Mutagenetix > Incidental Mutation

Incidental Mutation 'R9086:Cntnap3'

690626

Institutional Source

Beutler Lab

Gene Symbol

Cntnap3

Ensembl Gene

ENSMUSG00000033063

Gene Name

contactin associated protein-like 3

Synonyms

MMRRC Submission

068905-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.076) question?

Stock #

R9086 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

64736182-64903955 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 64781759 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 542 (D542V)

Ref Sequence

ENSEMBL: ENSMUSP00000089140 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091554]

AlphaFold

E9PY62

Predicted Effect

probably damaging
Transcript: ENSMUST00000091554
AA Change: D542V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000089140
Gene: ENSMUSG00000033063
AA Change: D542V

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
FA58C	33	180	4.88e-17	SMART
LamG	207	345	1.47e-11	SMART
LamG	394	525	1.43e-23	SMART
EGF	553	587	1.33e-1	SMART
FBG	590	775	6.76e-1	SMART
LamG	815	942	1.89e-32	SMART
EGF_like	963	999	6.28e1	SMART
LamG	1040	1178	9.46e-15	SMART
transmembrane domain	1245	1267	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NCP family of cell-recognition molecules. This family represents a distinct subgroup of the neurexins. NCP proteins mediate neuron-glial interactions in vertebrates and glial-glial contact in invertebrates. The protein encoded by this gene may play a role in cell recognition within the nervous system. Alternatively spliced transcript variants encoding different isoforms have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932415D10Rik	C	T	10: 82,288,743	S2811N	probably benign	Het
Abca9	T	C	11: 110,102,053	E1595G	probably damaging	Het
Ank1	T	C	8: 23,099,620	V608A	probably damaging	Het
Arl14epl	T	C	18: 46,932,594	V142A	possibly damaging	Het
Atp8a1	T	C	5: 67,774,816	D210G		Het
Baz1b	T	C	5: 135,231,684	F1112L	probably damaging	Het
Cage1	T	A	13: 38,022,922	I316F	probably damaging	Het
Car2	A	C	3: 14,887,908	T37P	probably benign	Het
Catsper2	TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT	TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT	2: 121,397,572		probably benign	Het
Coro1b	T	C	19: 4,152,526	Y338H	probably damaging	Het
Ctdspl2	G	A	2: 122,007,817		probably null	Het
Cyp2a12	T	C	7: 27,036,519	F451S	probably damaging	Het
Dpm2	T	C	2: 32,572,379	L59P	probably damaging	Het
Duoxa2	A	G	2: 122,301,340	Y170C	probably damaging	Het
Dus2	T	A	8: 106,015,941	Y34*	probably null	Het
Dzip3	A	G	16: 48,961,130	I266T	possibly damaging	Het
Ebf3	T	C	7: 137,199,265	T455A	possibly damaging	Het
