Incidental Mutation 'R9083:Trappc9'
ID 690424
Institutional Source Beutler Lab
Gene Symbol Trappc9
Ensembl Gene ENSMUSG00000047921
Gene Name trafficking protein particle complex 9
Synonyms TRS130, Nibp, 2900005P22Rik, 4632408O18Rik, 1810044A24Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9083 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 72589620-73061204 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 72736777 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 928 (R928*)
Ref Sequence ENSEMBL: ENSMUSP00000087202 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023276] [ENSMUST00000089770]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000023276
AA Change: R749*
SMART Domains Protein: ENSMUSP00000023276
Gene: ENSMUSG00000047921
AA Change: R749*

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 2 920 3.6e-239 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000089770
AA Change: R928*
SMART Domains Protein: ENSMUSP00000087202
Gene: ENSMUSG00000047921
AA Change: R928*

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 182 350 4.1e-20 PFAM
Pfam:TRAPPC9-Trs120 434 664 2.2e-16 PFAM
low complexity region 993 1004 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that likely plays a role in NF-kappa-B signaling. Mutations in this gene have been associated with autosomal-recessive mental retardation. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A T 6: 128,557,561 S844R possibly damaging Het
Aspm A G 1: 139,493,698 N3106S possibly damaging Het
Bco1 A C 8: 117,117,404 I286L probably benign Het
Bnc1 C T 7: 81,974,898 V194I probably benign Het
Bptf G A 11: 107,068,350 R1912W probably damaging Het
Cacna1a A G 8: 84,617,882 I1858V probably benign Het
Ccdc155 G A 7: 45,204,634 R24C unknown Het
Chdh T C 14: 30,031,746 F204S probably damaging Het
Cic A G 7: 25,286,045 T1212A probably damaging Het
Cpne7 C T 8: 123,130,212 P402L probably damaging Het
Cts8 A G 13: 61,249,222 Y295H probably damaging Het
Cyp1a2 T C 9: 57,680,289 T333A probably benign Het
Cyp2a12 T C 7: 27,036,519 F451S probably damaging Het
Dmxl2 T C 9: 54,409,264 I1613V probably benign Het
Eme1 A G 11: 94,650,132 L260S probably damaging Het
Ermp1 A C 19: 29,646,015 S192A probably benign Het
Fam186a T C 15: 99,945,198 Q1055R probably benign Het
Fat1 C T 8: 45,013,090 T1462M possibly damaging Het
Fat1 A G 8: 45,038,299 N3822S probably benign Het
Gm340 G T 19: 41,586,400 R1198L probably damaging Het
Gm884 A C 11: 103,619,004 S713A unknown Het
Gm973 A G 1: 59,636,158 T225A Het
Gnl2 A G 4: 125,047,564 Y367C probably damaging Het
Golga5 T A 12: 102,492,217 S640T probably benign Het
Inafm1 A G 7: 16,273,271 V7A unknown Het
Irx2 A G 13: 72,629,273 D71G possibly damaging Het
Kif13a T C 13: 46,812,787 Y448C probably damaging Het
Ldlrad4 A T 18: 68,064,675 N10I probably benign Het
Lix1 T C 17: 17,457,130 Y196H possibly damaging Het
Mon1a A G 9: 107,902,636 Y468C probably damaging Het
Mroh4 A T 15: 74,626,291 I177N probably damaging Het
Mterf4 A T 1: 93,301,793 Y236* probably null Het
Myo1f T A 17: 33,594,062 I614N probably damaging Het
Nbas T A 12: 13,335,855 S707T possibly damaging Het
Ncl A T 1: 86,351,461 S577T possibly damaging Het
Olfr120 T A 17: 37,726,169 N48K probably damaging Het
Olfr146 A G 9: 39,018,720 S274P probably damaging Het
Olfr607 T C 7: 103,460,689 D173G Het
Olfr769 A T 10: 129,112,023 M134K probably damaging Het
Olfr822 A T 10: 130,075,072 M221L probably benign Het
Olfr822 G C 10: 130,075,100 S230T probably benign Het
Olfr829 A T 9: 18,857,254 I201F probably benign Het
