Incidental Mutation 'R9085:Mast3'
ID 690532
Institutional Source Beutler Lab
Gene Symbol Mast3
Ensembl Gene ENSMUSG00000031833
Gene Name microtubule associated serine/threonine kinase 3
Synonyms
MMRRC Submission 068904-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9085 (G1)
Quality Score 110.008
Status Not validated
Chromosome 8
Chromosomal Location 71230761-71257681 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 71249361 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 53 (W53R)
Ref Sequence ENSEMBL: ENSMUSP00000148817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166004] [ENSMUST00000211948] [ENSMUST00000212001] [ENSMUST00000212038] [ENSMUST00000212551] [ENSMUST00000212757] [ENSMUST00000212875]
AlphaFold Q3U214
Predicted Effect possibly damaging
Transcript: ENSMUST00000166004
AA Change: W45R

PolyPhen 2 Score 0.634 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833
AA Change: W45R

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
Pfam:DUF1908 64 337 4.4e-128 PFAM
S_TKc 373 646 2.77e-99 SMART
S_TK_X 647 710 2.39e-1 SMART
low complexity region 820 833 N/A INTRINSIC
low complexity region 910 942 N/A INTRINSIC
PDZ 958 1038 3.8e-15 SMART
low complexity region 1053 1074 N/A INTRINSIC
low complexity region 1089 1121 N/A INTRINSIC
low complexity region 1124 1150 N/A INTRINSIC
low complexity region 1180 1204 N/A INTRINSIC
low complexity region 1231 1248 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000211948
Predicted Effect unknown
Transcript: ENSMUST00000212001
AA Change: W53R
Predicted Effect probably benign
Transcript: ENSMUST00000212038
Predicted Effect probably benign
Transcript: ENSMUST00000212551
Predicted Effect probably benign
Transcript: ENSMUST00000212757
Predicted Effect probably benign
Transcript: ENSMUST00000212875
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (72/72)
Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg1l G A 10: 42,194,637 (GRCm39) T385M probably damaging Het
Arhgap29 T A 3: 121,808,249 (GRCm39) D1142E probably benign Het
Ash1l C T 3: 88,889,294 (GRCm39) A391V probably benign Het
Ash1l T C 3: 88,891,529 (GRCm39) V1136A probably benign Het
Cacna1c G T 6: 118,615,466 (GRCm39) Y1308* probably null Het
Cacna1g A T 11: 94,334,046 (GRCm39) V865E probably benign Het
Cbx2 C T 11: 118,919,914 (GRCm39) T493M possibly damaging Het
Cyp2a12 T C 7: 26,735,944 (GRCm39) F451S probably damaging Het
Dlec1 G T 9: 118,953,252 (GRCm39) C572F probably damaging Het
Dmtn A G 14: 70,853,534 (GRCm39) S92P probably damaging Het
Dnah10 T C 5: 124,839,237 (GRCm39) L1225P Het
Dnah2 G T 11: 69,320,224 (GRCm39) H3954Q possibly damaging Het
Dntt C T 19: 41,044,220 (GRCm39) R462C probably damaging Het
Emc1 T C 4: 139,094,474 (GRCm39) Y676H possibly damaging Het
Epb41l4b A T 4: 57,041,064 (GRCm39) probably null Het
Fer T A 17: 64,228,767 (GRCm39) M214K probably damaging Het
Fgf17 A G 14: 70,874,436 (GRCm39) F129L probably damaging Het
Foxn3 C T 12: 99,355,095 (GRCm39) S23N probably damaging Het
Frmd4b A C 6: 97,269,334 (GRCm39) S993A probably benign Het
