Incidental Mutation 'R9086:Cntnap3'
ID 690626
Institutional Source Beutler Lab
Gene Symbol Cntnap3
Ensembl Gene ENSMUSG00000033063
Gene Name contactin associated protein-like 3
Synonyms
MMRRC Submission 068905-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.056) question?
Stock # R9086 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 64883996-65051769 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 64929573 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 542 (D542V)
Ref Sequence ENSEMBL: ENSMUSP00000089140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091554]
AlphaFold E9PY62
Predicted Effect probably damaging
Transcript: ENSMUST00000091554
AA Change: D542V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089140
Gene: ENSMUSG00000033063
AA Change: D542V

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
FA58C 33 180 4.88e-17 SMART
LamG 207 345 1.47e-11 SMART
LamG 394 525 1.43e-23 SMART
EGF 553 587 1.33e-1 SMART
FBG 590 775 6.76e-1 SMART
LamG 815 942 1.89e-32 SMART
EGF_like 963 999 6.28e1 SMART
LamG 1040 1178 9.46e-15 SMART
transmembrane domain 1245 1267 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NCP family of cell-recognition molecules. This family represents a distinct subgroup of the neurexins. NCP proteins mediate neuron-glial interactions in vertebrates and glial-glial contact in invertebrates. The protein encoded by this gene may play a role in cell recognition within the nervous system. Alternatively spliced transcript variants encoding different isoforms have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 109,992,879 (GRCm39) E1595G probably damaging Het
Ank1 T C 8: 23,589,636 (GRCm39) V608A probably damaging Het
Arl14epl T C 18: 47,065,661 (GRCm39) V142A possibly damaging Het
Atp8a1 T C 5: 67,932,159 (GRCm39) D210G Het
Baz1b T C 5: 135,260,538 (GRCm39) F1112L probably damaging Het
Cage1 T A 13: 38,206,898 (GRCm39) I316F probably damaging Het
Car2 A C 3: 14,952,968 (GRCm39) T37P probably benign Het
Catsper2 TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT 2: 121,228,053 (GRCm39) probably benign Het
Coro1b T C 19: 4,202,525 (GRCm39) Y338H probably damaging Het
Ctdspl2 G A 2: 121,838,298 (GRCm39) probably null Het
Cyp2a12 T C 7: 26,735,944 (GRCm39) F451S probably damaging Het
Dpm2 T C 2: 32,462,391 (GRCm39) L59P probably damaging Het
Duoxa2 A G 2: 122,131,821 (GRCm39) Y170C probably damaging Het
Dus2 T A 8: 106,742,573 (GRCm39) Y34* probably null Het
Dzip3 A G 16: 48,781,493 (GRCm39) I266T possibly damaging Het
Ebf3 T C 7: 136,800,994 (GRCm39) T455A possibly damaging Het
Echdc2 C T 4: 108,027,076 (GRCm39) Q74* probably null Het
Efhc1 T C 1: 21,025,592 (GRCm39) Y33H probably damaging Het
Fam20a A T 11: 109,566,754 (GRCm39) C378* probably null Het
Fbxo25 C A 8: 13,989,621 (GRCm39) P356Q probably damaging Het
Fig4 G T 10: 41,161,399 (GRCm39) T59K possibly damaging Het
