Incidental Mutation 'R9085:Rab3ip'
ID 690539
Institutional Source Beutler Lab
Gene Symbol Rab3ip
Ensembl Gene ENSMUSG00000064181
Gene Name RAB3A interacting protein
Synonyms Rabin3, Gtpat12, SSX2 interacting protein
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9085 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 116905784-116950769 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 116939405 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Leucine at position 16 (S16L)
Ref Sequence ENSEMBL: ENSMUSP00000151708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020375] [ENSMUST00000218391] [ENSMUST00000219109] [ENSMUST00000219603]
AlphaFold Q68EF0
Predicted Effect probably damaging
Transcript: ENSMUST00000020375
AA Change: S16L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020375
Gene: ENSMUSG00000064181
AA Change: S16L

DomainStartEndE-ValueType
low complexity region 84 100 N/A INTRINSIC
PDB:4LHZ|F 157 200 9e-15 PDB
low complexity region 213 220 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000218391
AA Change: S16L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000219109
AA Change: S16L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000219603
AA Change: S16L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (72/72)
MGI Phenotype PHENOTYPE: Homozygous null mice are fertile and show no obvious abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg1l G A 10: 42,318,641 T385M probably damaging Het
Arhgap29 T A 3: 122,014,600 D1142E probably benign Het
Ash1l C T 3: 88,981,987 A391V probably benign Het
Ash1l T C 3: 88,984,222 V1136A probably benign Het
Cacna1c G T 6: 118,638,505 Y1308* probably null Het
Cacna1g A T 11: 94,443,220 V865E probably benign Het
Cbx2 C T 11: 119,029,088 T493M possibly damaging Het
Cyp2a12 T C 7: 27,036,519 F451S probably damaging Het
Dlec1 G T 9: 119,124,184 C572F probably damaging Het
Dmtn A G 14: 70,616,094 S92P probably damaging Het
Dnah10 T C 5: 124,762,173 L1225P Het
Dnah2 G T 11: 69,429,398 H3954Q possibly damaging Het
Dntt C T 19: 41,055,781 R462C probably damaging Het
Emc1 T C 4: 139,367,163 Y676H possibly damaging Het
Epb41l4b A T 4: 57,041,064 probably null Het
Fer T A 17: 63,921,772 M214K probably damaging Het
Fgf17 A G 14: 70,636,996 F129L probably damaging Het
Foxn3 C T 12: 99,388,836 S23N probably damaging Het
Frmd4b A C 6: 97,292,373 S993A probably benign Het
Gdap1l1 T C 2: 163,438,588 W15R probably damaging Het
Gm11397 T C 13: 33,397,798 Y113H probably damaging Het
Gm884 A G 11: 103,616,739 Y1468H unknown Het
Golga5 T A 12: 102,492,217 S640T probably benign Het
Gucy2g A T 19: 55,233,165 Y301* probably null Het
Il31ra T C 13: 112,524,094 S654G Het
Lmnb2 T C 10: 80,904,257 D442G probably benign Het
Lpin1 T C 12: 16,573,714 Y223C Het
Mast3 A T 8: 70,796,717 W53R unknown Het
Mettl2 T C 11: 105,130,448 V180A possibly damaging Het
Mkl2 A C 16: 13,412,228 T926P probably damaging Het
Mospd3 C T 5: 137,600,608 probably benign Het
Mrpl18 A T 17: 12,915,695 V61E probably damaging Het
Muc2 T A 7: 141,700,489 C154S probably damaging Het
Mypn T G 10: 63,148,115 probably null Het
Nelfb C T 2: 25,204,280 C357Y probably damaging Het
Nes T G 3: 87,979,762 V1776G possibly damaging Het
Nin T A 12: 70,030,012 R1797* probably null Het
Nxpe2 A T 9: 48,339,572 I25K probably benign Het
Olfr1238 A G 2: 89,406,297 S261P probably damaging Het
Olfr994 T A 2: 85,430,275 T185S probably benign Het
Osbpl1a T C 18: 12,929,036 H60R probably damaging Het