Gdap1l1 T C 2: 163,280,508 (GRCm39) W15R probably damaging Het
Golga5 T A 12: 102,458,476 (GRCm39) S640T probably benign Het
Gucy2g A T 19: 55,221,597 (GRCm39) Y301* probably null Het
Il31ra T C 13: 112,660,628 (GRCm39) S654G Het
Lmnb2 T C 10: 80,740,091 (GRCm39) D442G probably benign Het
Lpin1 T C 12: 16,623,715 (GRCm39) Y223C Het
Lrrc37 A G 11: 103,507,565 (GRCm39) Y1468H unknown Het
Mettl2 T C 11: 105,021,274 (GRCm39) V180A possibly damaging Het
Mospd3 C T 5: 137,598,870 (GRCm39) probably benign Het
Mrpl18 A T 17: 13,134,582 (GRCm39) V61E probably damaging Het
Mrtfb A C 16: 13,230,092 (GRCm39) T926P probably damaging Het
Muc2 T A 7: 141,287,058 (GRCm39) C154S probably damaging Het
Mypn T G 10: 62,983,894 (GRCm39) probably null Het
Nelfb C T 2: 25,094,292 (GRCm39) C357Y probably damaging Het
Nes T G 3: 87,887,069 (GRCm39) V1776G possibly damaging Het
Nin T A 12: 70,076,786 (GRCm39) R1797* probably null Het
Nxpe2 A T 9: 48,250,872 (GRCm39) I25K probably benign Het
Or4a39 A G 2: 89,236,641 (GRCm39) S261P probably damaging Het
Or5ak24 T A 2: 85,260,619 (GRCm39) T185S probably benign Het
Osbpl1a T C 18: 13,062,093 (GRCm39) H60R probably damaging Het
Papss1 C A 3: 131,324,817 (GRCm39) H425N probably damaging Het
Pde4dip T C 3: 97,601,385 (GRCm39) N2344S probably benign Het
Pde6c G A 19: 38,166,569 (GRCm39) V704I probably benign Het
Pknox1 C T 17: 31,822,229 (GRCm39) T332M possibly damaging Het
Pla2r1 A T 2: 60,255,791 (GRCm39) V1251D probably damaging Het
Plch2 T C 4: 155,084,976 (GRCm39) D321G probably damaging Het
Plec A G 15: 76,057,275 (GRCm39) S4221P probably damaging Het
Psg23 T G 7: 18,348,660 (GRCm39) N49T possibly damaging Het
Qrfpr A G 3: 36,276,099 (GRCm39) F97S probably damaging Het
Rab3ip G A 10: 116,775,310 (GRCm39) S16L probably damaging Het
Rbm43 A G 2: 51,824,930 (GRCm39) probably benign Het
Rpgrip1l T C 8: 92,014,303 (GRCm39) N314D possibly damaging Het
Rpn2 C T 2: 157,125,567 (GRCm39) T26I possibly damaging Het
Rsph6a A T 7: 18,799,250 (GRCm39) N294Y probably damaging Het
Serpinb9h T C 13: 33,581,781 (GRCm39) Y113H probably damaging Het
Sesn1 C T 10: 41,686,835 (GRCm39) probably benign Het
Sh3d19 T C 3: 86,033,992 (GRCm39) Y782H probably damaging Het
Sh3rf1 C A 8: 61,802,493 (GRCm39) D275E probably benign Het
Siglecg T C 7: 43,061,049 (GRCm39) V374A probably benign Het
Slc6a11 A T 6: 114,202,808 (GRCm39) I301F probably damaging Het
Spock1 A T 13: 57,570,956 (GRCm39) F348I unknown Het
Sptlc2 T C 12: 87,382,839 (GRCm39) K422E probably benign Het
Tas2r115 A T 6: 132,714,327 (GRCm39) V208E probably benign Het
Tmem132a G T 19: 10,843,835 (GRCm39) Q174K probably damaging Het
Tmtc1 A T 6: 148,237,749 (GRCm39) Y338* probably null Het
Tnfaip1 G T 11: 78,420,965 (GRCm39) L32I probably damaging Het
Tox2 T C 2: 163,067,481 (GRCm39) C67R probably benign Het
Ube2o C T 11: 116,436,209 (GRCm39) G311S probably damaging Het
Unc13d AATGCCTCCCATGCC AATGCCTCCCATGCCTCCCATGCC 11: 115,958,998 (GRCm39) probably benign Het
Vav3 C T 3: 109,413,722 (GRCm39) A220V probably benign Het
Xaf1 A G 11: 72,197,419 (GRCm39) K132E probably benign Het
