Incidental Mutation 'R9086:Zfr2'
ID 690609
Institutional Source Beutler Lab
Gene Symbol Zfr2
Ensembl Gene ENSMUSG00000034949
Gene Name zinc finger RNA binding protein 2
Synonyms 9130206N08Rik, 2010013I23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock # R9086 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 81233155-81252123 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 81240195 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 212 (V212A)
Ref Sequence ENSEMBL: ENSMUSP00000113913 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117798] [ENSMUST00000144087]
AlphaFold E9Q5M4
Predicted Effect probably damaging
Transcript: ENSMUST00000117798
AA Change: V212A

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113913
Gene: ENSMUSG00000034949
AA Change: V212A

DomainStartEndE-ValueType
low complexity region 16 23 N/A INTRINSIC
low complexity region 44 62 N/A INTRINSIC
low complexity region 123 163 N/A INTRINSIC
ZnF_U1 202 236 3.58e-5 SMART
ZnF_C2H2 205 229 7.68e0 SMART
ZnF_U1 249 283 3.78e-4 SMART
ZnF_C2H2 252 276 4.12e0 SMART
ZnF_U1 397 431 3.78e-4 SMART
ZnF_C2H2 400 424 1.99e0 SMART
low complexity region 484 508 N/A INTRINSIC
DZF 585 837 2.06e-129 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144087
SMART Domains Protein: ENSMUSP00000115001
Gene: ENSMUSG00000034949

