Incidental Mutation 'R9083:Pdzph1'
ID 690432
Institutional Source Beutler Lab
Gene Symbol Pdzph1
Ensembl Gene ENSMUSG00000024227
Gene Name PDZ and pleckstrin homology domains 1
Synonyms 2610034M16Rik
MMRRC Submission 068902-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.084) question?
Stock # R9083 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 59185803-59298344 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 59261395 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 879 (R879L)
Ref Sequence ENSEMBL: ENSMUSP00000025064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025064]
AlphaFold Q8BGR1
Predicted Effect possibly damaging
Transcript: ENSMUST00000025064
AA Change: R879L

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000025064
Gene: ENSMUSG00000024227
AA Change: R879L

DomainStartEndE-ValueType
Blast:PDZ 780 844 6e-20 BLAST
PDZ 915 984 3.31e-15 SMART
PH 993 1096 9.4e-19 SMART
PH 1120 1218 2.83e-13 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A T 6: 128,534,524 (GRCm39) S844R possibly damaging Het
Adig C A 2: 158,347,709 (GRCm39) probably benign Het
Aspm A G 1: 139,421,436 (GRCm39) N3106S possibly damaging Het
Bcas1 A T 2: 170,190,081 (GRCm39) probably benign Het
Bco1 A C 8: 117,844,143 (GRCm39) I286L probably benign Het
Bnc1 C T 7: 81,624,646 (GRCm39) V194I probably benign Het
Bptf G A 11: 106,959,176 (GRCm39) R1912W probably damaging Het
Cacna1a A G 8: 85,344,511 (GRCm39) I1858V probably benign Het
Chdh T C 14: 29,753,703 (GRCm39) F204S probably damaging Het
Cic A G 7: 24,985,470 (GRCm39) T1212A probably damaging Het
Cpne7 C T 8: 123,856,951 (GRCm39) P402L probably damaging Het
Cts8 A G 13: 61,397,036 (GRCm39) Y295H probably damaging Het
Cyp1a2 T C 9: 57,587,572 (GRCm39) T333A probably benign Het
Cyp2a12 T C 7: 26,735,944 (GRCm39) F451S probably damaging Het
Dmxl2 T C 9: 54,316,548 (GRCm39) I1613V probably benign Het
Eme1 A G 11: 94,540,958 (GRCm39) L260S probably damaging Het
Ermp1 A C 19: 29,623,415 (GRCm39) S192A probably benign Het
Fam186a T C 15: 99,843,079 (GRCm39) Q1055R probably benign Het
Fat1 C T 8: 45,466,127 (GRCm39) T1462M possibly damaging Het
Fat1 A G 8: 45,491,336 (GRCm39) N3822S probably benign Het
Gm973 A G 1: 59,675,317 (GRCm39) T225A Het
Gnl2 A G 4: 124,941,357 (GRCm39) Y367C probably damaging Het
Golga5 T A 12: 102,458,476 (GRCm39) S640T probably benign Het
Inafm1 A G 7: 16,007,196 (GRCm39) V7A unknown Het
Irx2 A G 13: 72,777,392 (GRCm39) D71G possibly damaging Het
Kash5 G A 7: 44,854,058 (GRCm39) R24C unknown Het
Kif13a T C 13: 46,966,263 (GRCm39) Y448C probably damaging Het
Lcor G T 19: 41,574,839 (GRCm39) R1198L probably damaging Het
Ldlrad4 A T 18: 68,197,746 (GRCm39) N10I probably benign Het
Lix1 T C 17: 17,677,392 (GRCm39) Y196H possibly damaging Het
Lrrc37 A C 11: 103,509,830 (GRCm39) S713A unknown Het
Mon1a A G 9: 107,779,835 (GRCm39) Y468C probably damaging Het
Mroh4 A T 15: 74,498,140 (GRCm39) I177N probably damaging Het
Mterf4 A T 1: 93,229,515 (GRCm39) Y236* probably null Het
Myo1f T A 17: 33,813,036 (GRCm39) I614N probably damaging Het
Nbas T A 12: 13,385,856 (GRCm39) S707T possibly damaging Het
Ncl A T 1: 86,279,183 (GRCm39) S577T possibly damaging Het
