Incidental Mutation 'R9087:Ep400'
ID 690668
Institutional Source Beutler Lab
Gene Symbol Ep400
Ensembl Gene ENSMUSG00000029505
Gene Name E1A binding protein p400
Synonyms mDomino, 1700020J09Rik, p400
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9087 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 110664373-110770717 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 110667564 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 2887 (Y2887*)
Ref Sequence ENSEMBL: ENSMUSP00000049038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041558] [ENSMUST00000112435] [ENSMUST00000112436]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000041558
AA Change: Y2887*
SMART Domains Protein: ENSMUSP00000049038
Gene: ENSMUSG00000029505
AA Change: Y2887*

DomainStartEndE-ValueType
Pfam:EP400_N 1 461 1.6e-232 PFAM
low complexity region 519 532 N/A INTRINSIC
low complexity region 550 561 N/A INTRINSIC
low complexity region 598 620 N/A INTRINSIC
low complexity region 631 645 N/A INTRINSIC
low complexity region 658 686 N/A INTRINSIC
HSA 762 833 1.31e-31 SMART
low complexity region 908 925 N/A INTRINSIC
DEXDc 1049 1238 2.76e-15 SMART
Blast:DEXDc 1276 1317 2e-15 BLAST
low complexity region 1407 1417 N/A INTRINSIC
HELICc 1807 1893 1.17e-4 SMART
low complexity region 2006 2019 N/A INTRINSIC
low complexity region 2080 2100 N/A INTRINSIC
low complexity region 2214 2223 N/A INTRINSIC
SANT 2243 2310 3.57e-1 SMART
low complexity region 2402 2489 N/A INTRINSIC
low complexity region 2596 2608 N/A INTRINSIC
low complexity region 2644 2679 N/A INTRINSIC
low complexity region 2694 2738 N/A INTRINSIC
low complexity region 2769 2806 N/A INTRINSIC
low complexity region 2846 2883 N/A INTRINSIC
low complexity region 2933 2947 N/A INTRINSIC
low complexity region 2974 2986 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112435
AA Change: Y2761*
SMART Domains Protein: ENSMUSP00000108054
Gene: ENSMUSG00000029505
AA Change: Y2761*

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
low complexity region 121 145 N/A INTRINSIC
low complexity region 262 287 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 313 329 N/A INTRINSIC
coiled coil region 418 447 N/A INTRINSIC
low complexity region 471 485 N/A INTRINSIC
low complexity region 556 569 N/A INTRINSIC
low complexity region 587 598 N/A INTRINSIC
low complexity region 635 657 N/A INTRINSIC
low complexity region 668 682 N/A INTRINSIC
low complexity region 695 723 N/A INTRINSIC
HSA 799 870 1.31e-31 SMART
low complexity region 945 962 N/A INTRINSIC
DEXDc 1086 1275 2.76e-15 SMART
Blast:DEXDc 1313 1354 2e-15 BLAST
low complexity region 1444 1454 N/A INTRINSIC
internal_repeat_1 1556 1646 6.82e-5 PROSPERO
low complexity region 1887 1900 N/A INTRINSIC
low complexity region 1961 1981 N/A INTRINSIC
low complexity region 2095 2104 N/A INTRINSIC
SANT 2124 2191 3.57e-1 SMART
low complexity region 2283 2370 N/A INTRINSIC
internal_repeat_1 2371 2463 6.82e-5 PROSPERO
low complexity region 2477 2489 N/A INTRINSIC
low complexity region 2525 2560 N/A INTRINSIC
low complexity region 2575 2619 N/A INTRINSIC
low complexity region 2645 2659 N/A INTRINSIC
low complexity region 2660 2680 N/A INTRINSIC
low complexity region 2720 2757 N/A INTRINSIC
low complexity region 2807 2821 N/A INTRINSIC
low complexity region 2848 2860 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112436