Padi1 C A 4: 140,832,291 probably null Het
Patj G A 4: 98,513,634 V1004M probably benign Het
Pcdhb9 A T 18: 37,402,717 D588V probably damaging Het
Pdzph1 C A 17: 58,954,400 R879L possibly damaging Het
Pla2g2c G A 4: 138,736,067 V91I probably benign Het
Plin4 T C 17: 56,109,345 D53G possibly damaging Het
Poll T C 19: 45,557,878 Q241R probably benign Het
Recql5 A T 11: 115,894,649 L674M possibly damaging Het
Shroom3 G A 5: 92,950,674 G1338S probably damaging Het
Slc38a8 C T 8: 119,486,041 V294I probably benign Het
Slc4a1ap T C 5: 31,527,113 V31A probably benign Het
Tln2 G A 9: 67,362,645 P489S probably damaging Het
Uba7 C A 9: 107,977,967 T343N probably benign Het
Vasn C T 16: 4,650,007 T606I probably benign Het
Xrn2 T A 2: 147,038,279 D507E probably damaging Het
Zfp592 T A 7: 81,024,896 M536K possibly damaging Het
Zfp932 A T 5: 110,009,234 H266L probably damaging Het
Other mutations in Trappc9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Trappc9 APN 15 73026026 missense possibly damaging 0.79
IGL01348:Trappc9 APN 15 72937009 missense possibly damaging 0.64
IGL01367:Trappc9 APN 15 72590153 missense probably benign 0.31
IGL01521:Trappc9 APN 15 73052167 missense probably damaging 1.00
IGL01726:Trappc9 APN 15 72946122 missense probably damaging 0.98
IGL01881:Trappc9 APN 15 72999992 missense probably damaging 1.00
IGL02214:Trappc9 APN 15 73012882 nonsense probably null
IGL02693:Trappc9 APN 15 72963693 splice site probably benign
IGL03229:Trappc9 APN 15 73058456 missense probably damaging 1.00
basilio UTSW 15 73058393 missense probably damaging 1.00
Boomboom UTSW 15 72736869 nonsense probably null
bronto UTSW 15 73058238 nonsense probably null
Sotto_aceto UTSW 15 72685339 missense probably damaging 0.99
P0026:Trappc9 UTSW 15 72953082 missense probably damaging 1.00
PIT4453001:Trappc9 UTSW 15 73031598 frame shift probably null
PIT4519001:Trappc9 UTSW 15 72953094 missense probably benign
R0001:Trappc9 UTSW 15 72963662 missense probably damaging 1.00
R0094:Trappc9 UTSW 15 72894929 intron probably benign
R0745:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0747:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0800:Trappc9 UTSW 15 72953132 splice site probably benign
R0816:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0819:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0820:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0893:Trappc9 UTSW 15 72590107 missense probably damaging 1.00
R0976:Trappc9 UTSW 15 72999974 missense probably damaging 0.99
R1119:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1266:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1453:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1454:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1531:Trappc9 UTSW 15 72693548 nonsense probably null
R1543:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1563:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1565:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1600:Trappc9 UTSW 15 72937109 nonsense probably null
R1712:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1756:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1789:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1978:Trappc9 UTSW 15 73000025 missense probably damaging 1.00
R2001:Trappc9 UTSW 15 73058036 missense probably damaging 0.99
R2312:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R2334:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R2926:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3123:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3124:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3125:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3813:Trappc9 UTSW 15 73058393 missense probably damaging 1.00
