Mutagenetix > Incidental Mutation

Incidental Mutation 'R9085:Mast3'

690532

Institutional Source

Beutler Lab

Gene Symbol

Mast3

Ensembl Gene

ENSMUSG00000031833

Gene Name

microtubule associated serine/threonine kinase 3

Synonyms

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_199308.2. MGI:2683541

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9085 (G1)

Quality Score

110.008

Status

Not validated

Chromosome

Chromosomal Location

70778117-70805054 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 70796717 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 53 (W53R)

Ref Sequence

ENSEMBL: ENSMUSP00000148817 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166004] [ENSMUST00000211948] [ENSMUST00000212001] [ENSMUST00000212038] [ENSMUST00000212551] [ENSMUST00000212757] [ENSMUST00000212875]

AlphaFold

Q3U214

Predicted Effect

possibly damaging
Transcript: ENSMUST00000166004
AA Change: W45R

PolyPhen 2 Score 0.634 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833
AA Change: W45R

Domain	Start	End	E-Value	Type
low complexity region	43	59	N/A	INTRINSIC
Pfam:DUF1908	64	337	4.4e-128	PFAM
S_TKc	373	646	2.77e-99	SMART
S_TK_X	647	710	2.39e-1	SMART
low complexity region	820	833	N/A	INTRINSIC
low complexity region	910	942	N/A	INTRINSIC
PDZ	958	1038	3.8e-15	SMART
low complexity region	1053	1074	N/A	INTRINSIC
low complexity region	1089	1121	N/A	INTRINSIC
low complexity region	1124	1150	N/A	INTRINSIC
low complexity region	1180	1204	N/A	INTRINSIC
low complexity region	1231	1248	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000211948

Predicted Effect

unknown
Transcript: ENSMUST00000212001
AA Change: W53R

Predicted Effect

probably benign
Transcript: ENSMUST00000212038

Predicted Effect

probably benign
Transcript: ENSMUST00000212551

Predicted Effect

probably benign
Transcript: ENSMUST00000212757

Predicted Effect

probably benign
Transcript: ENSMUST00000212875

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (72/72)

Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Afg1l	G	A	10: 42,318,641	T385M	probably damaging	Het
Arhgap29	T	A	3: 122,014,600	D1142E	probably benign	Het
Ash1l	C	T	3: 88,981,987	A391V	probably benign	Het
Ash1l	T	C	3: 88,984,222	V1136A	probably benign	Het
Cacna1c	G	T	6: 118,638,505	Y1308*	probably null	Het
Cacna1g	A	T	11: 94,443,220	V865E	probably benign	Het
Cbx2	C	T	11: 119,029,088	T493M	possibly damaging	Het
Cyp2a12	T	C	7: 27,036,519	F451S	probably damaging	Het
Dlec1	G	T	9: 119,124,184	C572F	probably damaging	Het
Dmtn	A	G	14: 70,616,094	S92P	probably damaging	Het
Dnah10	T	C	5: 124,762,173	L1225P		Het
Dnah2	G	T	11: 69,429,398	H3954Q	possibly damaging	Het
Dntt	C	T	19: 41,055,781	R462C	probably damaging	Het
Emc1	T	C	4: 139,367,163	Y676H	possibly damaging	Het
Epb41l4b	A	T	4: 57,041,064		probably null	Het
Fer	T	A	17: 63,921,772	M214K	probably damaging	Het
Fgf17	A	G	14: 70,636,996	F129L	probably damaging	Het
Foxn3	C	T	12: 99,388,836	S23N	probably damaging	Het
Frmd4b	A	C	6: 97,292,373	S993A	probably benign	Het
Gdap1l1	T	C	2: 163,438,588	W15R	probably damaging	Het
Gm11397	T	C	13: 33,397,798	Y113H	probably damaging	Het
Gm884	A	G	11: 103,616,739	Y1468H	unknown	Het
Golga5	T	A	12: 102,492,217	S640T	probably benign	Het
Gucy2g	A	T	19: 55,233,165	Y301*	probably null	Het
Il31ra	T	C	13: 112,524,094	S654G		Het
Lmnb2	T	C	10: 80,904,257	D442G	probably benign	Het
Lpin1	T	C	12: 16,573,714	Y223C		Het
Mettl2	T	C	11: 105,130,448	V180A	possibly damaging	Het
Mkl2	A	C	16: 13,412,228	T926P	probably damaging	Het
Mospd3	C	T	5: 137,600,608		probably benign	Het
Mrpl18	A	T	17: 12,915,695	V61E	probably damaging	Het
Muc2	T	A	7: 141,700,489	C154S	probably damaging	Het
Mypn	T	G	10: 63,148,115		probably null	Het
Nelfb	C	T	2: 25,204,280	C357Y	probably damaging	Het
Nes	T	G	3: 87,979,762	V1776G	possibly damaging	Het
Nin	T	A	12: 70,030,012	R1797*	probably null	Het
Nxpe2	A	T	9: 48,339,572	I25K	probably benign	Het
Olfr1238	A	G	2: 89,406,297	S261P	probably damaging	Het
Olfr994	T	A	2: 85,430,275	T185S	probably benign	Het
Osbpl1a	T	C	18: 12,929,036	H60R	probably damaging	Het
Papss1	C	A	3: 131,619,056	H425N	probably damaging	Het
Pde4dip	T	C	3: 97,694,069	N2344S	probably benign	Het
Pde6c	G	A	19: 38,178,121	V704I	probably benign	Het
Pknox1	C	T	17: 31,603,255	T332M	possibly damaging	Het
Pla2r1	A	T	2: 60,425,447	V1251D	probably damaging	Het
Plch2	T	C	4: 155,000,519	D321G	probably damaging	Het
Plec	A	G	15: 76,173,075	S4221P	probably damaging	Het
Psg23	T	G	7: 18,614,735	N49T	possibly damaging	Het
Qrfpr	A	G	3: 36,221,950	F97S	probably damaging	Het
Rab3ip	G	A	10: 116,939,405	S16L	probably damaging	Het
Rbm43	A	G	2: 51,934,918		probably benign	Het
Rpgrip1l	T	C	8: 91,287,675	N314D	possibly damaging	Het
Rpn2	C	T	2: 157,283,647	T26I	possibly damaging	Het
Rsph6a	A	T	7: 19,065,325	N294Y	probably damaging	Het
Sesn1	C	T	10: 41,810,839		probably benign	Het
Sh3d19	T	C	3: 86,126,685	Y782H	probably damaging	Het
Sh3rf1	C	A	8: 61,349,459	D275E	probably benign	Het
Siglecg	T	C	7: 43,411,625	V374A	probably benign	Het
Slc6a11	A	T	6: 114,225,847	I301F	probably damaging	Het
Spock1	A	T	13: 57,423,143	F348I	unknown	Het
Sptlc2	T	C	12: 87,336,065	K422E	probably benign	Het
Tas2r115	A	T	6: 132,737,364	V208E	probably benign	Het
Tmem132a	G	T	19: 10,866,471	Q174K	probably damaging	Het
Tmtc1	A	T	6: 148,336,251	Y338*	probably null	Het
Tnfaip1	G	T	11: 78,530,139	L32I	probably damaging	Het
Tox2	T	C	2: 163,225,561	C67R	probably benign	Het
Ube2o	C	T	11: 116,545,383	G311S	probably damaging	Het
Unc13d	AATGCCTCCCATGCC	AATGCCTCCCATGCCTCCCATGCC	11: 116,068,172		probably benign	Het
Vav3	C	T	3: 109,506,406	A220V	probably benign	Het
Xaf1	A	G	11: 72,306,593	K132E	probably benign	Het
Zeb1	T	C	18: 5,766,716	L409S	probably damaging	Het
Zfp51	T	A	17: 21,464,398	L425H	probably damaging	Het

