	APN	15	72590153	missense	probably benign	0.31
IGL01521:Trappc9	APN	15	73052167	missense	probably damaging	1.00
IGL01726:Trappc9	APN	15	72946122	missense	probably damaging	0.98
IGL01881:Trappc9	APN	15	72999992	missense	probably damaging	1.00
IGL02214:Trappc9	APN	15	73012882	nonsense	probably null
IGL02693:Trappc9	APN	15	72963693	splice site	probably benign
IGL03229:Trappc9	APN	15	73058456	missense	probably damaging	1.00
basilio	UTSW	15	73058393	missense	probably damaging	1.00
Boomboom	UTSW	15	72736869	nonsense	probably null
bronto	UTSW	15	73058238	nonsense	probably null
Earl	UTSW	15	72736777	nonsense	probably null
Sotto_aceto	UTSW	15	72685339	missense	probably damaging	0.99
P0026:Trappc9	UTSW	15	72953082	missense	probably damaging	1.00
PIT4453001:Trappc9	UTSW	15	73031598	frame shift	probably null
PIT4519001:Trappc9	UTSW	15	72953094	missense	probably benign
R0001:Trappc9	UTSW	15	72963662	missense	probably damaging	1.00
R0094:Trappc9	UTSW	15	72894929	intron	probably benign
R0745:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0747:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0800:Trappc9	UTSW	15	72953132	splice site	probably benign
R0816:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0819:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0820:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0893:Trappc9	UTSW	15	72590107	missense	probably damaging	1.00
R0976:Trappc9	UTSW	15	72999974	missense	probably damaging	0.99
R1119:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1266:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1453:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1454:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1531:Trappc9	UTSW	15	72693548	nonsense	probably null
R1543:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1563:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1565:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1600:Trappc9	UTSW	15	72937109	nonsense	probably null
R1712:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1756:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1789:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1978:Trappc9	UTSW	15	73000025	missense	probably damaging	1.00
R2001:Trappc9	UTSW	15	73058036	missense	probably damaging	0.99
R2312:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R2334:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R2926:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3123:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3124:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3125:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3813:Trappc9	UTSW	15	73058393	missense	probably damaging	1.00
R4012:Trappc9	UTSW	15	73031623	missense	possibly damaging	0.95
R4080:Trappc9	UTSW	15	72941947	missense	probably damaging	1.00
R4282:Trappc9	UTSW	15	72590792	missense	probably damaging	1.00
R4572:Trappc9	UTSW	15	72937067	missense	possibly damaging	0.61
R4739:Trappc9	UTSW	15	72937060	missense	probably damaging	0.97
R4959:Trappc9	UTSW	15	72937056	missense	probably damaging	1.00
R4973:Trappc9	UTSW	15	72937056	missense	probably damaging	1.00
R5123:Trappc9	UTSW	15	72913366	intron	probably benign
R5128:Trappc9	UTSW	15	73058393	missense	probably damaging	1.00
R5228:Trappc9	UTSW	15	73057995	missense	probably damaging	1.00
R5362:Trappc9	UTSW	15	73058217	missense	possibly damaging	0.68
R5802:Trappc9	UTSW	15	72685339	missense	probably damaging	0.99
R6032:Trappc9	UTSW	15	72925530	missense	probably benign	0.43
R6032:Trappc9	UTSW	15	72925530	missense	probably benign	0.43
R6154:Trappc9	UTSW	15	73058081	missense	probably benign	0.03
R6372:Trappc9	UTSW	15	72590074	missense	possibly damaging	0.75
R6661:Trappc9	UTSW	15	72590144	missense	possibly damaging	0.55
R6864:Trappc9	UTSW	15	72937162	splice site	probably null
R6893:Trappc9	UTSW	15	72925650	missense	possibly damaging	0.93
R7099:Trappc9	UTSW	15	72693619	missense	probably benign	0.00
R7276:Trappc9	UTSW	15	73052270	missense	probably damaging	0.99
R7349:Trappc9	UTSW	15	72736869	nonsense	probably null
R8260:Trappc9	UTSW	15	72941909	nonsense	probably null
R8399:Trappc9	UTSW	15	73052282	missense	probably damaging	1.00
R8683:Trappc9	UTSW	15	73012815	missense	probably benign	0.26
R8839:Trappc9	UTSW	15	73058238	nonsense	probably null
R8945:Trappc9	UTSW	15	73058096	missense	probably benign
R9323:Trappc9	UTSW	15	72693582	missense	probably benign	0.41
R9329:Trappc9	UTSW	15	72801353	missense	unknown
R9366:Trappc9	UTSW	15	72937088	missense	probably benign
R9723:Trappc9	UTSW	15	72590114	missense	possibly damaging	0.87
RF008:Trappc9	UTSW	15	72801289	small insertion	probably benign
RF009:Trappc9	UTSW	15	72801287	small insertion	probably benign
RF014:Trappc9	UTSW	15	72801283	small insertion	probably benign
RF016:Trappc9	UTSW	15	72801289	small insertion	probably benign
RF023:Trappc9	UTSW	15	72801324	small insertion	probably benign
RF023:Trappc9	UTSW	15	72801331	small insertion	probably benign
RF028:Trappc9	UTSW	15	72801290	small insertion	probably benign
RF029:Trappc9	UTSW	15	72801323	small insertion	probably benign
RF030:Trappc9	UTSW	15	72801325	small insertion	probably benign
RF034:Trappc9	UTSW	15	72801298	small insertion	probably benign
RF036:Trappc9	UTSW	15	72801320	small insertion	probably benign
RF038:Trappc9	UTSW	15	72801323	small insertion	probably benign
RF040:Trappc9	UTSW	15	72801292	small insertion	probably benign
RF042:Trappc9	UTSW	15	72801283	small insertion	probably benign
RF043:Trappc9	UTSW	15	72801305	small insertion	probably benign
RF049:Trappc9	UTSW	15	72801301	small insertion	probably benign
RF049:Trappc9	UTSW	15	72801306	small insertion	probably benign
RF053:Trappc9	UTSW	15	72801328	small insertion	probably benign
RF057:Trappc9	UTSW	15	72801295	small insertion	probably benign
RF063:Trappc9	UTSW	15	72801320	small insertion	probably benign
RF063:Trappc9	UTSW	15	72801324	small insertion	probably benign
Z1177:Trappc9	UTSW	15	73052162	missense	probably null	0.51

Predicted Primers

PCR Primer
(F):5'- GGTTGTTCTTAAACCTAGTGCC -3'
(R):5'- CCCCTACTCTGAAATGGCAAAG -3'

Sequencing Primer
(F):5'- TGTTCTTAAACCTAGTGCCTCACAC -3'
(R):5'- AAAGTTGCCTCTCTTTGCTGCTG -3'

Posted On

2021-12-30