Mutagenetix > Incidental Mutation

Incidental Mutation 'R9085:Muc2'

690530

Institutional Source

Beutler Lab

Gene Symbol

Muc2

Ensembl Gene

ENSMUSG00000025515

Gene Name

mucin 2

Synonyms

2010015E03Rik

MMRRC Submission

068904-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.100) question?

Stock #

R9085 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

141276583-141308428 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 141287058 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 154 (C154S)

Ref Sequence

ENSEMBL: ENSMUSP00000140855 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000167366] [ENSMUST00000179227] [ENSMUST00000185406] [ENSMUST00000185823]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000167366
AA Change: C153S

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000128250
Gene: ENSMUSG00000025515
AA Change: C153S

Domain	Start	End	E-Value	Type
Pfam:VWD	3	72	2.3e-14	PFAM
C8	107	181	1.82e-31	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000179227

SMART Domains

Protein: ENSMUSP00000136692
Gene: ENSMUSG00000025515

Domain	Start	End	E-Value	Type
C8	11	85	1.61e-32	SMART
Blast:VWD	102	128	5e-8	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000185406

SMART Domains

Protein: ENSMUSP00000141040
Gene: ENSMUSG00000025515

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
VWD	20	183	1.5e-40	SMART
C8	216	290	3.9e-15	SMART
Pfam:TIL	293	349	5.4e-10	PFAM
VWC	351	411	7e-4	SMART
VWD	378	542	8.8e-44	SMART
C8	579	653	1.2e-36	SMART
SCOP:d1coua_	654	728	4e-8	SMART
VWC_def	820	865	1.3e-2	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000185823
AA Change: C154S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000140855
Gene: ENSMUSG00000025515
AA Change: C154S

Domain	Start	End	E-Value	Type
Pfam:VWD	3	73	5.6e-14	PFAM
C8	108	182	1.4e-35	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000187789

Predicted Effect

probably benign
Transcript: ENSMUST00000191587

Meta Mutation Damage Score

0.6329

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (72/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. The protein polymerizes into a gel of which 80% is composed of oligosaccharide side chains by weight. The protein features a central domain containing tandem repeats rich in threonine and proline that varies between 50 and 115 copies in different individuals. Downregulation of this gene has been observed in patients with Crohn disease and ulcerative colitis. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygotes for a point mutation have soft feces at weaning and develop diarrhea associated with malapsorption syndrome. Homozygous null mutants pass blood in their feces at 6 months, and 65% of null mutants have intestinal tumors at 1 year. [provided by MGI curators]

Allele List at MGI

All alleles(7) : Targeted(3) Chemically induced(4)