Gbp10 T A 5: 105,366,369 (GRCm39) M512L probably benign Het
Gdf10 T A 14: 33,654,221 (GRCm39) Y243N probably damaging Het
Golga5 T A 12: 102,458,476 (GRCm39) S640T probably benign Het
H1f9 A T 11: 94,859,083 (GRCm39) K126M possibly damaging Het
Ints1 A T 5: 139,743,947 (GRCm39) H1540Q probably benign Het
Lipo3 A T 19: 33,534,529 (GRCm39) L310Q probably benign Het
Lrrk2 A G 15: 91,640,051 (GRCm39) K1532R probably benign Het
Ltc4s T C 11: 50,128,074 (GRCm39) Y59C probably damaging Het
Macf1 T A 4: 123,377,944 (GRCm39) H1427L probably damaging Het
Mroh2b A G 15: 4,982,754 (GRCm39) probably null Het
Mthfd1l A T 10: 3,923,412 (GRCm39) D53V probably benign Het
Muc4 C A 16: 32,577,842 (GRCm39) P303Q Het
Nrxn1 A G 17: 90,469,792 (GRCm39) F1293S probably damaging Het
Nrxn2 G A 19: 6,540,108 (GRCm39) E803K probably damaging Het
Nup155 A G 15: 8,177,830 (GRCm39) D1071G possibly damaging Het
Or1l4b T A 2: 37,036,426 (GRCm39) D67E probably damaging Het
Or2ag18 A T 7: 106,405,126 (GRCm39) I181N probably benign Het
Or2ak6 T A 11: 58,592,955 (GRCm39) S143T possibly damaging Het
Papln A G 12: 83,821,633 (GRCm39) E287G probably damaging Het
Pex13 C A 11: 23,615,760 (GRCm39) G29C probably damaging Het
Phrf1 C A 7: 140,839,412 (GRCm39) T869K unknown Het
Pitrm1 A G 13: 6,627,517 (GRCm39) T912A probably benign Het
Pla2g4c A G 7: 13,071,692 (GRCm39) K171E probably benign Het
Pnpla7 A T 2: 24,929,709 (GRCm39) T833S probably damaging Het
Por G T 5: 135,744,918 (GRCm39) probably null Het
Rab3ip G A 10: 116,775,310 (GRCm39) S16L probably damaging Het
Rabgef1 A T 5: 130,240,792 (GRCm39) I304F probably benign Het
Rbbp8 T C 18: 11,875,736 (GRCm39) V883A possibly damaging Het
Rnase4 A G 14: 51,342,429 (GRCm39) D51G possibly damaging Het
Rnf13 A C 3: 57,740,997 (GRCm39) D291A probably benign Het
Rps6kb2 A T 19: 4,209,270 (GRCm39) I191N probably damaging Het
Scn1a A G 2: 66,181,358 (GRCm39) L55S probably benign Het
Son T A 16: 91,467,418 (GRCm39) F2260I unknown Het
Spata31h1 C T 10: 82,124,577 (GRCm39) S2811N probably benign Het
Ssr1 A G 13: 38,167,449 (GRCm39) I238T probably benign Het
Stk11ip A G 1: 75,506,818 (GRCm39) E633G possibly damaging Het
Svs3a A G 2: 164,132,062 (GRCm39) Y211C probably benign Het
Sytl1 T A 4: 132,988,175 (GRCm39) E60D possibly damaging Het
Tlcd5 C T 9: 43,022,664 (GRCm39) R230Q probably benign Het
Tlr1 T C 5: 65,083,198 (GRCm39) I460V probably damaging Het
Tmem64 T C 4: 15,266,718 (GRCm39) I256T probably damaging Het
Ttll5 G A 12: 85,964,516 (GRCm39) A553T possibly damaging Het
Ttll5 A T 12: 86,071,107 (GRCm39) T1327S probably benign Het
Upp2 T A 2: 58,680,177 (GRCm39) C334* probably null Het
Wdr74 C A 19: 8,713,358 (GRCm39) N24K possibly damaging Het
Zbtb42 G A 12: 112,645,848 (GRCm39) V8I probably benign Het
Zfp541 T A 7: 15,824,329 (GRCm39) L1078Q probably damaging Het
Zfr2 T C 10: 81,076,029 (GRCm39) V212A probably damaging Het
