Incidental Mutation 'R9085:Emc1'
ID 690517
Institutional Source Beutler Lab
Gene Symbol Emc1
Ensembl Gene ENSMUSG00000078517
Gene Name ER membrane protein complex subunit 1
Synonyms C230096C10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock # R9085 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 139352587-139378730 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 139367163 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 676 (Y676H)
Ref Sequence ENSEMBL: ENSMUSP00000137103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042096] [ENSMUST00000082262] [ENSMUST00000147999] [ENSMUST00000155700] [ENSMUST00000179784]
AlphaFold Q8C7X2
Predicted Effect possibly damaging
Transcript: ENSMUST00000042096
AA Change: Y673H

PolyPhen 2 Score 0.619 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000049034
Gene: ENSMUSG00000078517
AA Change: Y673H

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 5.3e-9 PFAM
Pfam:DUF1620 787 993 1.1e-66 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000082262
AA Change: Y676H

PolyPhen 2 Score 0.826 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000080888
Gene: ENSMUSG00000078517
AA Change: Y676H

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 4.7e-10 PFAM
Pfam:DUF1620 791 996 1.1e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147999
SMART Domains Protein: ENSMUSP00000117419
Gene: ENSMUSG00000066036

DomainStartEndE-ValueType
low complexity region 170 226 N/A INTRINSIC
low complexity region 617 629 N/A INTRINSIC
Pfam:E3_UbLigase_R4 1205 1301 4.5e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155700
Predicted Effect possibly damaging
Transcript: ENSMUST00000179784
AA Change: Y676H

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000137103
Gene: ENSMUSG00000078517
AA Change: Y676H