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Afg1l	G	A	10: 42,194,637 (GRCm39)	T385M	probably damaging	Het
Arhgap29	T	A	3: 121,808,249 (GRCm39)	D1142E	probably benign	Het
Ash1l	C	T	3: 88,889,294 (GRCm39)	A391V	probably benign	Het
Ash1l	T	C	3: 88,891,529 (GRCm39)	V1136A	probably benign	Het
Cacna1c	G	T	6: 118,615,466 (GRCm39)	Y1308*	probably null	Het
Cacna1g	A	T	11: 94,334,046 (GRCm39)	V865E	probably benign	Het
Cbx2	C	T	11: 118,919,914 (GRCm39)	T493M	possibly damaging	Het
Cyp2a12	T	C	7: 26,735,944 (GRCm39)	F451S	probably damaging	Het
Dlec1	G	T	9: 118,953,252 (GRCm39)	C572F	probably damaging	Het
Dmtn	A	G	14: 70,853,534 (GRCm39)	S92P	probably damaging	Het
Dnah10	T	C	5: 124,839,237 (GRCm39)	L1225P		Het
Dnah2	G	T	11: 69,320,224 (GRCm39)	H3954Q	possibly damaging	Het
Dntt	C	T	19: 41,044,220 (GRCm39)	R462C	probably damaging	Het
Emc1	T	C	4: 139,094,474 (GRCm39)	Y676H	possibly damaging	Het
Epb41l4b	A	T	4: 57,041,064 (GRCm39)		probably null	Het
Fer	T	A	17: 64,228,767 (GRCm39)	M214K	probably damaging	Het
Fgf17	A	G	14: 70,874,436 (GRCm39)	F129L	probably damaging	Het
Foxn3	C	T	12: 99,355,095 (GRCm39)	S23N	probably damaging	Het
Frmd4b	A	C	6: 97,269,334 (GRCm39)	S993A	probably benign	Het
Gdap1l1	T	C	2: 163,280,508 (GRCm39)	W15R	probably damaging	Het
Golga5	T	A	12: 102,458,476 (GRCm39)	S640T	probably benign	Het
Gucy2g	A	T	19: 55,221,597 (GRCm39)	Y301*	probably null	Het
Il31ra	T	C	13: 112,660,628 (GRCm39)	S654G		Het
Lmnb2	T	C	10: 80,740,091 (GRCm39)	D442G	probably benign	Het
Lpin1	T	C	12: 16,623,715 (GRCm39)	Y223C		Het
Lrrc37	A	G	11: 103,507,565 (GRCm39)	Y1468H	unknown	Het
Mast3	A	T	8: 71,249,361 (GRCm39)	W53R	unknown	Het
Mettl2	T	C	11: 105,021,274 (GRCm39)	V180A	possibly damaging	Het
Mospd3	C	T	5: 137,598,870 (GRCm39)		probably benign	Het
Mrpl18	A	T	17: 13,134,582 (GRCm39)	V61E	probably damaging	Het
Mrtfb	A	C	16: 13,230,092 (GRCm39)	T926P	probably damaging	Het
Mypn	T	G	10: 62,983,894 (GRCm39)		probably null	Het
Nelfb	C	T	2: 25,094,292 (GRCm39)	C357Y	probably damaging	Het
Nes	T	G	3: 87,887,069 (GRCm39)	V1776G	possibly damaging	Het
Nin	T	A	12: 70,076,786 (GRCm39)	R1797*	probably null	Het
Nxpe2	A	T	9: 48,250,872 (GRCm39)	I25K	probably benign	Het
Or4a39	A	G	2: 89,236,641 (GRCm39)	S261P	probably damaging	Het
Or5ak24	T	A	2: 85,260,619 (GRCm39)	T185S	probably benign	Het
Osbpl1a	T	C	18: 13,062,093 (GRCm39)	H60R	probably damaging	Het
Papss1	C	A	3: 131,324,817 (GRCm39)	H425N	probably damaging	Het
Pde4dip	T	C	3: 97,601,385 (GRCm39)	N2344S	probably benign	Het
Pde6c	G	A	19: 38,166,569 (GRCm39)	V704I	probably benign	Het
Pknox1	C	T	17: 31,822,229 (GRCm39)	T332M	possibly damaging	Het
Pla2r1	A	T	2: 60,255,791 (GRCm39)	V1251D	probably damaging	Het
Plch2	T	C	4: 155,084,976 (GRCm39)	D321G	probably damaging	Het
Plec	A	G	15: 76,057,275 (GRCm39)	S4221P	probably damaging	Het
Psg23	T	G	7: 18,348,660 (GRCm39)	N49T	possibly damaging	Het
Qrfpr	A	G	3: 36,276,099 (GRCm39)	F97S	probably damaging	Het
Rab3ip	G	A	10: 116,775,310 (GRCm39)	S16L	probably damaging	Het
Rbm43	A	G	2: 51,824,930 (GRCm39)		probably benign	Het
Rpgrip1l	T	C	8: 92,014,303 (GRCm39)	N314D	possibly damaging	Het
Rpn2	C	T	2: 157,125,567 (GRCm39)	T26I	possibly damaging	Het
Rsph6a	A	T	7: 18,799,250 (GRCm39)	N294Y	probably damaging	Het
Serpinb9h	T	C	13: 33,581,781 (GRCm39)	Y113H	probably damaging	Het
Sesn1	C	T	10: 41,686,835 (GRCm39)		probably benign	Het
Sh3d19	T	C	3: 86,033,992 (GRCm39)	Y782H	probably damaging	Het
Sh3rf1	C	A	8: 61,802,493 (GRCm39)	D275E	probably benign	Het
Siglecg	T	C	7: 43,061,049 (GRCm39)	V374A	probably benign	Het
Slc6a11	A	T	6: 114,202,808 (GRCm39)	I301F	probably damaging	Het
Spock1	A	T	13: 57,570,956 (GRCm39)	F348I	unknown	Het
Sptlc2	T	C	12: 87,382,839 (GRCm39)	K422E	probably benign	Het
Tas2r115	A	T	6: 132,714,327 (GRCm39)	V208E	probably benign	Het
Tmem132a	G	T	19: 10,843,835 (GRCm39)	Q174K	probably damaging	Het
Tmtc1	A	T	6: 148,237,749 (GRCm39)	Y338*	probably null	Het
Tnfaip1	G	T	11: 78,420,965 (GRCm39)	L32I	probably damaging	Het
Tox2	T	C	2: 163,067,481 (GRCm39)	C67R	probably benign	Het
Ube2o	C	T	11: 116,436,209 (GRCm39)	G311S	probably damaging	Het
Unc13d	AATGCCTCCCATGCC	AATGCCTCCCATGCCTCCCATGCC	11: 115,958,998 (GRCm39)		probably benign	Het
Vav3	C	T	3: 109,413,722 (GRCm39)	A220V	probably benign	Het
Xaf1	A	G	11: 72,197,419 (GRCm39)	K132E	probably benign	Het
Zeb1	T	C	18: 5,766,716 (GRCm39)	L409S	probably damaging	Het
Zfp51	T	A	17: 21,684,660 (GRCm39)	L425H	probably damaging	Het