Papss1 C A 3: 131,619,056 H425N probably damaging Het
Pde4dip T C 3: 97,694,069 N2344S probably benign Het
Pde6c G A 19: 38,178,121 V704I probably benign Het
Pknox1 C T 17: 31,603,255 T332M possibly damaging Het
Pla2r1 A T 2: 60,425,447 V1251D probably damaging Het
Plch2 T C 4: 155,000,519 D321G probably damaging Het
Plec A G 15: 76,173,075 S4221P probably damaging Het
Psg23 T G 7: 18,614,735 N49T possibly damaging Het
Qrfpr A G 3: 36,221,950 F97S probably damaging Het
Rbm43 A G 2: 51,934,918 probably benign Het
Rpgrip1l T C 8: 91,287,675 N314D possibly damaging Het
Rpn2 C T 2: 157,283,647 T26I possibly damaging Het
Rsph6a A T 7: 19,065,325 N294Y probably damaging Het
Sesn1 C T 10: 41,810,839 probably benign Het
Sh3d19 T C 3: 86,126,685 Y782H probably damaging Het
Sh3rf1 C A 8: 61,349,459 D275E probably benign Het
Siglecg T C 7: 43,411,625 V374A probably benign Het
Slc6a11 A T 6: 114,225,847 I301F probably damaging Het
Spock1 A T 13: 57,423,143 F348I unknown Het
Sptlc2 T C 12: 87,336,065 K422E probably benign Het
Tas2r115 A T 6: 132,737,364 V208E probably benign Het
Tmem132a G T 19: 10,866,471 Q174K probably damaging Het
Tmtc1 A T 6: 148,336,251 Y338* probably null Het
Tnfaip1 G T 11: 78,530,139 L32I probably damaging Het
Tox2 T C 2: 163,225,561 C67R probably benign Het
Ube2o C T 11: 116,545,383 G311S probably damaging Het
Unc13d AATGCCTCCCATGCC AATGCCTCCCATGCCTCCCATGCC 11: 116,068,172 probably benign Het
Vav3 C T 3: 109,506,406 A220V probably benign Het
Xaf1 A G 11: 72,306,593 K132E probably benign Het
Zeb1 T C 18: 5,766,716 L409S probably damaging Het
Zfp51 T A 17: 21,464,398 L425H probably damaging Het
Other mutations in Rab3ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01912:Rab3ip APN 10 116907092 missense probably benign 0.09
IGL01946:Rab3ip APN 10 116937395 critical splice donor site probably null
IGL02665:Rab3ip APN 10 116937548 missense probably benign 0.02
R1538:Rab3ip UTSW 10 116939254 missense probably damaging 1.00
R1565:Rab3ip UTSW 10 116939223 missense probably benign 0.09
R1760:Rab3ip UTSW 10 116937510 missense probably damaging 1.00
R2077:Rab3ip UTSW 10 116918960 missense possibly damaging 0.87
R4441:Rab3ip UTSW 10 116915932 missense probably benign 0.19
R5442:Rab3ip UTSW 10 116918848 missense probably benign
R5526:Rab3ip UTSW 10 116918929 missense possibly damaging 0.61
R5682:Rab3ip UTSW 10 116907103 nonsense probably null
R5921:Rab3ip UTSW 10 116939247 missense probably damaging 1.00
R6254:Rab3ip UTSW 10 116915867 missense probably damaging 1.00
R7021:Rab3ip UTSW 10 116939378 missense probably damaging 1.00
R7026:Rab3ip UTSW 10 116937536 missense probably benign 0.18
R7326:Rab3ip UTSW 10 116937633 missense probably benign 0.07
R7408:Rab3ip UTSW 10 116937641 missense possibly damaging 0.62
R7655:Rab3ip UTSW 10 116914139 missense probably benign 0.04
R7656:Rab3ip UTSW 10 116914139 missense probably benign 0.04
R8363:Rab3ip UTSW 10 116918964 missense probably damaging 1.00
R8537:Rab3ip UTSW 10 116910154 missense probably damaging 1.00
R9086:Rab3ip UTSW 10 116939405 missense probably damaging 1.00
R9161:Rab3ip UTSW 10 116914161 missense probably damaging 1.00
R9451:Rab3ip UTSW 10 116939449 start codon destroyed probably null 0.97
R9563:Rab3ip UTSW 10 116918763 missense probably null 1.00
R9564:Rab3ip UTSW 10 116915875 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACAGTTGAAATGCCTGGG -3'
(R):5'- TTCCCAAGTTACTTCTGGGTAG -3'

Sequencing Primer
(F):5'- TGCCTGGGGGACGAATACAC -3'
(R):5'- CTTCTGGGTAGTATTTTACCACAAG -3'
Posted On 2021-12-30