AA Change: Y2851*
SMART Domains Protein: ENSMUSP00000108055
Gene: ENSMUSG00000029505
AA Change: Y2851*

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
low complexity region 121 145 N/A INTRINSIC
low complexity region 262 287 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 313 329 N/A INTRINSIC
coiled coil region 418 449 N/A INTRINSIC
low complexity region 472 482 N/A INTRINSIC
low complexity region 483 496 N/A INTRINSIC
low complexity region 514 525 N/A INTRINSIC
low complexity region 562 584 N/A INTRINSIC
low complexity region 595 609 N/A INTRINSIC
low complexity region 622 650 N/A INTRINSIC
HSA 726 797 1.31e-31 SMART
low complexity region 872 889 N/A INTRINSIC
DEXDc 1013 1202 2.76e-15 SMART
Blast:DEXDc 1240 1281 2e-15 BLAST
low complexity region 1371 1381 N/A INTRINSIC
internal_repeat_1 1483 1573 6.76e-5 PROSPERO
HELICc 1771 1857 1.17e-4 SMART
low complexity region 1970 1983 N/A INTRINSIC
low complexity region 2044 2064 N/A INTRINSIC
low complexity region 2178 2187 N/A INTRINSIC
SANT 2207 2274 3.57e-1 SMART
low complexity region 2366 2453 N/A INTRINSIC
internal_repeat_1 2454 2546 6.76e-5 PROSPERO
low complexity region 2560 2572 N/A INTRINSIC
low complexity region 2608 2643 N/A INTRINSIC
low complexity region 2658 2702 N/A INTRINSIC
low complexity region 2733 2770 N/A INTRINSIC
low complexity region 2810 2847 N/A INTRINSIC
low complexity region 2897 2911 N/A INTRINSIC
low complexity region 2938 2950 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele die at E11.5 and display severe defects in yolk sac erythropoiesis, anemia, and a slight deformity of the neural tube. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars A G 8: 111,041,537 D180G probably damaging Het
Abcb6 A T 1: 75,173,567 I649K probably damaging Het
Ace T C 11: 105,981,919 F969S probably damaging Het
Ankrd26 A G 6: 118,559,269 probably null Het
Apobec1 A T 6: 122,581,741 L9* probably null Het
Atp13a1 A G 8: 69,803,807 D865G probably damaging Het
Barhl1 T C 2: 28,915,219 Y154C probably damaging Het
Bbx T C 16: 50,274,635 D106G probably damaging Het
Cacna1a G A 8: 84,638,803 A2192T probably benign Het
Cacnb1 T C 11: 98,003,007 N563S possibly damaging Het
Capn5 A T 7: 98,126,324 I470N probably damaging Het
Cd300c T C 11: 114,959,765 T71A probably damaging Het
Celf4 T A 18: 25,504,270 S223C probably damaging Het
Cftr A C 6: 18,214,181 I119L possibly damaging Het
Cmya5 T C 13: 93,097,203 E459G possibly damaging Het
Cntn2 A G 1: 132,525,370 Y395H probably damaging Het
Cntnap3 T C 13: 64,751,718 D987G probably damaging Het
Col5a2 T A 1: 45,442,658 D102V unknown Het
Cpeb2 T C 5: 43,281,118 F812L Het
Cpsf3 T A 12: 21,308,994 L565Q probably damaging Het
Ctnnd1 A C 2: 84,609,578 L796R probably damaging Het
Dach1 A G 14: 98,168,831 L160P probably benign Het
Dennd1a A C 2: 38,021,354 probably null Het
Dnah12 T C 14: 26,824,546 I2431T probably damaging Het
Erich1 T C 8: 14,033,623 D149G probably damaging Het
Fut2 T C 7: 45,651,069 N93S probably damaging Het
Gba2 C T 4: 43,568,304 A688T probably benign Het
Gcm2 C G 13: 41,109,930 E9Q Het
Gfod1 T C 13: 43,200,362 E379G probably damaging Het
Gfod2 A G 8: 105,728,219 F10L probably damaging Het
Gm4871 T G 5: 145,032,278 H75P possibly damaging Het
Gtpbp3 T A 8: 71,492,355 V418E probably benign Het
Hif1a T A 12: 73,942,325 I688K probably benign Het
Ifi44 G T 3: 151,745,880 S196R probably damaging Het