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 5.3e-9 PFAM
Pfam:DUF1620 790 996 1.1e-66 PFAM
Meta Mutation Damage Score 0.8014 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type I transmembrane protein, which is a subunit of the endoplasmic reticulum membrane protein complex (EMC). Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg1l G A 10: 42,318,641 T385M probably damaging Het
Arhgap29 T A 3: 122,014,600 D1142E probably benign Het
Ash1l C T 3: 88,981,987 A391V probably benign Het
Ash1l T C 3: 88,984,222 V1136A probably benign Het
Cacna1c G T 6: 118,638,505 Y1308* probably null Het
Cacna1g A T 11: 94,443,220 V865E probably benign Het
Cbx2 C T 11: 119,029,088 T493M possibly damaging Het
Cyp2a12 T C 7: 27,036,519 F451S probably damaging Het
Dlec1 G T 9: 119,124,184 C572F probably damaging Het
Dmtn A G 14: 70,616,094 S92P probably damaging Het
Dnah10 T C 5: 124,762,173 L1225P Het
Dnah2 G T 11: 69,429,398 H3954Q possibly damaging Het
Dntt C T 19: 41,055,781 R462C probably damaging Het
Epb41l4b A T 4: 57,041,064 probably null Het
Fer T A 17: 63,921,772 M214K probably damaging Het
Fgf17 A G 14: 70,636,996 F129L probably damaging Het
Foxn3 C T 12: 99,388,836 S23N probably damaging Het
Frmd4b A C 6: 97,292,373 S993A probably benign Het
Gdap1l1 T C 2: 163,438,588 W15R probably damaging Het
Gm11397 T C 13: 33,397,798 Y113H probably damaging Het
Gm884 A G 11: 103,616,739 Y1468H unknown Het
Golga5 T A 12: 102,492,217 S640T probably benign Het
Gucy2g A T 19: 55,233,165 Y301* probably null Het
Il31ra T C 13: 112,524,094 S654G Het
Lmnb2 T C 10: 80,904,257 D442G probably benign Het
Lpin1 T C 12: 16,573,714 Y223C Het
Mast3 A T 8: 70,796,717 W53R unknown Het
Mettl2 T C 11: 105,130,448 V180A possibly damaging Het
Mkl2 A C 16: 13,412,228 T926P probably damaging Het
Mospd3 C T 5: 137,600,608 probably benign Het
Mrpl18 A T 17: 12,915,695 V61E probably damaging Het
Muc2 T A 7: 141,700,489 C154S probably damaging Het
Mypn T G 10: 63,148,115 probably null Het
Nelfb C T 2: 25,204,280 C357Y probably damaging Het
Nes T G 3: 87,979,762 V1776G possibly damaging Het
Nin T A 12: 70,030,012 R1797* probably null Het
Nxpe2 A T 9: 48,339,572 I25K probably benign Het
Olfr1238 A G 2: 89,406,297 S261P probably damaging Het
Olfr994 T A 2: 85,430,275 T185S probably benign Het
Osbpl1a T C 18: 12,929,036 H60R probably damaging Het
Papss1 C A 3: 131,619,056 H425N probably damaging Het
Pde4dip T C 3: 97,694,069 N2344S probably benign Het
Pde6c G A 19: 38,178,121 V704I probably benign Het
Pknox1 C T 17: 31,603,255 T332M possibly damaging Het
Pla2r1 A T 2: 60,425,447 V1251D probably damaging Het
Plch2 T C 4: 155,000,519 D321G probably damaging Het
Plec A G 15: 76,173,075 S4221P probably damaging Het
Psg23 T G 7: 18,614,735 N49T possibly damaging Het
Qrfpr A G 3: 36,221,950 F97S probably damaging Het
Rab3ip G A 10: 116,939,405 S16L probably damaging Het
Rbm43 A G 2: 51,934,918 probably benign Het
Rpgrip1l T C 8: 91,287,675 N314D possibly damaging Het
Rpn2 C T 2: 157,283,647 T26I possibly damaging Het
Rsph6a A T 7: 19,065,325 N294Y probably damaging Het
Sesn1 C T 10: 41,810,839 probably benign Het
Sh3d19 T C 3: 86,126,685 Y782H probably damaging Het
Sh3rf1 C A 8: 61,349,459 D275E probably benign Het
Siglecg T C 7: 43,411,625 V374A probably benign Het
Slc6a11 A T 6: 114,225,847 I301F probably damaging Het
Spock1 A T 13: 57,423,143 F348I unknown Het
Sptlc2 T C 12: 87,336,065 K422E probably benign Het
Tas2r115 A T 6: 132,737,364 V208E probably benign Het
Tmem132a G T 19: 10,866,471 Q174K probably damaging Het
Tmtc1 A T 6: 148,336,251 Y338* probably null Het
Tnfaip1 G T 11: 78,530,139 L32I probably damaging Het
Tox2 T C 2: 163,225,561 C67R probably benign Het
Ube2o C T 11: 116,545,383 G311S probably damaging Het
Unc13d AATGCCTCCCATGCC AATGCCTCCCATGCCTCCCATGCC 11: 116,068,172 probably benign Het
Vav3 C T 3: 109,506,406 A220V probably benign Het