Other mutations in Cntnap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Cntnap3 APN 13 64,920,545 (GRCm39) missense probably damaging 1.00
IGL00782:Cntnap3 APN 13 64,893,619 (GRCm39) splice site probably benign
IGL00976:Cntnap3 APN 13 64,942,166 (GRCm39) missense probably damaging 1.00
IGL01319:Cntnap3 APN 13 64,935,651 (GRCm39) missense probably damaging 1.00
IGL01610:Cntnap3 APN 13 64,905,115 (GRCm39) missense probably damaging 0.98
IGL01861:Cntnap3 APN 13 64,946,922 (GRCm39) missense probably damaging 1.00
IGL02127:Cntnap3 APN 13 64,946,878 (GRCm39) splice site probably benign
IGL02133:Cntnap3 APN 13 64,899,487 (GRCm39) splice site probably benign
IGL02251:Cntnap3 APN 13 64,909,850 (GRCm39) missense probably damaging 1.00
IGL02272:Cntnap3 APN 13 64,905,225 (GRCm39) missense probably damaging 1.00
IGL02370:Cntnap3 APN 13 64,899,565 (GRCm39) missense probably benign
IGL02456:Cntnap3 APN 13 64,946,872 (GRCm39) splice site probably benign
IGL02589:Cntnap3 APN 13 64,940,244 (GRCm39) missense probably benign 0.08
IGL02695:Cntnap3 APN 13 64,919,946 (GRCm39) missense probably benign 0.01
IGL02850:Cntnap3 APN 13 64,905,223 (GRCm39) missense probably damaging 1.00
IGL03038:Cntnap3 APN 13 64,888,839 (GRCm39) missense possibly damaging 0.50
IGL03188:Cntnap3 APN 13 64,929,559 (GRCm39) missense probably damaging 0.97
IGL03327:Cntnap3 APN 13 65,035,582 (GRCm39) nonsense probably null
PIT4480001:Cntnap3 UTSW 13 64,905,024 (GRCm39) missense probably damaging 1.00
R0309:Cntnap3 UTSW 13 64,905,250 (GRCm39) splice site probably benign
R0422:Cntnap3 UTSW 13 64,905,099 (GRCm39) missense probably damaging 0.96
R0463:Cntnap3 UTSW 13 64,926,690 (GRCm39) missense probably damaging 1.00
R0491:Cntnap3 UTSW 13 64,909,859 (GRCm39) missense probably benign 0.01
R0499:Cntnap3 UTSW 13 65,006,492 (GRCm39) missense probably benign 0.33
R0550:Cntnap3 UTSW 13 64,909,814 (GRCm39) missense possibly damaging 0.86
R0613:Cntnap3 UTSW 13 64,906,228 (GRCm39) missense probably damaging 1.00
R0666:Cntnap3 UTSW 13 64,905,211 (GRCm39) missense probably damaging 1.00
R0840:Cntnap3 UTSW 13 64,935,724 (GRCm39) missense possibly damaging 0.94
R1577:Cntnap3 UTSW 13 64,906,104 (GRCm39) missense probably damaging 1.00
R1716:Cntnap3 UTSW 13 64,909,816 (GRCm39) missense probably damaging 1.00
R1732:Cntnap3 UTSW 13 64,888,626 (GRCm39) critical splice donor site probably null
R1739:Cntnap3 UTSW 13 64,888,406 (GRCm39) missense probably benign 0.17
R1905:Cntnap3 UTSW 13 65,051,578 (GRCm39) missense probably benign 0.04
R1988:Cntnap3 UTSW 13 64,906,204 (GRCm39) missense probably damaging 1.00
R2086:Cntnap3 UTSW 13 64,942,076 (GRCm39) missense possibly damaging 0.76
R3732:Cntnap3 UTSW 13 64,888,813 (GRCm39) missense possibly damaging 0.73
R3808:Cntnap3 UTSW 13 64,929,618 (GRCm39) missense probably damaging 0.96