Zeb1 T C 18: 5,766,716 (GRCm39) L409S probably damaging Het
Zfp51 T A 17: 21,684,660 (GRCm39) L425H probably damaging Het
Other mutations in Mast3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Mast3 APN 8 71,233,327 (GRCm39) splice site probably benign
IGL01411:Mast3 APN 8 71,232,227 (GRCm39) missense possibly damaging 0.50
IGL01475:Mast3 APN 8 71,232,174 (GRCm39) missense probably damaging 1.00
IGL01886:Mast3 APN 8 71,234,783 (GRCm39) missense possibly damaging 0.94
IGL02104:Mast3 APN 8 71,240,550 (GRCm39) missense possibly damaging 0.78
IGL02236:Mast3 APN 8 71,241,888 (GRCm39) missense probably benign 0.36
IGL02437:Mast3 APN 8 71,233,202 (GRCm39) missense possibly damaging 0.79
IGL02704:Mast3 APN 8 71,239,519 (GRCm39) missense probably damaging 1.00
IGL03155:Mast3 APN 8 71,241,861 (GRCm39) missense probably damaging 1.00
IGL03366:Mast3 APN 8 71,234,207 (GRCm39) nonsense probably null
gravy UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
stuffing UTSW 8 71,237,441 (GRCm39) frame shift probably null
turkey UTSW 8 71,238,126 (GRCm39) missense probably damaging 1.00
BB010:Mast3 UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
BB020:Mast3 UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
R0037:Mast3 UTSW 8 71,236,343 (GRCm39) critical splice donor site probably null
R0280:Mast3 UTSW 8 71,240,564 (GRCm39) missense possibly damaging 0.65
R0280:Mast3 UTSW 8 71,236,439 (GRCm39) missense probably damaging 1.00
R0731:Mast3 UTSW 8 71,233,965 (GRCm39) missense probably damaging 1.00
R1101:Mast3 UTSW 8 71,239,307 (GRCm39) missense probably damaging 1.00
R1177:Mast3 UTSW 8 71,232,968 (GRCm39) missense probably damaging 1.00
R1208:Mast3 UTSW 8 71,240,916 (GRCm39) splice site probably null
R1208:Mast3 UTSW 8 71,240,916 (GRCm39) splice site probably null
R1333:Mast3 UTSW 8 71,233,938 (GRCm39) missense probably damaging 1.00
R1543:Mast3 UTSW 8 71,244,955 (GRCm39) missense possibly damaging 0.93
R1544:Mast3 UTSW 8 71,238,816 (GRCm39) missense probably damaging 1.00
R1738:Mast3 UTSW 8 71,237,200 (GRCm39) missense probably benign 0.38
R1842:Mast3 UTSW 8 71,233,037 (GRCm39) missense possibly damaging 0.91
R1936:Mast3 UTSW 8 71,237,444 (GRCm39) missense probably damaging 1.00
R2015:Mast3 UTSW 8 71,240,007 (GRCm39) missense probably benign 0.00
R2219:Mast3 UTSW 8 71,233,607 (GRCm39) missense probably damaging 0.99
R2220:Mast3 UTSW 8 71,233,607 (GRCm39) missense probably damaging 0.99
R3711:Mast3 UTSW 8 71,232,251 (GRCm39) missense probably benign 0.13
R3919:Mast3 UTSW 8 71,232,066 (GRCm39) missense probably benign 0.02
R4027:Mast3 UTSW 8 71,240,552 (GRCm39) missense probably damaging 1.00
R4060:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4061:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4062:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4063:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4588:Mast3 UTSW 8 71,233,251 (GRCm39) nonsense probably null
R4672:Mast3 UTSW 8 71,237,441 (GRCm39) frame shift probably null
R4770:Mast3 UTSW 8 71,238,864 (GRCm39) missense probably damaging 1.00