Xaf1 A G 11: 72,306,593 K132E probably benign Het
Zeb1 T C 18: 5,766,716 L409S probably damaging Het
Zfp51 T A 17: 21,464,398 L425H probably damaging Het
Other mutations in Emc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Emc1 APN 4 139355082 splice site probably benign
IGL00898:Emc1 APN 4 139371630 missense probably damaging 1.00
IGL01481:Emc1 APN 4 139362099 missense probably benign 0.00
IGL02174:Emc1 APN 4 139371668 missense possibly damaging 0.95
IGL02264:Emc1 APN 4 139375464 missense probably damaging 1.00
IGL02501:Emc1 APN 4 139370984 missense probably benign 0.00
IGL02697:Emc1 APN 4 139352644 missense probably benign
IGL03355:Emc1 APN 4 139371593 splice site probably benign
IGL03386:Emc1 APN 4 139363781 critical splice donor site probably null
PIT4480001:Emc1 UTSW 4 139359277 missense possibly damaging 0.69
R0023:Emc1 UTSW 4 139371009 missense probably damaging 1.00
R0023:Emc1 UTSW 4 139371009 missense probably damaging 1.00
R0051:Emc1 UTSW 4 139375163 missense possibly damaging 0.81
R0094:Emc1 UTSW 4 139360485 missense probably damaging 0.99
R0613:Emc1 UTSW 4 139375072 splice site probably benign
R1464:Emc1 UTSW 4 139370937 missense probably damaging 0.97
R1464:Emc1 UTSW 4 139370937 missense probably damaging 0.97
R1512:Emc1 UTSW 4 139360184 splice site probably null
R1702:Emc1 UTSW 4 139375201 missense probably damaging 1.00
R1839:Emc1 UTSW 4 139360485 missense probably damaging 0.98
R1843:Emc1 UTSW 4 139375512 missense probably benign 0.02
R1850:Emc1 UTSW 4 139359373 splice site probably benign
R2024:Emc1 UTSW 4 139360946 missense possibly damaging 0.95
R2196:Emc1 UTSW 4 139366530 missense probably benign 0.08
R2912:Emc1 UTSW 4 139365260 missense possibly damaging 0.51
R3696:Emc1 UTSW 4 139365386 missense possibly damaging 0.46
R3697:Emc1 UTSW 4 139365386 missense possibly damaging 0.46
R3698:Emc1 UTSW 4 139365386 missense possibly damaging 0.46
R3803:Emc1 UTSW 4 139367163 missense possibly damaging 0.91
R3923:Emc1 UTSW 4 139363185 nonsense probably null
R4738:Emc1 UTSW 4 139362202 missense possibly damaging 0.52
R4914:Emc1 UTSW 4 139375165 nonsense probably null
R5033:Emc1 UTSW 4 139371696 missense probably damaging 1.00
R5322:Emc1 UTSW 4 139354246 missense probably damaging 1.00
R5375:Emc1 UTSW 4 139366491 missense probably damaging 0.96
R5483:Emc1 UTSW 4 139375376 missense probably damaging 1.00
R5587:Emc1 UTSW 4 139362148 missense probably damaging 0.98
R5687:Emc1 UTSW 4 139375380 missense probably damaging 1.00
R5938:Emc1 UTSW 4 139357620 missense probably benign
R6056:Emc1 UTSW 4 139354222 missense possibly damaging 0.51
R6170:Emc1 UTSW 4 139366378 missense probably benign 0.01
R6174:Emc1 UTSW 4 139366531 missense probably benign 0.01
R6208:Emc1 UTSW 4 139354271 missense probably damaging 0.99
R6340:Emc1 UTSW 4 139365563 missense probably damaging 1.00
R6371:Emc1 UTSW 4 139371665 nonsense probably null
R6889:Emc1 UTSW 4 139365350 missense probably damaging 0.97
R7592:Emc1 UTSW 4 139360566 missense probably benign 0.00
R7699:Emc1 UTSW 4 139354870 missense probably benign
R7715:Emc1 UTSW 4 139371623 missense probably damaging 1.00
R7984:Emc1 UTSW 4 139375449 missense probably damaging 1.00
R8112:Emc1 UTSW 4 139367187 missense probably benign 0.00
R8325:Emc1 UTSW 4 139365210 missense possibly damaging 0.94
R8387:Emc1 UTSW 4 139361289 missense probably benign
R8751:Emc1 UTSW 4 139369968 missense possibly damaging 0.58
R9032:Emc1 UTSW 4 139367163 missense possibly damaging 0.91
R9474:Emc1 UTSW 4 139366394 missense probably damaging 0.98
R9482:Emc1 UTSW 4 139360890 missense probably damaging 0.96
R9610:Emc1 UTSW 4 139363724 missense probably benign 0.38
R9611:Emc1 UTSW 4 139363724 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- GAGCCTTAGATAGACCCAGTGAC -3'
(R):5'- AGCAGAATGACACACCCTTTG -3'

Sequencing Primer
(F):5'- GATAGACCCAGTGACTTGTTTTATC -3'
(R):5'- CCTTTGTGGGCTACGGGATC -3'
Posted On 2021-12-30