Other mutations in Muc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
Eeyore	APN	7	141,693,356 (GRCm38)	missense	probably benign	0.35
kenny	APN	7	0 ()	nonsense
Winnie	APN	7	141,286,029 (GRCm39)	missense	probably damaging	1.00
IGL01303:Muc2	APN	7	141,306,132 (GRCm39)	missense	probably benign
IGL01482:Muc2	APN	7	141,307,797 (GRCm39)	missense	probably damaging	0.96
IGL01875:Muc2	APN	7	141,306,477 (GRCm39)	missense	probably damaging	0.99
IGL02088:Muc2	APN	7	141,305,241 (GRCm39)	missense	probably damaging	1.00
IGL02415:Muc2	APN	7	141,305,609 (GRCm39)	nonsense	probably null
IGL02548:Muc2	APN	7	141,305,594 (GRCm39)	missense	probably damaging	1.00
IGL02836:Muc2	APN	7	141,300,450 (GRCm39)	unclassified	probably benign
IGL03196:Muc2	APN	7	141,301,367 (GRCm39)	missense	probably damaging	0.97
Muskatenwein	UTSW	7	141,307,176 (GRCm39)	missense	unknown
nomoco	UTSW	7	141,307,456 (GRCm39)	missense	probably damaging	1.00
Schlendrian	UTSW	7	141,281,925 (GRCm39)	missense	probably damaging	1.00
Seco	UTSW	7	141,284,976 (GRCm39)	missense	probably damaging	1.00
BB001:Muc2	UTSW	7	141,281,631 (GRCm39)	missense	probably damaging	1.00
BB011:Muc2	UTSW	7	141,281,631 (GRCm39)	missense	probably damaging	1.00
E0370:Muc2	UTSW	7	141,282,598 (GRCm39)	missense	probably damaging	1.00
R0127:Muc2	UTSW	7	141,302,691 (GRCm39)	missense	probably benign	0.00
R0179:Muc2	UTSW	7	141,302,708 (GRCm39)	missense	probably damaging	1.00
R0201:Muc2	UTSW	7	141,699,185 (GRCm38)	frame shift	probably null
R0299:Muc2	UTSW	7	141,306,466 (GRCm39)	missense	probably damaging	1.00
R0547:Muc2	UTSW	7	141,699,185 (GRCm38)	frame shift	probably null
R0699:Muc2	UTSW	7	141,306,037 (GRCm39)	missense	probably damaging	1.00
R0900:Muc2	UTSW	7	141,699,185 (GRCm38)	frame shift	probably null
R1348:Muc2	UTSW	7	141,699,185 (GRCm38)	frame shift	probably null
R1466:Muc2	UTSW	7	141,302,711 (GRCm39)	missense	probably damaging	1.00
R1466:Muc2	UTSW	7	141,302,711 (GRCm39)	missense	probably damaging	1.00
R1625:Muc2	UTSW	7	141,283,405 (GRCm39)	missense	probably damaging	1.00
R2010:Muc2	UTSW	7	141,287,444 (GRCm39)	missense	probably damaging	0.99
R2149:Muc2	UTSW	7	141,699,185 (GRCm38)	frame shift	probably null
R2163:Muc2	UTSW	7	141,699,185 (GRCm38)	frame shift	probably null
R3008:Muc2	UTSW	7	141,281,347 (GRCm39)	missense	possibly damaging	0.93
R3110:Muc2	UTSW	7	141,299,225 (GRCm39)	unclassified	probably benign
R3112:Muc2	UTSW	7	141,299,225 (GRCm39)	unclassified	probably benign
R3424:Muc2	UTSW	7	141,279,595 (GRCm39)	missense	probably damaging	0.99
R3786:Muc2	UTSW	7	141,283,590 (GRCm39)	missense	probably benign	0.01