Echdc2	C	T	4: 108,169,879	Q74*	probably null	Het
Efhc1	T	C	1: 20,955,368	Y33H	probably damaging	Het
Fam20a	A	T	11: 109,675,928	C378*	probably null	Het
Fbxo25	C	A	8: 13,939,621	P356Q	probably damaging	Het
Fig4	G	T	10: 41,285,403	T59K	possibly damaging	Het
Gbp10	T	A	5: 105,218,503	M512L	probably benign	Het
Gdf10	T	A	14: 33,932,264	Y243N	probably damaging	Het
Golga5	T	A	12: 102,492,217	S640T	probably benign	Het
Hils1	A	T	11: 94,968,257	K126M	possibly damaging	Het
Ints1	A	T	5: 139,758,192	H1540Q	probably benign	Het
Lipo3	A	T	19: 33,557,129	L310Q	probably benign	Het
Lrrk2	A	G	15: 91,755,848	K1532R	probably benign	Het
Ltc4s	T	C	11: 50,237,247	Y59C	probably damaging	Het
Macf1	T	A	4: 123,484,151	H1427L	probably damaging	Het
Mroh2b	A	G	15: 4,953,272		probably null	Het
Mthfd1l	A	T	10: 3,973,412	D53V	probably benign	Het
Muc4	C	A	16: 32,757,468	P303Q		Het
Nrxn1	A	G	17: 90,162,364	F1293S	probably damaging	Het
Nrxn2	G	A	19: 6,490,078	E803K	probably damaging	Het
Nup155	A	G	15: 8,148,346	D1071G	possibly damaging	Het
Olfr319	T	A	11: 58,702,129	S143T	possibly damaging	Het
Olfr364-ps1	T	A	2: 37,146,414	D67E	probably damaging	Het
Olfr700	A	T	7: 106,805,919	I181N	probably benign	Het
Papln	A	G	12: 83,774,859	E287G	probably damaging	Het
Pex13	C	A	11: 23,665,760	G29C	probably damaging	Het
Phrf1	C	A	7: 141,259,499	T869K	unknown	Het
Pitrm1	A	G	13: 6,577,481	T912A	probably benign	Het
Pla2g4c	A	G	7: 13,337,767	K171E	probably benign	Het
Pnpla7	A	T	2: 25,039,697	T833S	probably damaging	Het
Por	G	T	5: 135,716,064		probably null	Het
Rab3ip	G	A	10: 116,939,405	S16L	probably damaging	Het
Rabgef1	A	T	5: 130,211,951	I304F	probably benign	Het
Rbbp8	T	C	18: 11,742,679	V883A	possibly damaging	Het
Rnase4	A	G	14: 51,104,972	D51G	possibly damaging	Het
Rnf13	A	C	3: 57,833,576	D291A	probably benign	Het
Rps6kb2	A	T	19: 4,159,271	I191N	probably damaging	Het
Scn1a	A	G	2: 66,351,014	L55S	probably benign	Het
Son	T	A	16: 91,670,530	F2260I	unknown	Het
Ssr1	A	G	13: 37,983,473	I238T	probably benign	Het
Stk11ip	A	G	1: 75,530,174	E633G	possibly damaging	Het
Svs3a	A	G	2: 164,290,142	Y211C	probably benign	Het
Sytl1	T	A	4: 133,260,864	E60D	possibly damaging	Het
Tlr1	T	C	5: 64,925,855	I460V	probably damaging	Het
Tmem136	C	T	9: 43,111,369	R230Q	probably benign	Het
Tmem64	T	C	4: 15,266,718	I256T	probably damaging	Het
Ttll5	G	A	12: 85,917,742	A553T	possibly damaging	Het
Ttll5	A	T	12: 86,024,333	T1327S	probably benign	Het
Upp2	T	A	2: 58,790,165	C334*	probably null	Het
Wdr74	C	A	19: 8,735,994	N24K	possibly damaging	Het
Zbtb42	G	A	12: 112,679,414	V8I	probably benign	Het
Zfp541	T	A	7: 16,090,404	L1078Q	probably damaging	Het
Zfr2	T	C	10: 81,240,195	V212A	probably damaging	Het