DomainStartEndE-ValueType
low complexity region 33 51 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik C T 10: 82,288,743 S2811N probably benign Het
Abca9 T C 11: 110,102,053 E1595G probably damaging Het
Ank1 T C 8: 23,099,620 V608A probably damaging Het
Arl14epl T C 18: 46,932,594 V142A possibly damaging Het
Atp8a1 T C 5: 67,774,816 D210G Het
Baz1b T C 5: 135,231,684 F1112L probably damaging Het
Cage1 T A 13: 38,022,922 I316F probably damaging Het
Car2 A C 3: 14,887,908 T37P probably benign Het
Catsper2 TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT 2: 121,397,572 probably benign Het
Cntnap3 T A 13: 64,781,759 D542V probably damaging Het
Coro1b T C 19: 4,152,526 Y338H probably damaging Het
Ctdspl2 G A 2: 122,007,817 probably null Het
Cyp2a12 T C 7: 27,036,519 F451S probably damaging Het
Dpm2 T C 2: 32,572,379 L59P probably damaging Het
Duoxa2 A G 2: 122,301,340 Y170C probably damaging Het
Dus2 T A 8: 106,015,941 Y34* probably null Het
Dzip3 A G 16: 48,961,130 I266T possibly damaging Het
Ebf3 T C 7: 137,199,265 T455A possibly damaging Het
Echdc2 C T 4: 108,169,879 Q74* probably null Het
Efhc1 T C 1: 20,955,368 Y33H probably damaging Het
Fam20a A T 11: 109,675,928 C378* probably null Het
Fbxo25 C A 8: 13,939,621 P356Q probably damaging Het
Fig4 G T 10: 41,285,403 T59K possibly damaging Het
Gbp10 T A 5: 105,218,503 M512L probably benign Het
Gdf10 T A 14: 33,932,264 Y243N probably damaging Het
Golga5 T A 12: 102,492,217 S640T probably benign Het
Hils1 A T 11: 94,968,257 K126M possibly damaging Het
Ints1 A T 5: 139,758,192 H1540Q probably benign Het
Lipo3 A T 19: 33,557,129 L310Q probably benign Het
Lrrk2 A G 15: 91,755,848 K1532R probably benign Het
Ltc4s T C 11: 50,237,247 Y59C probably damaging Het
Macf1 T A 4: 123,484,151 H1427L probably damaging Het
Mroh2b A G 15: 4,953,272 probably null Het
Mthfd1l A T 10: 3,973,412 D53V probably benign Het
Muc4 C A 16: 32,757,468 P303Q Het
Nrxn1 A G 17: 90,162,364 F1293S probably damaging Het
Nrxn2 G A 19: 6,490,078 E803K probably damaging Het
Nup155 A G 15: 8,148,346 D1071G possibly damaging Het
Olfr319 T A 11: 58,702,129 S143T possibly damaging Het
Olfr364-ps1 T A 2: 37,146,414 D67E probably damaging Het
Olfr700 A T 7: 106,805,919 I181N probably benign Het
Papln A G 12: 83,774,859 E287G probably damaging Het
Pex13 C A 11: 23,665,760 G29C probably damaging Het
Phrf1 C A 7: 141,259,499 T869K unknown Het
Pitrm1 A G 13: 6,577,481 T912A probably benign Het
Pla2g4c A G 7: 13,337,767 K171E probably benign Het
Pnpla7 A T 2: 25,039,697 T833S probably damaging Het
Por G T 5: 135,716,064 probably null Het
Rab3ip G A 10: 116,939,405 S16L probably damaging Het
Rabgef1 A T 5: 130,211,951 I304F probably benign Het
Rbbp8 T C 18: 11,742,679 V883A possibly damaging Het
Rnase4 A G 14: 51,104,972 D51G possibly damaging Het
Rnf13 A C 3: 57,833,576 D291A probably benign Het
Rps6kb2 A T 19: 4,159,271 I191N probably damaging Het
Scn1a A G 2: 66,351,014 L55S probably benign Het
Son T A 16: 91,670,530 F2260I unknown Het
Ssr1 A G 13: 37,983,473 I238T probably benign Het
Stk11ip A G 1: 75,530,174 E633G possibly damaging Het
Svs3a A G 2: 164,290,142 Y211C probably benign Het
Sytl1 T A 4: 133,260,864 E60D possibly damaging Het
Tlr1 T C 5: 64,925,855 I460V probably damaging Het
Tmem136 C T 9: 43,111,369 R230Q probably benign Het
Tmem64 T C 4: 15,266,718 I256T probably damaging Het
Ttll5 G A 12: 85,917,742 A553T possibly damaging Het
Ttll5 A T 12: 86,024,333 T1327S probably benign Het
Upp2 T A 2: 58,790,165 C334* probably null Het
Wdr74 C A 19: 8,735,994 N24K possibly damaging Het
Zbtb42 G A 12: 112,679,414 V8I probably benign Het
Zfp541 T A 7: 16,090,404 L1078Q probably damaging Het
Other mutations in Zfr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Zfr2 APN 10 81242085 missense probably damaging 0.96
IGL01622:Zfr2 APN 10 81251359 missense probably benign
IGL01623:Zfr2 APN 10 81251359 missense probably benign
IGL02719:Zfr2 APN 10 81244712 missense probably damaging 1.00
IGL03036:Zfr2 APN 10 81242151 missense probably benign 0.01
R0302:Zfr2 UTSW 10 81251336 unclassified probably benign
R0837:Zfr2 UTSW 10 81245408 missense probably damaging 1.00
R1557:Zfr2 UTSW 10 81247391 missense probably benign 0.01
R1714:Zfr2 UTSW 10 81244749 missense probably damaging 1.00
R1737:Zfr2 UTSW 10 81242085 missense probably damaging 0.96
R1991:Zfr2 UTSW 10 81242852 missense possibly damaging 0.86
R2134:Zfr2 UTSW 10 81242901 missense probably damaging 1.00
R2148:Zfr2 UTSW 10 81242116 missense probably benign 0.13
R2150:Zfr2 UTSW 10 81242116 missense probably benign 0.13
R3703:Zfr2 UTSW 10 81246079 missense probably benign 0.40
R3704:Zfr2 UTSW 10 81246079 missense probably benign 0.40
R3705:Zfr2 UTSW 10 81246079 missense probably benign 0.40
R3715:Zfr2 UTSW 10 81246079 missense probably benign 0.40
R4301:Zfr2 UTSW 10 81242184 unclassified probably benign
R4654:Zfr2 UTSW 10 81251249 splice site probably null
R4811:Zfr2 UTSW 10 81243713 missense probably benign 0.07
R5290:Zfr2 UTSW 10 81246710 frame shift probably null
R5781:Zfr2 UTSW 10 81243713 missense probably benign 0.07
R7114:Zfr2 UTSW 10 81244725 missense probably damaging 1.00
R8192:Zfr2 UTSW 10 81242815 missense possibly damaging 0.83
R8359:Zfr2 UTSW 10 81242819 missense possibly damaging 0.57
R8389:Zfr2 UTSW 10 81245489 missense probably benign
R8827:Zfr2 UTSW 10 81242785 missense probably benign 0.00
R8953:Zfr2 UTSW 10 81248437 missense probably damaging 0.99
R9189:Zfr2 UTSW 10 81244662 missense probably damaging 1.00
R9487:Zfr2 UTSW 10 81240135 missense probably benign 0.33
R9592:Zfr2 UTSW 10 81233746 missense unknown
R9645:Zfr2 UTSW 10 81248418 nonsense probably null
X0063:Zfr2 UTSW 10 81242957 critical splice donor site probably null
Z1177:Zfr2 UTSW 10 81246084 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTCTCCCTCCTAGGACCAAG -3'
(R):5'- CATGGGCCTGGGAAACAAAC -3'

Sequencing Primer
(F):5'- CCTGACTCGGACTCAGTGTC -3'
(R):5'- AAACCAGGGTCCCGTAGC -3'
Posted On 2021-12-30