R3854:Muc2	UTSW	7	141,308,081 (GRCm39)	missense	probably damaging	1.00
R3964:Muc2	UTSW	7	141,286,233 (GRCm39)	missense	probably benign	0.17
R3965:Muc2	UTSW	7	141,286,233 (GRCm39)	missense	probably benign	0.17
R3966:Muc2	UTSW	7	141,286,233 (GRCm39)	missense	probably benign	0.17
R3973:Muc2	UTSW	7	141,300,541 (GRCm39)	unclassified	probably benign
R3974:Muc2	UTSW	7	141,300,541 (GRCm39)	unclassified	probably benign
R3976:Muc2	UTSW	7	141,300,541 (GRCm39)	unclassified	probably benign
R4327:Muc2	UTSW	7	141,281,577 (GRCm39)	missense	probably damaging	0.96
R4694:Muc2	UTSW	7	141,306,082 (GRCm39)	missense	probably damaging	1.00
R4764:Muc2	UTSW	7	141,299,345 (GRCm39)	missense	possibly damaging	0.88
R4769:Muc2	UTSW	7	141,286,260 (GRCm39)	critical splice donor site	probably null
R4798:Muc2	UTSW	7	141,307,877 (GRCm39)	missense	probably benign	0.01
R4900:Muc2	UTSW	7	141,303,280 (GRCm39)	missense	probably benign	0.32
R5383:Muc2	UTSW	7	141,307,456 (GRCm39)	missense	probably damaging	1.00
R5489:Muc2	UTSW	7	141,305,169 (GRCm39)	missense	probably benign	0.00
R5615:Muc2	UTSW	7	141,277,446 (GRCm39)	missense	probably damaging	1.00
R5856:Muc2	UTSW	7	141,299,381 (GRCm39)	unclassified	probably benign
R5919:Muc2	UTSW	7	141,281,171 (GRCm39)	missense	probably damaging	0.97
R5953:Muc2	UTSW	7	141,287,951 (GRCm39)	missense	probably damaging	0.96
R5979:Muc2	UTSW	7	141,305,143 (GRCm39)	missense	probably damaging	0.99
R5979:Muc2	UTSW	7	141,283,493 (GRCm39)	splice site	probably null
R6175:Muc2	UTSW	7	141,282,875 (GRCm39)	missense	probably damaging	1.00
R6213:Muc2	UTSW	7	141,305,151 (GRCm39)	missense	probably damaging	1.00
R6281:Muc2	UTSW	7	141,306,140 (GRCm39)	missense	probably damaging	1.00
R6321:Muc2	UTSW	7	141,287,397 (GRCm39)	missense	probably benign	0.28
R6390:Muc2	UTSW	7	141,305,883 (GRCm39)	missense	probably damaging	0.97
R6485:Muc2	UTSW	7	141,300,473 (GRCm39)	unclassified	probably benign
R6582:Muc2	UTSW	7	141,282,941 (GRCm39)	missense	probably benign	0.00
R6683:Muc2	UTSW	7	141,305,214 (GRCm39)	missense	probably benign	0.38
R6896:Muc2	UTSW	7	141,306,432 (GRCm39)	missense	possibly damaging	0.48
R6906:Muc2	UTSW	7	141,284,976 (GRCm39)	missense	probably damaging	1.00
R6924:Muc2	UTSW	7	141,284,077 (GRCm39)	missense	possibly damaging	0.87
R7040:Muc2	UTSW	7	141,305,194 (GRCm39)	missense	unknown
R7222:Muc2	UTSW	7	141,290,758 (GRCm39)	missense
R7251:Muc2	UTSW	7	141,278,965 (GRCm39)	missense	possibly damaging	0.91
R7282:Muc2	UTSW	7	141,306,481 (GRCm39)	missense
R7315:Muc2	UTSW	7	141,276,645 (GRCm39)	missense	probably damaging	0.99