Or10al4 T A 17: 38,037,060 (GRCm39) N48K probably damaging Het
Or52d13 T C 7: 103,109,896 (GRCm39) D173G Het
Or6c2b A T 10: 128,947,892 (GRCm39) M134K probably damaging Het
Or6c69c A T 10: 129,910,941 (GRCm39) M221L probably benign Het
Or6c69c G C 10: 129,910,969 (GRCm39) S230T probably benign Het
Or7g17 A T 9: 18,768,550 (GRCm39) I201F probably benign Het
Or8g17 A G 9: 38,930,016 (GRCm39) S274P probably damaging Het
Padi1 C A 4: 140,559,602 (GRCm39) probably null Het
Patj G A 4: 98,401,871 (GRCm39) V1004M probably benign Het
Pcdhb9 A T 18: 37,535,770 (GRCm39) D588V probably damaging Het
Pla2g2c G A 4: 138,463,378 (GRCm39) V91I probably benign Het
Plin4 T C 17: 56,416,345 (GRCm39) D53G possibly damaging Het
Poll T C 19: 45,546,317 (GRCm39) Q241R probably benign Het
Recql5 A T 11: 115,785,475 (GRCm39) L674M possibly damaging Het
Shroom3 G A 5: 93,098,533 (GRCm39) G1338S probably damaging Het
Slc38a8 C T 8: 120,212,780 (GRCm39) V294I probably benign Het
Slc4a1ap T C 5: 31,684,457 (GRCm39) V31A probably benign Het
Tln2 G A 9: 67,269,927 (GRCm39) P489S probably damaging Het
Trappc9 G A 15: 72,608,626 (GRCm39) R928* probably null Het
Uba7 C A 9: 107,855,166 (GRCm39) T343N probably benign Het
Vasn C T 16: 4,467,871 (GRCm39) T606I probably benign Het
Xrn2 T A 2: 146,880,199 (GRCm39) D507E probably damaging Het
Zfp592 T A 7: 80,674,644 (GRCm39) M536K possibly damaging Het
Zfp932 A T 5: 110,157,100 (GRCm39) H266L probably damaging Het
Other mutations in Pdzph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Pdzph1 APN 17 59,281,791 (GRCm39) missense possibly damaging 0.46
IGL00644:Pdzph1 APN 17 59,195,105 (GRCm39) missense probably benign
IGL01413:Pdzph1 APN 17 59,186,147 (GRCm39) missense possibly damaging 0.82
IGL01530:Pdzph1 APN 17 59,229,710 (GRCm39) missense probably damaging 1.00
IGL02089:Pdzph1 APN 17 59,274,334 (GRCm39) missense possibly damaging 0.92
IGL02201:Pdzph1 APN 17 59,274,506 (GRCm39) splice site probably benign
IGL02548:Pdzph1 APN 17 59,280,386 (GRCm39) missense probably benign 0.10
IGL02618:Pdzph1 APN 17 59,186,068 (GRCm39) utr 3 prime probably benign
IGL02660:Pdzph1 APN 17 59,187,642 (GRCm39) missense probably damaging 0.97
IGL02749:Pdzph1 APN 17 59,239,478 (GRCm39) missense possibly damaging 0.95
IGL02876:Pdzph1 APN 17 59,281,064 (GRCm39) missense probably benign
IGL03304:Pdzph1 APN 17 59,187,641 (GRCm39) missense probably damaging 1.00
IGL03336:Pdzph1 APN 17 59,281,229 (GRCm39) missense probably benign 0.00
R0008:Pdzph1 UTSW 17 59,229,756 (GRCm39) splice site probably benign
R0008:Pdzph1 UTSW 17 59,229,756 (GRCm39) splice site probably benign
R0498:Pdzph1 UTSW 17 59,280,825 (GRCm39) missense probably benign 0.00
R0553:Pdzph1 UTSW 17 59,229,722 (GRCm39) missense probably damaging 1.00
R0594:Pdzph1 UTSW 17 59,261,474 (GRCm39) missense possibly damaging 0.76
R1306:Pdzph1 UTSW 17 59,239,427 (GRCm39) missense possibly damaging 0.90
R1370:Pdzph1 UTSW 17 59,281,082 (GRCm39) missense possibly damaging 0.73
R1382:Pdzph1 UTSW 17 59,281,742 (GRCm39) missense probably benign 0.10
R1463:Pdzph1 UTSW 17 59,239,440 (GRCm39) missense probably damaging 1.00
R1766:Pdzph1 UTSW 17 59,280,747 (GRCm39) missense probably benign 0.16