Other mutations in Mast3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00952:Mast3	APN	8	70780683	splice site	probably benign
IGL01411:Mast3	APN	8	70779583	missense	possibly damaging	0.50
IGL01475:Mast3	APN	8	70779530	missense	probably damaging	1.00
IGL01886:Mast3	APN	8	70782139	missense	possibly damaging	0.94
IGL02104:Mast3	APN	8	70787906	missense	possibly damaging	0.78
IGL02236:Mast3	APN	8	70789244	missense	probably benign	0.36
IGL02437:Mast3	APN	8	70780558	missense	possibly damaging	0.79
IGL02704:Mast3	APN	8	70786875	missense	probably damaging	1.00
IGL03155:Mast3	APN	8	70789217	missense	probably damaging	1.00
IGL03366:Mast3	APN	8	70781563	nonsense	probably null
gravy	UTSW	8	70786635	missense	probably damaging	1.00
stuffing	UTSW	8	70784797	frame shift	probably null
turkey	UTSW	8	70785482	missense	probably damaging	1.00
BB010:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
BB020:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
R0037:Mast3	UTSW	8	70783699	critical splice donor site	probably null
R0280:Mast3	UTSW	8	70783795	missense	probably damaging	1.00
R0280:Mast3	UTSW	8	70787920	missense	possibly damaging	0.65
R0731:Mast3	UTSW	8	70781321	missense	probably damaging	1.00
R1101:Mast3	UTSW	8	70786663	missense	probably damaging	1.00
R1177:Mast3	UTSW	8	70780324	missense	probably damaging	1.00
R1208:Mast3	UTSW	8	70788272	splice site	probably null
R1208:Mast3	UTSW	8	70788272	splice site	probably null
R1333:Mast3	UTSW	8	70781294	missense	probably damaging	1.00
R1543:Mast3	UTSW	8	70792311	missense	possibly damaging	0.93
R1544:Mast3	UTSW	8	70786172	missense	probably damaging	1.00
R1738:Mast3	UTSW	8	70784556	missense	probably benign	0.38
R1842:Mast3	UTSW	8	70780393	missense	possibly damaging	0.91
R1936:Mast3	UTSW	8	70784800	missense	probably damaging	1.00
R2015:Mast3	UTSW	8	70787363	missense	probably benign	0.00
R2219:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R2220:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R3711:Mast3	UTSW	8	70779607	missense	probably benign	0.13
R3919:Mast3	UTSW	8	70779422	missense	probably benign	0.02
R4027:Mast3	UTSW	8	70787908	missense	probably damaging	1.00
R4060:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4061:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4062:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4063:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4588:Mast3	UTSW	8	70780607	nonsense	probably null
R4672:Mast3	UTSW	8	70784797	frame shift	probably null
R4770:Mast3	UTSW	8	70786220	missense	probably damaging	1.00
R4822:Mast3	UTSW	8	70780366	missense	probably damaging	1.00
R4830:Mast3	UTSW	8	70788915	missense	possibly damaging	0.87
R5196:Mast3	UTSW	8	70788245	missense	probably damaging	1.00
R5333:Mast3	UTSW	8	70783501	missense	probably benign	0.03
R5428:Mast3	UTSW	8	70784733	missense	possibly damaging	0.95
R5656:Mast3	UTSW	8	70786221	missense	probably damaging	1.00
R5920:Mast3	UTSW	8	70787933	missense	probably benign	0.00
R6177:Mast3	UTSW	8	70790018	missense	probably damaging	1.00
R6186:Mast3	UTSW	8	70785483	missense	probably damaging	1.00
R6407:Mast3	UTSW	8	70782128	missense	probably benign	0.02
R6614:Mast3	UTSW	8	70781966	missense	possibly damaging	0.95
R6804:Mast3	UTSW	8	70786732	missense	probably benign	0.29
R6873:Mast3	UTSW	8	70786592	nonsense	probably null
R6930:Mast3	UTSW	8	70799471	nonsense	probably null
R6948:Mast3	UTSW	8	70785482	missense	probably damaging	1.00
R7084:Mast3	UTSW	8	70779473	missense	probably benign	0.14
R7253:Mast3	UTSW	8	70789682	critical splice donor site	probably null
R7316:Mast3	UTSW	8	70779788	missense	probably damaging	1.00
R7357:Mast3	UTSW	8	70784859	missense	probably damaging	1.00
R7405:Mast3	UTSW	8	70786171	missense	probably damaging	1.00
R7429:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7430:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7521:Mast3	UTSW	8	70788768	missense	probably benign	0.16
R7576:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R7933:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
R7998:Mast3	UTSW	8	70783570	missense	probably benign
R8021:Mast3	UTSW	8	70788252	missense	probably benign	0.02
R8204:Mast3	UTSW	8	70788281	missense	probably benign	0.00
R8327:Mast3	UTSW	8	70779418	missense	probably damaging	1.00
R8357:Mast3	UTSW	8	70780441	missense	probably benign	0.39
R8415:Mast3	UTSW	8	70781222	missense	probably damaging	1.00
R8457:Mast3	UTSW	8	70780441	missense	probably benign	0.39
R8530:Mast3	UTSW	8	70788233	missense	possibly damaging	0.92
R8891:Mast3	UTSW	8	70781157	missense	probably damaging	1.00
R8930:Mast3	UTSW	8	70781733	splice site	probably benign
R9002:Mast3	UTSW	8	70781260	missense	probably damaging	1.00
R9087:Mast3	UTSW	8	70789686	missense	possibly damaging	0.93
R9148:Mast3	UTSW	8	70780447	missense	probably damaging	0.98
R9364:Mast3	UTSW	8	70786182	missense	probably damaging	1.00
R9779:Mast3	UTSW	8	70785483	missense	probably damaging	1.00
Z1177:Mast3	UTSW	8	70789038	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- GCACCTGTCTCAAGAAGTCC -3'
(R):5'- GAAATTACTGATCCCCGCGC -3'

Sequencing Primer
(F):5'- GAAGTCCTTGGACTCAAGTTCTGAC -3'
(R):5'- TGACGCTCGAGTGAGTACC -3'

Posted On

2021-12-30