R3809:Cntnap3 UTSW 13 64,929,618 (GRCm39) missense probably damaging 0.96
R4384:Cntnap3 UTSW 13 64,896,274 (GRCm39) missense probably damaging 1.00
R4433:Cntnap3 UTSW 13 64,926,667 (GRCm39) missense possibly damaging 0.92
R4631:Cntnap3 UTSW 13 64,926,697 (GRCm39) missense probably benign 0.04
R4645:Cntnap3 UTSW 13 64,926,602 (GRCm39) critical splice donor site probably null
R4702:Cntnap3 UTSW 13 64,926,676 (GRCm39) missense probably benign 0.17
R4876:Cntnap3 UTSW 13 64,935,520 (GRCm39) missense probably benign 0.00
R4994:Cntnap3 UTSW 13 64,909,798 (GRCm39) missense possibly damaging 0.55
R5043:Cntnap3 UTSW 13 64,942,162 (GRCm39) missense probably damaging 1.00
R5214:Cntnap3 UTSW 13 64,909,824 (GRCm39) missense probably damaging 1.00
R5403:Cntnap3 UTSW 13 64,909,792 (GRCm39) missense possibly damaging 0.90
R5571:Cntnap3 UTSW 13 65,051,572 (GRCm39) missense probably damaging 0.98
R5587:Cntnap3 UTSW 13 64,894,552 (GRCm39) missense probably damaging 1.00
R5695:Cntnap3 UTSW 13 64,935,769 (GRCm39) missense probably damaging 0.99
R5834:Cntnap3 UTSW 13 64,896,391 (GRCm39) missense probably benign 0.07
R5892:Cntnap3 UTSW 13 64,946,994 (GRCm39) missense probably damaging 1.00
R5950:Cntnap3 UTSW 13 64,935,583 (GRCm39) missense probably damaging 1.00
R6526:Cntnap3 UTSW 13 64,929,702 (GRCm39) missense possibly damaging 0.96
R6954:Cntnap3 UTSW 13 64,896,373 (GRCm39) missense probably benign 0.00
R7138:Cntnap3 UTSW 13 64,929,539 (GRCm39) critical splice donor site probably null
R7355:Cntnap3 UTSW 13 64,919,776 (GRCm39) missense probably benign
R7425:Cntnap3 UTSW 13 64,906,066 (GRCm39) missense probably damaging 1.00
R7521:Cntnap3 UTSW 13 64,919,815 (GRCm39) missense probably benign 0.22
R7719:Cntnap3 UTSW 13 64,920,591 (GRCm39) nonsense probably null
R7810:Cntnap3 UTSW 13 64,941,122 (GRCm39) missense possibly damaging 0.73
R7871:Cntnap3 UTSW 13 65,051,587 (GRCm39) missense probably benign 0.00
R8259:Cntnap3 UTSW 13 64,935,681 (GRCm39) missense probably damaging 0.99
R8415:Cntnap3 UTSW 13 64,886,479 (GRCm39) missense probably benign 0.31
R8491:Cntnap3 UTSW 13 64,933,157 (GRCm39) missense probably damaging 1.00
R9087:Cntnap3 UTSW 13 64,899,532 (GRCm39) missense probably damaging 0.96
R9398:Cntnap3 UTSW 13 65,051,648 (GRCm39) missense probably benign 0.41
R9475:Cntnap3 UTSW 13 64,946,949 (GRCm39) missense probably damaging 1.00
R9625:Cntnap3 UTSW 13 65,006,579 (GRCm39) missense probably damaging 1.00
R9679:Cntnap3 UTSW 13 64,899,562 (GRCm39) missense probably damaging 1.00
Z1176:Cntnap3 UTSW 13 64,940,202 (GRCm39) missense probably damaging 0.98
Z1176:Cntnap3 UTSW 13 64,888,686 (GRCm39) frame shift probably null
Z1177:Cntnap3 UTSW 13 64,929,706 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACACAAGTGCATCTGTGTCAG -3'
(R):5'- TGCAGTGGTCCCTGATCTTC -3'

Sequencing Primer
(F):5'- TGGTAACAGCTGAGCCATC -3'
(R):5'- CTCCTATCCTTGTGCTTGCAATCAG -3'
Posted On 2021-12-30