Incidental Mutation 'R9086:Cntnap3'
ID 690626
Institutional Source Beutler Lab
Gene Symbol Cntnap3
Ensembl Gene ENSMUSG00000033063
Gene Name contactin associated protein-like 3
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock # R9086 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 64736182-64903955 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 64781759 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 542 (D542V)
Ref Sequence ENSEMBL: ENSMUSP00000089140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091554]
AlphaFold E9PY62
Predicted Effect probably damaging
Transcript: ENSMUST00000091554
AA Change: D542V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089140
Gene: ENSMUSG00000033063
AA Change: D542V

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
FA58C 33 180 4.88e-17 SMART
LamG 207 345 1.47e-11 SMART
LamG 394 525 1.43e-23 SMART
EGF 553 587 1.33e-1 SMART
FBG 590 775 6.76e-1 SMART
LamG 815 942 1.89e-32 SMART
EGF_like 963 999 6.28e1 SMART
LamG 1040 1178 9.46e-15 SMART
transmembrane domain 1245 1267 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NCP family of cell-recognition molecules. This family represents a distinct subgroup of the neurexins. NCP proteins mediate neuron-glial interactions in vertebrates and glial-glial contact in invertebrates. The protein encoded by this gene may play a role in cell recognition within the nervous system. Alternatively spliced transcript variants encoding different isoforms have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik C T 10: 82,288,743 S2811N probably benign Het
Abca9 T C 11: 110,102,053 E1595G probably damaging Het
Ank1 T C 8: 23,099,620 V608A probably damaging Het
Arl14epl T C 18: 46,932,594 V142A possibly damaging Het
Atp8a1 T C 5: 67,774,816 D210G Het
Baz1b T C 5: 135,231,684 F1112L probably damaging Het
Cage1 T A 13: 38,022,922 I316F probably damaging Het
Car2 A C 3: 14,887,908 T37P probably benign Het
Catsper2 TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT 2: 121,397,572 probably benign Het
Coro1b T C 19: 4,152,526 Y338H probably damaging Het
Ctdspl2 G A 2: 122,007,817 probably null Het
Cyp2a12 T C 7: 27,036,519 F451S probably damaging Het
Dpm2 T C 2: 32,572,379 L59P probably damaging Het
Duoxa2 A G 2: 122,301,340 Y170C probably damaging Het
Dus2 T A 8: 106,015,941 Y34* probably null Het
Dzip3 A G 16: 48,961,130 I266T possibly damaging Het
Ebf3 T C 7: 137,199,265 T455A possibly damaging Het
Echdc2 C T 4: 108,169,879 Q74* probably null Het
Efhc1 T C 1: 20,955,368 Y33H probably damaging Het
Fam20a A T 11: 109,675,928 C378* probably null Het
Fbxo25 C A 8: 13,939,621 P356Q probably damaging Het
Fig4 G T 10: 41,285,403 T59K possibly damaging Het
Gbp10 T A 5: 105,218,503 M512L probably benign Het
Gdf10 T A 14: 33,932,264 Y243N probably damaging Het
Golga5 T A 12: 102,492,217 S640T probably benign Het
Hils1 A T 11: 94,968,257 K126M possibly damaging Het
Ints1 A T 5: 139,758,192 H1540Q probably benign Het
Lipo3 A T 19: 33,557,129 L310Q probably benign Het
Lrrk2 A G 15: 91,755,848 K1532R probably benign Het
Ltc4s T C 11: 50,237,247 Y59C probably damaging Het
Macf1 T A 4: 123,484,151 H1427L probably damaging Het
Mroh2b A G 15: 4,953,272 probably null Het
Mthfd1l A T 10: 3,973,412 D53V probably benign Het
Muc4 C A 16: 32,757,468 P303Q Het