R4012:Trappc9 UTSW 15 73031623 missense possibly damaging 0.95
R4080:Trappc9 UTSW 15 72941947 missense probably damaging 1.00
R4282:Trappc9 UTSW 15 72590792 missense probably damaging 1.00
R4572:Trappc9 UTSW 15 72937067 missense possibly damaging 0.61
R4739:Trappc9 UTSW 15 72937060 missense probably damaging 0.97
R4959:Trappc9 UTSW 15 72937056 missense probably damaging 1.00
R4973:Trappc9 UTSW 15 72937056 missense probably damaging 1.00
R5123:Trappc9 UTSW 15 72913366 intron probably benign
R5128:Trappc9 UTSW 15 73058393 missense probably damaging 1.00
R5228:Trappc9 UTSW 15 73057995 missense probably damaging 1.00
R5362:Trappc9 UTSW 15 73058217 missense possibly damaging 0.68
R5802:Trappc9 UTSW 15 72685339 missense probably damaging 0.99
R6032:Trappc9 UTSW 15 72925530 missense probably benign 0.43
R6032:Trappc9 UTSW 15 72925530 missense probably benign 0.43
R6154:Trappc9 UTSW 15 73058081 missense probably benign 0.03
R6372:Trappc9 UTSW 15 72590074 missense possibly damaging 0.75
R6661:Trappc9 UTSW 15 72590144 missense possibly damaging 0.55
R6864:Trappc9 UTSW 15 72937162 splice site probably null
R6893:Trappc9 UTSW 15 72925650 missense possibly damaging 0.93
R7099:Trappc9 UTSW 15 72693619 missense probably benign 0.00
R7276:Trappc9 UTSW 15 73052270 missense probably damaging 0.99
R7349:Trappc9 UTSW 15 72736869 nonsense probably null
R8260:Trappc9 UTSW 15 72941909 nonsense probably null
R8399:Trappc9 UTSW 15 73052282 missense probably damaging 1.00
R8683:Trappc9 UTSW 15 73012815 missense probably benign 0.26
R8839:Trappc9 UTSW 15 73058238 nonsense probably null
R8945:Trappc9 UTSW 15 73058096 missense probably benign
R9323:Trappc9 UTSW 15 72693582 missense probably benign 0.41
R9329:Trappc9 UTSW 15 72801353 missense unknown
R9366:Trappc9 UTSW 15 72937088 missense probably benign
RF008:Trappc9 UTSW 15 72801289 small insertion probably benign
RF009:Trappc9 UTSW 15 72801287 small insertion probably benign
RF014:Trappc9 UTSW 15 72801283 small insertion probably benign
RF016:Trappc9 UTSW 15 72801289 small insertion probably benign
RF023:Trappc9 UTSW 15 72801324 small insertion probably benign
RF023:Trappc9 UTSW 15 72801331 small insertion probably benign
RF028:Trappc9 UTSW 15 72801290 small insertion probably benign
RF029:Trappc9 UTSW 15 72801323 small insertion probably benign
RF030:Trappc9 UTSW 15 72801325 small insertion probably benign
RF034:Trappc9 UTSW 15 72801298 small insertion probably benign
RF036:Trappc9 UTSW 15 72801320 small insertion probably benign
RF038:Trappc9 UTSW 15 72801323 small insertion probably benign
RF040:Trappc9 UTSW 15 72801292 small insertion probably benign
RF042:Trappc9 UTSW 15 72801283 small insertion probably benign
RF043:Trappc9 UTSW 15 72801305 small insertion probably benign
RF049:Trappc9 UTSW 15 72801301 small insertion probably benign
RF049:Trappc9 UTSW 15 72801306 small insertion probably benign
RF053:Trappc9 UTSW 15 72801328 small insertion probably benign
RF057:Trappc9 UTSW 15 72801295 small insertion probably benign
RF063:Trappc9 UTSW 15 72801320 small insertion probably benign
RF063:Trappc9 UTSW 15 72801324 small insertion probably benign
Z1177:Trappc9 UTSW 15 73052162 missense probably null 0.51
Predicted Primers PCR Primer
(F):5'- GGTTGTTCTTAAACCTAGTGCC -3'
(R):5'- CCCCTACTCTGAAATGGCAAAG -3'

Sequencing Primer
(F):5'- TGTTCTTAAACCTAGTGCCTCACAC -3'
(R):5'- AAAGTTGCCTCTCTTTGCTGCTG -3'
Posted On 2021-12-30