Igfn1 T C 1: 135,974,868 probably null Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kl A G 5: 150,988,492 K569E probably benign Het
Klkb1 G A 8: 45,275,478 Q415* probably null Het
L1td1 A G 4: 98,736,462 D298G possibly damaging Het
L2hgdh C T 12: 69,702,357 R252Q probably benign Het
Lipc C G 9: 70,802,108 K452N probably benign Het
Lrp10 C A 14: 54,468,164 S270R probably damaging Het
Ly6e T G 15: 74,957,800 L14R probably benign Het
Mast3 T C 8: 70,789,686 D90G possibly damaging Het
Mmp27 T C 9: 7,579,857 F444S probably damaging Het
Mrgpra2b A T 7: 47,464,770 N71K probably benign Het
Nbea C A 3: 55,642,736 probably null Het
Ndufb10 A G 17: 24,724,185 probably null Het
Ndufb9 C T 15: 58,939,302 P146S probably benign Het
Nhsl1 T C 10: 18,531,282 V1388A probably damaging Het
Nomo1 C A 7: 46,083,324 D1170E probably benign Het
Nop2 G T 6: 125,137,428 R254L probably benign Het
Nup160 A T 2: 90,684,085 T126S probably benign Het
Olfr1049 A G 2: 86,255,036 M219T probably benign Het
Olfr1107 A G 2: 87,071,955 Y60H probably damaging Het
Olfr344 T C 2: 36,569,333 L245P probably damaging Het
Olfr493 A G 7: 108,346,751 S77P probably damaging Het
Olfr531 A T 7: 140,400,634 C137* probably null Het
Olfr555 A G 7: 102,659,757 K312R probably benign Het
Olfr675 C T 7: 105,024,703 W92* probably null Het
Olfr917 A G 9: 38,665,415 L143P probably damaging Het
Opa1 A G 16: 29,618,235 D654G probably damaging Het
Osbp2 T A 11: 3,717,976 D7V probably damaging Het
Osr2 A T 15: 35,300,864 I189F probably damaging Het
Pdlim5 A G 3: 142,352,833 V50A possibly damaging Het
Pik3r3 A G 4: 116,291,734 N334S probably benign Het
Plk5 C G 10: 80,357,996 R40G probably damaging Het
Ppfia4 A G 1: 134,312,588 I889T probably damaging Het
Prpf38b T C 3: 108,904,341 K403E unknown Het
Rgs20 T G 1: 4,923,967 E31A possibly damaging Het
Rpl11 A T 4: 136,052,689 M12K possibly damaging Het
Rreb1 C A 13: 37,931,668 T1001K probably benign Het
Ruvbl1 A G 6: 88,497,373 K453E probably benign Het
Sdc4 A T 2: 164,429,039 V100D probably benign Het
Simc1 C A 13: 54,524,334 T165K probably benign Het
Slc2a3 A G 6: 122,740,449 V16A probably benign Het
Smbd1 A T 16: 32,806,760 S53T possibly damaging Het
Smndc1 A T 19: 53,383,643 N113K possibly damaging Het
Tas2r139 T G 6: 42,141,234 F100C probably damaging Het
Tubgcp5 A G 7: 55,817,358 Y692C probably damaging Het
Ube2d2a T C 18: 35,800,144 I78T probably benign Het
Ugt2b37 C T 5: 87,254,137 V212I probably benign Het
Wars2 A G 3: 99,216,747 D308G possibly damaging Het
Yeats2 G A 16: 20,211,750 probably null Het
Zfp385a G T 15: 103,315,891 H219N possibly damaging Het
Zfp407 T C 18: 84,209,857 T1876A probably damaging Het
Other mutations in Ep400
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Ep400 APN 5 110687841 missense unknown
IGL00585:Ep400 APN 5 110755905 missense possibly damaging 0.70
IGL00586:Ep400 APN 5 110739594 missense probably damaging 1.00
IGL00816:Ep400 APN 5 110735490 unclassified probably benign
IGL01066:Ep400 APN 5 110668199 splice site probably benign
IGL01302:Ep400 APN 5 110742048 missense probably benign 0.00
IGL01568:Ep400 APN 5 110719495 missense unknown
IGL01833:Ep400 APN 5 110680008 missense unknown
IGL02086:Ep400 APN 5 110676943 splice site probably benign
IGL02266:Ep400 APN 5 110695297 unclassified probably benign
IGL02288:Ep400 APN 5 110683836 splice site probably benign