Nrxn1 A G 17: 90,162,364 F1293S probably damaging Het
Nrxn2 G A 19: 6,490,078 E803K probably damaging Het
Nup155 A G 15: 8,148,346 D1071G possibly damaging Het
Olfr319 T A 11: 58,702,129 S143T possibly damaging Het
Olfr364-ps1 T A 2: 37,146,414 D67E probably damaging Het
Olfr700 A T 7: 106,805,919 I181N probably benign Het
Papln A G 12: 83,774,859 E287G probably damaging Het
Pex13 C A 11: 23,665,760 G29C probably damaging Het
Phrf1 C A 7: 141,259,499 T869K unknown Het
Pitrm1 A G 13: 6,577,481 T912A probably benign Het
Pla2g4c A G 7: 13,337,767 K171E probably benign Het
Pnpla7 A T 2: 25,039,697 T833S probably damaging Het
Por G T 5: 135,716,064 probably null Het
Rab3ip G A 10: 116,939,405 S16L probably damaging Het
Rabgef1 A T 5: 130,211,951 I304F probably benign Het
Rbbp8 T C 18: 11,742,679 V883A possibly damaging Het
Rnase4 A G 14: 51,104,972 D51G possibly damaging Het
Rnf13 A C 3: 57,833,576 D291A probably benign Het
Rps6kb2 A T 19: 4,159,271 I191N probably damaging Het
Scn1a A G 2: 66,351,014 L55S probably benign Het
Son T A 16: 91,670,530 F2260I unknown Het
Ssr1 A G 13: 37,983,473 I238T probably benign Het
Stk11ip A G 1: 75,530,174 E633G possibly damaging Het
Svs3a A G 2: 164,290,142 Y211C probably benign Het
Sytl1 T A 4: 133,260,864 E60D possibly damaging Het
Tlr1 T C 5: 64,925,855 I460V probably damaging Het
Tmem136 C T 9: 43,111,369 R230Q probably benign Het
Tmem64 T C 4: 15,266,718 I256T probably damaging Het
Ttll5 G A 12: 85,917,742 A553T possibly damaging Het
Ttll5 A T 12: 86,024,333 T1327S probably benign Het
Upp2 T A 2: 58,790,165 C334* probably null Het
Wdr74 C A 19: 8,735,994 N24K possibly damaging Het
Zbtb42 G A 12: 112,679,414 V8I probably benign Het
Zfp541 T A 7: 16,090,404 L1078Q probably damaging Het
Zfr2 T C 10: 81,240,195 V212A probably damaging Het
Other mutations in Cntnap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Cntnap3 APN 13 64772731 missense probably damaging 1.00
IGL00782:Cntnap3 APN 13 64745805 splice site probably benign
IGL00976:Cntnap3 APN 13 64794352 missense probably damaging 1.00
IGL01319:Cntnap3 APN 13 64787837 missense probably damaging 1.00
IGL01610:Cntnap3 APN 13 64757301 missense probably damaging 0.98
IGL01861:Cntnap3 APN 13 64799108 missense probably damaging 1.00
IGL02127:Cntnap3 APN 13 64799064 splice site probably benign
IGL02133:Cntnap3 APN 13 64751673 splice site probably benign
IGL02251:Cntnap3 APN 13 64762036 missense probably damaging 1.00
IGL02272:Cntnap3 APN 13 64757411 missense probably damaging 1.00
IGL02370:Cntnap3 APN 13 64751751 missense probably benign
IGL02456:Cntnap3 APN 13 64799058 splice site probably benign
IGL02589:Cntnap3 APN 13 64792430 missense probably benign 0.08
IGL02695:Cntnap3 APN 13 64772132 missense probably benign 0.01
IGL02850:Cntnap3 APN 13 64757409 missense probably damaging 1.00
IGL03038:Cntnap3 APN 13 64741025 missense possibly damaging 0.50
IGL03188:Cntnap3 APN 13 64781745 missense probably damaging 0.97
IGL03327:Cntnap3 APN 13 64887768 nonsense probably null
PIT4480001:Cntnap3 UTSW 13 64757210 missense probably damaging 1.00
R0309:Cntnap3 UTSW 13 64757436 splice site probably benign
R0422:Cntnap3 UTSW 13 64757285 missense probably damaging 0.96
R0463:Cntnap3 UTSW 13 64778876 missense probably damaging 1.00
