Incidental Mutation 'R9085:Nin'
ID 690552
Institutional Source Beutler Lab
Gene Symbol Nin
Ensembl Gene ENSMUSG00000021068
Gene Name ninein
Synonyms 3110068G20Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9085 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 70011435-70113717 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 70030012 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 1797 (R1797*)
Ref Sequence ENSEMBL: ENSMUSP00000082422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021468] [ENSMUST00000085314] [ENSMUST00000095666] [ENSMUST00000169074] [ENSMUST00000220689] [ENSMUST00000222237] [ENSMUST00000222835] [ENSMUST00000223257]
AlphaFold Q61043
Predicted Effect probably null
Transcript: ENSMUST00000021468
AA Change: R1797*
SMART Domains Protein: ENSMUSP00000021468
Gene: ENSMUSG00000021068
AA Change: R1797*

DomainStartEndE-ValueType
internal_repeat_1 7 67 7.83e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 7.83e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1980 2013 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000085314
AA Change: R1797*
SMART Domains Protein: ENSMUSP00000082422
Gene: ENSMUSG00000021068
AA Change: R1797*

DomainStartEndE-ValueType
internal_repeat_1 7 67 4.15e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 4.15e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1971 2045 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000095666
AA Change: R1797*
SMART Domains Protein: ENSMUSP00000093327
Gene: ENSMUSG00000021068
AA Change: R1797*

DomainStartEndE-ValueType
internal_repeat_1 7 67 7.83e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 7.83e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1980 2013 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000169074
AA Change: R1797*
SMART Domains Protein: ENSMUSP00000129648
Gene: ENSMUSG00000021068
AA Change: R1797*