IGL02301:Ep400 APN 5 110674960 missense probably damaging 1.00
IGL02377:Ep400 APN 5 110720825 missense unknown
IGL02382:Ep400 APN 5 110701728 missense unknown
IGL02419:Ep400 APN 5 110697376 splice site probably null
IGL02591:Ep400 APN 5 110733772 unclassified probably benign
IGL02981:Ep400 APN 5 110756103 missense possibly damaging 0.79
IGL02981:Ep400 APN 5 110691610 splice site probably benign
IGL03173:Ep400 APN 5 110708871 unclassified probably benign
IGL03244:Ep400 APN 5 110727563 missense unknown
IGL03333:Ep400 APN 5 110703566 missense unknown
santol UTSW 5 110701671 missense unknown
PIT4243001:Ep400 UTSW 5 110735580 missense unknown
PIT4260001:Ep400 UTSW 5 110693171 nonsense probably null
R0017:Ep400 UTSW 5 110673529 missense probably damaging 1.00
R0179:Ep400 UTSW 5 110668649 missense probably damaging 0.99
R0243:Ep400 UTSW 5 110724407 splice site probably benign
R0366:Ep400 UTSW 5 110701671 missense unknown
R0508:Ep400 UTSW 5 110739508 missense probably benign 0.00
R0541:Ep400 UTSW 5 110705016 missense unknown
R0558:Ep400 UTSW 5 110685067 splice site probably benign
R0576:Ep400 UTSW 5 110711093 unclassified probably benign
R0595:Ep400 UTSW 5 110703542 missense unknown
R0671:Ep400 UTSW 5 110688196 missense unknown
R0763:Ep400 UTSW 5 110665837 missense probably damaging 1.00
R1078:Ep400 UTSW 5 110735522 unclassified probably benign
R1300:Ep400 UTSW 5 110673560 missense probably damaging 1.00
R1439:Ep400 UTSW 5 110685478 missense unknown
R1520:Ep400 UTSW 5 110691778 intron probably benign
R1529:Ep400 UTSW 5 110739445 missense probably benign 0.00
R1535:Ep400 UTSW 5 110708166 unclassified probably benign
R1560:Ep400 UTSW 5 110671106 splice site probably null
R1587:Ep400 UTSW 5 110726902 missense probably benign 0.23
R1596:Ep400 UTSW 5 110708861 unclassified probably benign
R1653:Ep400 UTSW 5 110693174 nonsense probably null
R1711:Ep400 UTSW 5 110693308 unclassified probably benign
R1774:Ep400 UTSW 5 110685491 missense unknown
R1836:Ep400 UTSW 5 110705054 missense unknown
R1905:Ep400 UTSW 5 110670948 missense probably damaging 1.00
R1917:Ep400 UTSW 5 110703575 missense unknown
R2064:Ep400 UTSW 5 110735404 unclassified probably benign
R2122:Ep400 UTSW 5 110708850 unclassified probably benign
R2144:Ep400 UTSW 5 110703518 missense unknown
R2215:Ep400 UTSW 5 110693555 unclassified probably benign
R2252:Ep400 UTSW 5 110719091 missense unknown
R2253:Ep400 UTSW 5 110719091 missense unknown
R2483:Ep400 UTSW 5 110719236 missense unknown
R2504:Ep400 UTSW 5 110668645 missense probably damaging 1.00
R2512:Ep400 UTSW 5 110708915 unclassified probably benign
R2842:Ep400 UTSW 5 110698815 nonsense probably null
R2920:Ep400 UTSW 5 110755914 missense probably damaging 1.00
R3082:Ep400 UTSW 5 110693230 unclassified probably benign
R3151:Ep400 UTSW 5 110703569 missense unknown
R3552:Ep400 UTSW 5 110729287 missense unknown
R3623:Ep400 UTSW 5 110719236 missense unknown
R3779:Ep400 UTSW 5 110691649 missense unknown
R3923:Ep400 UTSW 5 110756523 missense possibly damaging 0.55
R4062:Ep400 UTSW 5 110741981 missense probably benign 0.10
R4508:Ep400 UTSW 5 110703615 missense unknown
R4584:Ep400 UTSW 5 110733897 unclassified probably benign
R4585:Ep400 UTSW 5 110753859 missense probably damaging 1.00
R4586:Ep400 UTSW 5 110753859 missense probably damaging 1.00
R4807:Ep400 UTSW 5 110695578 splice site probably null