R0491:Cntnap3 UTSW 13 64762045 missense probably benign 0.01
R0499:Cntnap3 UTSW 13 64858678 missense probably benign 0.33
R0550:Cntnap3 UTSW 13 64762000 missense possibly damaging 0.86
R0613:Cntnap3 UTSW 13 64758414 missense probably damaging 1.00
R0666:Cntnap3 UTSW 13 64757397 missense probably damaging 1.00
R0840:Cntnap3 UTSW 13 64787910 missense possibly damaging 0.94
R1577:Cntnap3 UTSW 13 64758290 missense probably damaging 1.00
R1716:Cntnap3 UTSW 13 64762002 missense probably damaging 1.00
R1732:Cntnap3 UTSW 13 64740812 critical splice donor site probably null
R1739:Cntnap3 UTSW 13 64740592 missense probably benign 0.17
R1905:Cntnap3 UTSW 13 64903764 missense probably benign 0.04
R1988:Cntnap3 UTSW 13 64758390 missense probably damaging 1.00
R2086:Cntnap3 UTSW 13 64794262 missense possibly damaging 0.76
R3732:Cntnap3 UTSW 13 64740999 missense possibly damaging 0.73
R3808:Cntnap3 UTSW 13 64781804 missense probably damaging 0.96
R3809:Cntnap3 UTSW 13 64781804 missense probably damaging 0.96
R4384:Cntnap3 UTSW 13 64748460 missense probably damaging 1.00
R4433:Cntnap3 UTSW 13 64778853 missense possibly damaging 0.92
R4631:Cntnap3 UTSW 13 64778883 missense probably benign 0.04
R4645:Cntnap3 UTSW 13 64778788 critical splice donor site probably null
R4702:Cntnap3 UTSW 13 64778862 missense probably benign 0.17
R4876:Cntnap3 UTSW 13 64787706 missense probably benign 0.00
R4994:Cntnap3 UTSW 13 64761984 missense possibly damaging 0.55
R5043:Cntnap3 UTSW 13 64794348 missense probably damaging 1.00
R5214:Cntnap3 UTSW 13 64762010 missense probably damaging 1.00
R5403:Cntnap3 UTSW 13 64761978 missense possibly damaging 0.90
R5571:Cntnap3 UTSW 13 64903758 missense probably damaging 0.98
R5587:Cntnap3 UTSW 13 64746738 missense probably damaging 1.00
R5695:Cntnap3 UTSW 13 64787955 missense probably damaging 0.99
R5834:Cntnap3 UTSW 13 64748577 missense probably benign 0.07
R5892:Cntnap3 UTSW 13 64799180 missense probably damaging 1.00
R5950:Cntnap3 UTSW 13 64787769 missense probably damaging 1.00
R6526:Cntnap3 UTSW 13 64781888 missense possibly damaging 0.96
R6954:Cntnap3 UTSW 13 64748559 missense probably benign 0.00
R7138:Cntnap3 UTSW 13 64781725 critical splice donor site probably null
R7355:Cntnap3 UTSW 13 64771962 missense probably benign
R7425:Cntnap3 UTSW 13 64758252 missense probably damaging 1.00
R7521:Cntnap3 UTSW 13 64772001 missense probably benign 0.22
R7719:Cntnap3 UTSW 13 64772777 nonsense probably null
R7810:Cntnap3 UTSW 13 64793308 missense possibly damaging 0.73
R7871:Cntnap3 UTSW 13 64903773 missense probably benign 0.00
R8259:Cntnap3 UTSW 13 64787867 missense probably damaging 0.99
R8415:Cntnap3 UTSW 13 64738665 missense probably benign 0.31
R8491:Cntnap3 UTSW 13 64785343 missense probably damaging 1.00
R9087:Cntnap3 UTSW 13 64751718 missense probably damaging 0.96
R9398:Cntnap3 UTSW 13 64903834 missense probably benign 0.41
R9475:Cntnap3 UTSW 13 64799135 missense probably damaging 1.00
Z1176:Cntnap3 UTSW 13 64740872 frame shift probably null
Z1176:Cntnap3 UTSW 13 64792388 missense probably damaging 0.98
Z1177:Cntnap3 UTSW 13 64781892 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACACAAGTGCATCTGTGTCAG -3'
(R):5'- TGCAGTGGTCCCTGATCTTC -3'

Sequencing Primer
(F):5'- TGGTAACAGCTGAGCCATC -3'
(R):5'- CTCCTATCCTTGTGCTTGCAATCAG -3'
Posted On 2021-12-30