R7421:Muc2	UTSW	7	141,301,863 (GRCm39)	missense
R7556:Muc2	UTSW	7	141,307,439 (GRCm39)	missense
R7651:Muc2	UTSW	7	141,290,750 (GRCm39)	missense
R7710:Muc2	UTSW	7	141,287,452 (GRCm39)	missense	possibly damaging	0.92
R7776:Muc2	UTSW	7	141,290,942 (GRCm39)	missense
R7813:Muc2	UTSW	7	141,282,543 (GRCm39)	splice site	probably null
R7843:Muc2	UTSW	7	141,281,662 (GRCm39)	missense	probably benign	0.03
R7869:Muc2	UTSW	7	141,303,471 (GRCm39)	missense
R7924:Muc2	UTSW	7	141,281,631 (GRCm39)	missense	probably damaging	1.00
R7993:Muc2	UTSW	7	141,308,173 (GRCm39)	missense
R8053:Muc2	UTSW	7	141,284,575 (GRCm39)	missense	probably benign	0.01
R8068:Muc2	UTSW	7	141,298,422 (GRCm39)	missense
R8099:Muc2	UTSW	7	141,299,175 (GRCm39)	splice site	probably null
R8192:Muc2	UTSW	7	141,305,215 (GRCm39)	missense
R8194:Muc2	UTSW	7	141,290,801 (GRCm39)	missense
R8545:Muc2	UTSW	7	141,306,130 (GRCm39)	missense	unknown
R8701:Muc2	UTSW	7	141,281,850 (GRCm39)	missense	probably damaging	1.00
R8883:Muc2	UTSW	7	141,287,469 (GRCm39)	missense	probably damaging	0.98
R8894:Muc2	UTSW	7	141,280,758 (GRCm39)	missense	probably damaging	1.00
R8905:Muc2	UTSW	7	141,279,643 (GRCm39)	missense	probably benign	0.00
R9024:Muc2	UTSW	7	141,287,936 (GRCm39)	missense	probably damaging	0.98
R9032:Muc2	UTSW	7	141,287,058 (GRCm39)	missense	probably damaging	1.00
R9091:Muc2	UTSW	7	141,290,816 (GRCm39)	missense
R9104:Muc2	UTSW	7	141,286,224 (GRCm39)	missense	probably damaging	1.00
R9114:Muc2	UTSW	7	141,287,983 (GRCm39)	nonsense	probably null
R9270:Muc2	UTSW	7	141,290,816 (GRCm39)	missense
R9297:Muc2	UTSW	7	141,302,759 (GRCm39)	missense
R9325:Muc2	UTSW	7	141,298,559 (GRCm39)	missense
R9354:Muc2	UTSW	7	141,307,157 (GRCm39)	missense
R9386:Muc2	UTSW	7	141,279,389 (GRCm39)	missense	probably damaging	1.00
R9529:Muc2	UTSW	7	141,287,453 (GRCm39)	missense	possibly damaging	0.55
R9550:Muc2	UTSW	7	141,308,242 (GRCm39)	missense	probably damaging	1.00
R9583:Muc2	UTSW	7	141,300,559 (GRCm39)	missense
R9607:Muc2	UTSW	7	141,305,190 (GRCm39)	missense
R9646:Muc2	UTSW	7	141,276,643 (GRCm39)	missense	probably benign
R9651:Muc2	UTSW	7	141,288,014 (GRCm39)	missense	probably damaging	0.99
R9774:Muc2	UTSW	7	141,285,811 (GRCm39)	missense	probably benign
R9784:Muc2	UTSW	7	141,280,785 (GRCm39)	nonsense	probably null
Z1176:Muc2	UTSW	7	141,300,451 (GRCm39)	missense
Z1177:Muc2	UTSW	7	141,298,531 (GRCm39)	missense

Predicted Primers

PCR Primer
(F):5'- CCCAAGTGACCTCAATGTGAG -3'
(R):5'- AAAGCGAGTCTCACTATGGCTC -3'

Sequencing Primer
(F):5'- CCAAGTGACCTCAATGTGAGTGTTC -3'
(R):5'- TCTCACTATGGCTCAAGAAAGG -3'

Posted On

2021-12-30