R1773:Pdzph1 UTSW 17 59,281,808 (GRCm39) missense probably damaging 0.98
R1862:Pdzph1 UTSW 17 59,229,578 (GRCm39) missense probably damaging 1.00
R2070:Pdzph1 UTSW 17 59,281,092 (GRCm39) missense probably benign 0.04
R2071:Pdzph1 UTSW 17 59,281,092 (GRCm39) missense probably benign 0.04
R2229:Pdzph1 UTSW 17 59,239,407 (GRCm39) splice site probably benign
R2264:Pdzph1 UTSW 17 59,195,162 (GRCm39) critical splice acceptor site probably null
R2334:Pdzph1 UTSW 17 59,229,644 (GRCm39) missense probably damaging 1.00
R3750:Pdzph1 UTSW 17 59,280,331 (GRCm39) nonsense probably null
R4700:Pdzph1 UTSW 17 59,281,541 (GRCm39) missense probably damaging 0.98
R4847:Pdzph1 UTSW 17 59,280,525 (GRCm39) missense possibly damaging 0.95
R4868:Pdzph1 UTSW 17 59,281,751 (GRCm39) missense probably benign 0.00
R5130:Pdzph1 UTSW 17 59,229,604 (GRCm39) missense probably damaging 1.00
R5329:Pdzph1 UTSW 17 59,281,875 (GRCm39) missense probably damaging 1.00
R5574:Pdzph1 UTSW 17 59,280,942 (GRCm39) missense probably benign 0.00
R5770:Pdzph1 UTSW 17 59,186,146 (GRCm39) missense probably damaging 1.00
R5795:Pdzph1 UTSW 17 59,192,862 (GRCm39) missense possibly damaging 0.47
R5842:Pdzph1 UTSW 17 59,281,407 (GRCm39) missense possibly damaging 0.64
R5851:Pdzph1 UTSW 17 59,280,741 (GRCm39) missense probably benign 0.02
R6158:Pdzph1 UTSW 17 59,280,622 (GRCm39) missense probably damaging 0.96
R6813:Pdzph1 UTSW 17 59,281,431 (GRCm39) missense probably benign 0.08
R7022:Pdzph1 UTSW 17 59,281,121 (GRCm39) missense probably benign 0.02
R7395:Pdzph1 UTSW 17 59,186,154 (GRCm39) missense possibly damaging 0.85
R7525:Pdzph1 UTSW 17 59,274,336 (GRCm39) missense possibly damaging 0.73
R7944:Pdzph1 UTSW 17 59,239,455 (GRCm39) missense probably damaging 1.00
R7945:Pdzph1 UTSW 17 59,239,455 (GRCm39) missense probably damaging 1.00
R7992:Pdzph1 UTSW 17 59,186,105 (GRCm39) missense possibly damaging 0.71
R8016:Pdzph1 UTSW 17 59,239,476 (GRCm39) missense probably damaging 0.98
R8116:Pdzph1 UTSW 17 59,282,138 (GRCm39) missense probably benign 0.01
R8273:Pdzph1 UTSW 17 59,280,009 (GRCm39) missense probably benign 0.00
R8523:Pdzph1 UTSW 17 59,191,008 (GRCm39) missense probably damaging 1.00
R8819:Pdzph1 UTSW 17 59,187,715 (GRCm39) nonsense probably null
R8820:Pdzph1 UTSW 17 59,187,715 (GRCm39) nonsense probably null
R8839:Pdzph1 UTSW 17 59,257,237 (GRCm39) missense probably benign 0.02
R8871:Pdzph1 UTSW 17 59,195,033 (GRCm39) missense probably damaging 1.00
R8898:Pdzph1 UTSW 17 59,281,334 (GRCm39) missense probably benign 0.00
R8959:Pdzph1 UTSW 17 59,281,599 (GRCm39) missense probably damaging 0.97
R9043:Pdzph1 UTSW 17 59,280,535 (GRCm39) missense probably benign 0.05
R9092:Pdzph1 UTSW 17 59,280,125 (GRCm39) missense probably damaging 1.00
R9682:Pdzph1 UTSW 17 59,257,262 (GRCm39) missense probably damaging 1.00
R9757:Pdzph1 UTSW 17 59,281,898 (GRCm39) nonsense probably null
R9774:Pdzph1 UTSW 17 59,281,751 (GRCm39) missense probably benign 0.00
X0028:Pdzph1 UTSW 17 59,186,116 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAGGTTCTTTAATACATGCCAAC -3'
(R):5'- TAATGCTCTTTATCCTAGGGCC -3'

Sequencing Primer
(F):5'- GGTTCTTTAATACATGCCAACTACCC -3'
(R):5'- GTTTTCACCATGACCCCAGGAG -3'
Posted On 2021-12-30