DomainStartEndE-ValueType
internal_repeat_1 7 67 7.83e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 7.83e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1980 2013 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000220689
AA Change: R1090*
Predicted Effect probably benign
Transcript: ENSMUST00000221579
Predicted Effect probably null
Transcript: ENSMUST00000222237
AA Change: R1797*
Predicted Effect probably benign
Transcript: ENSMUST00000222835
Predicted Effect probably null
Transcript: ENSMUST00000223257
AA Change: R1797*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the proteins important for centrosomal function. This protein is important for positioning and anchoring the microtubules minus-ends in epithelial cells. Localization of this protein to the centrosome requires three leucine zippers in the central coiled-coil domain. Multiple alternatively spliced transcript variants that encode different isoforms have been reported. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg1l G A 10: 42,318,641 T385M probably damaging Het
Arhgap29 T A 3: 122,014,600 D1142E probably benign Het
Ash1l C T 3: 88,981,987 A391V probably benign Het
Ash1l T C 3: 88,984,222 V1136A probably benign Het
Cacna1c G T 6: 118,638,505 Y1308* probably null Het
Cacna1g A T 11: 94,443,220 V865E probably benign Het
Cbx2 C T 11: 119,029,088 T493M possibly damaging Het
Cyp2a12 T C 7: 27,036,519 F451S probably damaging Het
Dlec1 G T 9: 119,124,184 C572F probably damaging Het
Dmtn A G 14: 70,616,094 S92P probably damaging Het
Dnah10 T C 5: 124,762,173 L1225P Het
Dnah2 G T 11: 69,429,398 H3954Q possibly damaging Het
Dntt C T 19: 41,055,781 R462C probably damaging Het
Emc1 T C 4: 139,367,163 Y676H possibly damaging Het
Fer T A 17: 63,921,772 M214K probably damaging Het
Fgf17 A G 14: 70,636,996 F129L probably damaging Het
Foxn3 C T 12: 99,388,836 S23N probably damaging Het
Frmd4b A C 6: 97,292,373 S993A probably benign Het
Gdap1l1 T C 2: 163,438,588 W15R probably damaging Het
Gm11397 T C 13: 33,397,798 Y113H probably damaging Het
Gm884 A G 11: 103,616,739 Y1468H unknown Het
Golga5 T A 12: 102,492,217 S640T probably benign Het
Gucy2g A T 19: 55,233,165 Y301* probably null Het
Il31ra T C 13: 112,524,094 S654G Het
Lmnb2 T C 10: 80,904,257 D442G probably benign Het
Lpin1 T C 12: 16,573,714 Y223C Het
Mast3 A T 8: 70,796,717 W53R unknown Het
Mettl2 T C 11: 105,130,448 V180A possibly damaging Het
Mkl2 A C 16: 13,412,228 T926P probably damaging Het
Mospd3 C T 5: 137,600,608 probably benign Het
Mrpl18 A T 17: 12,915,695 V61E probably damaging Het
Muc2 T A 7: 141,700,489 C154S probably damaging Het
Nelfb C T 2: 25,204,280 C357Y probably damaging Het
Nes T G 3: 87,979,762 V1776G possibly damaging Het
Nxpe2 A T 9: 48,339,572 I25K probably benign Het
Olfr1238 A G 2: 89,406,297 S261P probably damaging Het
Olfr994 T A 2: 85,430,275 T185S probably benign Het
Osbpl1a T C 18: 12,929,036 H60R probably damaging Het
Papss1 C A 3: 131,619,056 H425N probably damaging Het
Pde4dip T C 3: 97,694,069 N2344S probably benign Het
Pde6c G A 19: 38,178,121 V704I probably benign Het
Pknox1 C T 17: 31,603,255 T332M possibly damaging Het
Pla2r1 A T 2: 60,425,447 V1251D probably damaging Het
Plch2 T C 4: 155,000,519 D321G probably damaging Het
Plec A G 15: 76,173,075 S4221P probably damaging Het
Psg23 T G 7: 18,614,735 N49T possibly damaging Het
Qrfpr A G 3: 36,221,950 F97S probably damaging Het
Rab3ip G A 10: 116,939,405 S16L probably damaging Het
Rbm43 A G 2: 51,934,918 probably benign Het
Rpgrip1l T C 8: 91,287,675 N314D possibly damaging Het
Rpn2 C T 2: 157,283,647 T26I possibly damaging Het
Rsph6a A T 7: 19,065,325 N294Y probably damaging Het
Sesn1 C T 10: 41,810,839 probably benign Het
Sh3d19 T C 3: 86,126,685 Y782H probably damaging Het
Sh3rf1 C A 8: 61,349,459 D275E probably benign Het
Siglecg T C 7: 43,411,625 V374A probably benign Het
Slc6a11 A T 6: 114,225,847 I301F probably damaging Het
Spock1 A T 13: 57,423,143 F348I unknown Het
Sptlc2 T C 12: 87,336,065 K422E probably benign Het
Synpo2 GTCCTCCTCCTCCTCCTCCTC GTCCTCCTCCTCCTCCTC 3: 123,114,418 probably benign Het
Tas2r115 A T 6: 132,737,364 V208E probably benign Het
Tmem132a G T 19: 10,866,471 Q174K probably damaging Het
Tmtc1 A T 6: 148,336,251 Y338* probably null Het
Tnfaip1 G T 11: 78,530,139 L32I probably damaging Het
Tox2 T C 2: 163,225,561 C67R probably benign Het
Ube2o C T 11: 116,545,383 G311S probably damaging Het
Unc13d AATGCCTCCCATGCC AATGCCTCCCATGCCTCCCATGCC 11: 116,068,172 probably benign Het
Unc13d TCCCATGCC TCCCATGCCCCCCATGCC 11: 116,068,178 probably benign Het
Unc13d GCC GCCTCCCATACC 11: 116,068,184 probably benign Het
Vav3 C T 3: 109,506,406 A220V probably benign Het
Xaf1 A G 11: 72,306,593 K132E probably benign Het
Zeb1 T C 18: 5,766,716 L409S probably damaging Het
Zfp51 T A 17: 21,464,398 L425H probably damaging Het
Other mutations in Nin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00472:Nin APN 12 70030088 missense probably damaging 0.98
IGL00677:Nin APN 12 70026860 missense probably damaging 1.00
IGL00823:Nin APN 12 70014793 missense probably benign 0.01
IGL01103:Nin APN 12 70056758 missense probably damaging 0.99