Other mutations in Cntnap3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00433:Cntnap3	APN	13	64772731	missense	probably damaging	1.00
IGL00782:Cntnap3	APN	13	64745805	splice site	probably benign
IGL00976:Cntnap3	APN	13	64794352	missense	probably damaging	1.00
IGL01319:Cntnap3	APN	13	64787837	missense	probably damaging	1.00
IGL01610:Cntnap3	APN	13	64757301	missense	probably damaging	0.98
IGL01861:Cntnap3	APN	13	64799108	missense	probably damaging	1.00
IGL02127:Cntnap3	APN	13	64799064	splice site	probably benign
IGL02133:Cntnap3	APN	13	64751673	splice site	probably benign
IGL02251:Cntnap3	APN	13	64762036	missense	probably damaging	1.00
IGL02272:Cntnap3	APN	13	64757411	missense	probably damaging	1.00
IGL02370:Cntnap3	APN	13	64751751	missense	probably benign
IGL02456:Cntnap3	APN	13	64799058	splice site	probably benign
IGL02589:Cntnap3	APN	13	64792430	missense	probably benign	0.08
IGL02695:Cntnap3	APN	13	64772132	missense	probably benign	0.01
IGL02850:Cntnap3	APN	13	64757409	missense	probably damaging	1.00
IGL03038:Cntnap3	APN	13	64741025	missense	possibly damaging	0.50
IGL03188:Cntnap3	APN	13	64781745	missense	probably damaging	0.97
IGL03327:Cntnap3	APN	13	64887768	nonsense	probably null
PIT4480001:Cntnap3	UTSW	13	64757210	missense	probably damaging	1.00
R0309:Cntnap3	UTSW	13	64757436	splice site	probably benign
R0422:Cntnap3	UTSW	13	64757285	missense	probably damaging	0.96
R0463:Cntnap3	UTSW	13	64778876	missense	probably damaging	1.00
R0491:Cntnap3	UTSW	13	64762045	missense	probably benign	0.01
R0499:Cntnap3	UTSW	13	64858678	missense	probably benign	0.33
R0550:Cntnap3	UTSW	13	64762000	missense	possibly damaging	0.86
R0613:Cntnap3	UTSW	13	64758414	missense	probably damaging	1.00
R0666:Cntnap3	UTSW	13	64757397	missense	probably damaging	1.00
R0840:Cntnap3	UTSW	13	64787910	missense	possibly damaging	0.94
R1577:Cntnap3	UTSW	13	64758290	missense	probably damaging	1.00
R1716:Cntnap3	UTSW	13	64762002	missense	probably damaging	1.00
R1732:Cntnap3	UTSW	13	64740812	critical splice donor site	probably null
R1739:Cntnap3	UTSW	13	64740592	missense	probably benign	0.17
R1905:Cntnap3	UTSW	13	64903764	missense	probably benign	0.04
R1988:Cntnap3	UTSW	13	64758390	missense	probably damaging	1.00
R2086:Cntnap3	UTSW	13	64794262	missense	possibly damaging	0.76
R3732:Cntnap3	UTSW	13	64740999	missense	possibly damaging	0.73
R3808:Cntnap3	UTSW	13	64781804	missense	probably damaging	0.96
R3809:Cntnap3	UTSW	13	64781804	missense	probably damaging	0.96
R4384:Cntnap3	UTSW	13	64748460	missense	probably damaging	1.00
R4433:Cntnap3	UTSW	13	64778853	missense	possibly damaging	0.92
R4631:Cntnap3	UTSW	13	64778883	missense	probably benign	0.04
R4645:Cntnap3	UTSW	13	64778788	critical splice donor site	probably null
R4702:Cntnap3	UTSW	13	64778862	missense	probably benign	0.17
R4876:Cntnap3	UTSW	13	64787706	missense	probably benign	0.00
R4994:Cntnap3	UTSW	13	64761984	missense	possibly damaging	0.55
R5043:Cntnap3	UTSW	13	64794348	missense	probably damaging	1.00
R5214:Cntnap3	UTSW	13	64762010	missense	probably damaging	1.00
R5403:Cntnap3	UTSW	13	64761978	missense	possibly damaging	0.90
R5571:Cntnap3	UTSW	13	64903758	missense	probably damaging	0.98
R5587:Cntnap3	UTSW	13	64746738	missense	probably damaging	1.00
R5695:Cntnap3	UTSW	13	64787955	missense	probably damaging	0.99
R5834:Cntnap3	UTSW	13	64748577	missense	probably benign	0.07
R5892:Cntnap3	UTSW	13	64799180	missense	probably damaging	1.00
R5950:Cntnap3	UTSW	13	64787769	missense	probably damaging	1.00
R6526:Cntnap3	UTSW	13	64781888	missense	possibly damaging	0.96
R6954:Cntnap3	UTSW	13	64748559	missense	probably benign	0.00
R7138:Cntnap3	UTSW	13	64781725	critical splice donor site	probably null
R7355:Cntnap3	UTSW	13	64771962	missense	probably benign
R7425:Cntnap3	UTSW	13	64758252	missense	probably damaging	1.00
R7521:Cntnap3	UTSW	13	64772001	missense	probably benign	0.22
R7719:Cntnap3	UTSW	13	64772777	nonsense	probably null
R7810:Cntnap3	UTSW	13	64793308	missense	possibly damaging	0.73
R7871:Cntnap3	UTSW	13	64903773	missense	probably benign	0.00
R8259:Cntnap3	UTSW	13	64787867	missense	probably damaging	0.99
R8415:Cntnap3	UTSW	13	64738665	missense	probably benign	0.31
R8491:Cntnap3	UTSW	13	64785343	missense	probably damaging	1.00
R9087:Cntnap3	UTSW	13	64751718	missense	probably damaging	0.96
R9398:Cntnap3	UTSW	13	64903834	missense	probably benign	0.41
R9475:Cntnap3	UTSW	13	64799135	missense	probably damaging	1.00
R9625:Cntnap3	UTSW	13	64858765	missense	probably damaging	1.00
R9679:Cntnap3	UTSW	13	64751748	missense	probably damaging	1.00
Z1176:Cntnap3	UTSW	13	64740872	frame shift	probably null
Z1176:Cntnap3	UTSW	13	64792388	missense	probably damaging	0.98
Z1177:Cntnap3	UTSW	13	64781892	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ACACAAGTGCATCTGTGTCAG -3'
(R):5'- TGCAGTGGTCCCTGATCTTC -3'

Sequencing Primer
(F):5'- TGGTAACAGCTGAGCCATC -3'
(R):5'- CTCCTATCCTTGTGCTTGCAATCAG -3'

Posted On

2021-12-30