R4822:Mast3 UTSW 8 71,233,010 (GRCm39) missense probably damaging 1.00
R4830:Mast3 UTSW 8 71,241,559 (GRCm39) missense possibly damaging 0.87
R5196:Mast3 UTSW 8 71,240,889 (GRCm39) missense probably damaging 1.00
R5333:Mast3 UTSW 8 71,236,145 (GRCm39) missense probably benign 0.03
R5428:Mast3 UTSW 8 71,237,377 (GRCm39) missense possibly damaging 0.95
R5656:Mast3 UTSW 8 71,238,865 (GRCm39) missense probably damaging 1.00
R5920:Mast3 UTSW 8 71,240,577 (GRCm39) missense probably benign 0.00
R6177:Mast3 UTSW 8 71,242,662 (GRCm39) missense probably damaging 1.00
R6186:Mast3 UTSW 8 71,238,127 (GRCm39) missense probably damaging 1.00
R6407:Mast3 UTSW 8 71,234,772 (GRCm39) missense probably benign 0.02
R6614:Mast3 UTSW 8 71,234,610 (GRCm39) missense possibly damaging 0.95
R6804:Mast3 UTSW 8 71,239,376 (GRCm39) missense probably benign 0.29
R6873:Mast3 UTSW 8 71,239,236 (GRCm39) nonsense probably null
R6930:Mast3 UTSW 8 71,252,115 (GRCm39) nonsense probably null
R6948:Mast3 UTSW 8 71,238,126 (GRCm39) missense probably damaging 1.00
R7084:Mast3 UTSW 8 71,232,117 (GRCm39) missense probably benign 0.14
R7253:Mast3 UTSW 8 71,242,326 (GRCm39) critical splice donor site probably null
R7316:Mast3 UTSW 8 71,232,432 (GRCm39) missense probably damaging 1.00
R7357:Mast3 UTSW 8 71,237,503 (GRCm39) missense probably damaging 1.00
R7405:Mast3 UTSW 8 71,238,815 (GRCm39) missense probably damaging 1.00
R7429:Mast3 UTSW 8 71,232,947 (GRCm39) missense probably damaging 1.00
R7430:Mast3 UTSW 8 71,232,947 (GRCm39) missense probably damaging 1.00
R7521:Mast3 UTSW 8 71,241,412 (GRCm39) missense probably benign 0.16
R7576:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R7933:Mast3 UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
R7998:Mast3 UTSW 8 71,236,214 (GRCm39) missense probably benign
R8021:Mast3 UTSW 8 71,240,896 (GRCm39) missense probably benign 0.02
R8204:Mast3 UTSW 8 71,240,925 (GRCm39) missense probably benign 0.00
R8327:Mast3 UTSW 8 71,232,062 (GRCm39) missense probably damaging 1.00
R8357:Mast3 UTSW 8 71,233,085 (GRCm39) missense probably benign 0.39
R8415:Mast3 UTSW 8 71,233,866 (GRCm39) missense probably damaging 1.00
R8457:Mast3 UTSW 8 71,233,085 (GRCm39) missense probably benign 0.39
R8530:Mast3 UTSW 8 71,240,877 (GRCm39) missense possibly damaging 0.92
R8891:Mast3 UTSW 8 71,233,801 (GRCm39) missense probably damaging 1.00
R8930:Mast3 UTSW 8 71,234,377 (GRCm39) splice site probably benign
R9002:Mast3 UTSW 8 71,233,904 (GRCm39) missense probably damaging 1.00
R9087:Mast3 UTSW 8 71,242,330 (GRCm39) missense possibly damaging 0.93
R9148:Mast3 UTSW 8 71,233,091 (GRCm39) missense probably damaging 0.98
R9364:Mast3 UTSW 8 71,238,826 (GRCm39) missense probably damaging 1.00
R9779:Mast3 UTSW 8 71,238,127 (GRCm39) missense probably damaging 1.00
Z1177:Mast3 UTSW 8 71,241,682 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GCACCTGTCTCAAGAAGTCC -3'
(R):5'- GAAATTACTGATCCCCGCGC -3'

Sequencing Primer
(F):5'- GAAGTCCTTGGACTCAAGTTCTGAC -3'
(R):5'- TGACGCTCGAGTGAGTACC -3'
Posted On 2021-12-30