IGL01113:Nin APN 12 70031779 missense probably damaging 1.00
IGL01420:Nin APN 12 70045414 missense probably benign 0.08
IGL01556:Nin APN 12 70043188 missense probably benign 0.01
IGL01663:Nin APN 12 70043665 missense possibly damaging 0.72
IGL02002:Nin APN 12 70062699 nonsense probably null
IGL02030:Nin APN 12 70045268 missense probably damaging 1.00
IGL02202:Nin APN 12 70055436 missense probably damaging 1.00
IGL02207:Nin APN 12 70056657 missense probably damaging 0.99
IGL02257:Nin APN 12 70102691 missense possibly damaging 0.71
IGL02394:Nin APN 12 70044031 missense probably damaging 1.00
IGL02531:Nin APN 12 70020932 missense probably benign 0.02
IGL03028:Nin APN 12 70035270 missense probably benign 0.13
IGL03155:Nin APN 12 70031770 missense probably damaging 1.00
IGL03197:Nin APN 12 70026810 missense probably benign 0.03
IGL02835:Nin UTSW 12 70056738 missense probably damaging 1.00
R0131:Nin UTSW 12 70051141 missense probably damaging 1.00
R0131:Nin UTSW 12 70051141 missense probably damaging 1.00
R0132:Nin UTSW 12 70051141 missense probably damaging 1.00
R0211:Nin UTSW 12 70014875 missense probably damaging 1.00
R0211:Nin UTSW 12 70014875 missense probably damaging 1.00
R0734:Nin UTSW 12 70030113 missense probably benign 0.01
R0947:Nin UTSW 12 70061186 missense probably damaging 1.00
R1085:Nin UTSW 12 70020962 missense possibly damaging 0.91
R1367:Nin UTSW 12 70043929 missense probably damaging 0.99
R1452:Nin UTSW 12 70017650 nonsense probably null
R1477:Nin UTSW 12 70044184 missense possibly damaging 0.87
R1518:Nin UTSW 12 70014773 missense probably benign 0.27
R1566:Nin UTSW 12 70054479 missense probably damaging 0.99
R1572:Nin UTSW 12 70038750 missense probably damaging 1.00
R1583:Nin UTSW 12 70031738 missense probably benign
R1584:Nin UTSW 12 70042669 missense probably benign 0.03
R1699:Nin UTSW 12 70030938 missense probably benign 0.40
R1699:Nin UTSW 12 70045563 missense possibly damaging 0.87
R1765:Nin UTSW 12 70042891 missense probably damaging 1.00
R1794:Nin UTSW 12 70043795 nonsense probably null
R1952:Nin UTSW 12 70030926 missense probably damaging 1.00
R2004:Nin UTSW 12 70025477 missense probably benign 0.01
R2025:Nin UTSW 12 70030008 missense probably damaging 1.00
R2060:Nin UTSW 12 70042418 missense possibly damaging 0.64
R2213:Nin UTSW 12 70045354 missense probably damaging 1.00
R2224:Nin UTSW 12 70061230 missense probably damaging 1.00
R2247:Nin UTSW 12 70054545 missense probably damaging 1.00
R2972:Nin UTSW 12 70062713 missense probably damaging 1.00
R3776:Nin UTSW 12 70038682 missense possibly damaging 0.71
R3881:Nin UTSW 12 70042541 missense probably benign 0.00
R3930:Nin UTSW 12 70078242 missense probably damaging 1.00
R3959:Nin UTSW 12 70050752 missense probably damaging 1.00
R4229:Nin UTSW 12 70051210 missense probably damaging 0.99
R4359:Nin UTSW 12 70014938 missense probably benign 0.00
R4423:Nin UTSW 12 70042978 missense probably damaging 1.00
R4461:Nin UTSW 12 70042585 missense probably benign 0.37
R4639:Nin UTSW 12 70038601 missense probably damaging 0.97
R4791:Nin UTSW 12 70043807 missense possibly damaging 0.94
R4839:Nin UTSW 12 70090551 missense possibly damaging 0.46
R4912:Nin UTSW 12 70044063 missense probably damaging 1.00
R5712:Nin UTSW 12 70042769 missense probably damaging 1.00
R5726:Nin UTSW 12 70078179 missense probably damaging 1.00
R5804:Nin UTSW 12 70045601 missense possibly damaging 0.58
R5874:Nin UTSW 12 70030918 missense possibly damaging 0.94
R5992:Nin UTSW 12 70045524 missense possibly damaging 0.83
R6077:Nin UTSW 12 70019232 missense probably damaging 1.00
R6184:Nin UTSW 12 70043737 missense probably damaging 1.00
R6307:Nin UTSW 12 70014857 missense possibly damaging 0.91
R6315:Nin UTSW 12 70045615 missense probably damaging 1.00
R6326:Nin UTSW 12 70045181 missense possibly damaging 0.95
R6492:Nin UTSW 12 70054534 missense probably benign 0.22
R6562:Nin UTSW 12 70055954 missense probably damaging 1.00
R6578:Nin UTSW 12 70061194 missense probably damaging 0.99
R6613:Nin UTSW 12 70030954 missense probably damaging 1.00
R7112:Nin UTSW 12 70102799 missense
R7170:Nin UTSW 12 70044239 missense
R7324:Nin UTSW 12 70043734 missense
R7338:Nin UTSW 12 70044064 missense
R7372:Nin UTSW 12 70056029 missense
R7431:Nin UTSW 12 70078223 missense
R7577:Nin UTSW 12 70062706 missense
R7655:Nin UTSW 12 70042768 missense
R7656:Nin UTSW 12 70042768 missense
R7683:Nin UTSW 12 70078182 missense
R7769:Nin UTSW 12 70043230 missense
R7981:Nin UTSW 12 70042817 missense
R8138:Nin UTSW 12 70042898 missense
R8141:Nin UTSW 12 70030021 missense
R8754:Nin UTSW 12 70031013 intron probably benign
R8790:Nin UTSW 12 70021019 missense
R8899:Nin UTSW 12 70030936 missense probably damaging 1.00
R8974:Nin UTSW 12 70078158 missense
R9143:Nin UTSW 12 70090575 missense
R9380:Nin UTSW 12 70028031 missense
Z1176:Nin UTSW 12 70049164 critical splice acceptor site probably null
Z1177:Nin UTSW 12 70044095 missense
Z1177:Nin UTSW 12 70054426 missense
Predicted Primers PCR Primer
(F):5'- CGTTCGGTTCAGTAGTGGCTAC -3'
(R):5'- TATCCTTTCCTGGACATGCAAC -3'

Sequencing Primer
(F):5'- CGTGatatacacacacaca -3'
(R):5'- CATGCAACAGGTGAGCCCATG -3'
Posted On 2021-12-30