R4921:Ep400 UTSW 5 110665810 missense probably damaging 1.00
R4976:Ep400 UTSW 5 110698812 missense unknown
R4976:Ep400 UTSW 5 110720756 missense unknown
R5075:Ep400 UTSW 5 110685485 missense unknown
R5120:Ep400 UTSW 5 110756358 missense probably damaging 1.00
R5122:Ep400 UTSW 5 110668170 missense probably damaging 1.00
R5223:Ep400 UTSW 5 110668630 missense probably damaging 1.00
R5284:Ep400 UTSW 5 110668124 missense probably damaging 1.00
R5388:Ep400 UTSW 5 110701728 missense unknown
R5401:Ep400 UTSW 5 110683171 missense unknown
R5431:Ep400 UTSW 5 110676554 missense unknown
R5461:Ep400 UTSW 5 110676684 nonsense probably null
R5568:Ep400 UTSW 5 110756205 missense probably damaging 1.00
R5650:Ep400 UTSW 5 110695952 critical splice donor site probably null
R5778:Ep400 UTSW 5 110719584 missense unknown
R5806:Ep400 UTSW 5 110755554 nonsense probably null
R5814:Ep400 UTSW 5 110695578 splice site probably null
R5830:Ep400 UTSW 5 110683996 missense unknown
R5882:Ep400 UTSW 5 110755587 missense probably benign 0.00
R5931:Ep400 UTSW 5 110735520 unclassified probably benign
R5945:Ep400 UTSW 5 110682866 missense unknown
R5966:Ep400 UTSW 5 110676900 missense unknown
R5973:Ep400 UTSW 5 110729831 missense unknown
R5980:Ep400 UTSW 5 110733729 unclassified probably benign
R6000:Ep400 UTSW 5 110683201 missense unknown
R6006:Ep400 UTSW 5 110704959 missense unknown
R6053:Ep400 UTSW 5 110755795 missense probably benign 0.22
R6145:Ep400 UTSW 5 110756703 missense possibly damaging 0.95
R6154:Ep400 UTSW 5 110755933 missense probably damaging 0.97
R6169:Ep400 UTSW 5 110741997 missense possibly damaging 0.83
R6228:Ep400 UTSW 5 110670942 missense probably damaging 1.00
R6295:Ep400 UTSW 5 110753809 missense probably benign 0.00
R6486:Ep400 UTSW 5 110697218 unclassified probably benign
R6504:Ep400 UTSW 5 110708837 unclassified probably benign
R6607:Ep400 UTSW 5 110683314 missense unknown
R6657:Ep400 UTSW 5 110693545 unclassified probably benign
R6660:Ep400 UTSW 5 110719447 nonsense probably null
R6741:Ep400 UTSW 5 110676895 missense unknown
R6933:Ep400 UTSW 5 110665862 missense probably damaging 1.00
R6937:Ep400 UTSW 5 110711152 unclassified probably benign
R7069:Ep400 UTSW 5 110668124 missense probably damaging 1.00
R7103:Ep400 UTSW 5 110733785 missense unknown
R7156:Ep400 UTSW 5 110685363 missense unknown
R7272:Ep400 UTSW 5 110755645 nonsense probably null
R7365:Ep400 UTSW 5 110719614 missense unknown
R7581:Ep400 UTSW 5 110756025 missense unknown
R7684:Ep400 UTSW 5 110697352 missense unknown
R7699:Ep400 UTSW 5 110696032 missense unknown
R7700:Ep400 UTSW 5 110696032 missense unknown
R7856:Ep400 UTSW 5 110666584 missense probably damaging 0.99
R7954:Ep400 UTSW 5 110668733 missense possibly damaging 0.46
R8098:Ep400 UTSW 5 110693251 missense unknown
R8108:Ep400 UTSW 5 110687883 missense unknown
R8260:Ep400 UTSW 5 110755612 nonsense probably null
R8293:Ep400 UTSW 5 110708892 missense unknown
R8314:Ep400 UTSW 5 110755753 missense unknown
R8351:Ep400 UTSW 5 110739334 missense probably damaging 1.00
R8424:Ep400 UTSW 5 110693278 missense unknown
R8459:Ep400 UTSW 5 110708891 missense unknown
R8529:Ep400 UTSW 5 110719236 missense unknown
R8688:Ep400 UTSW 5 110720819 missense unknown
R8744:Ep400 UTSW 5 110742059 missense unknown
R8923:Ep400 UTSW 5 110683998 missense unknown
R9005:Ep400 UTSW 5 110711093 missense unknown
R9146:Ep400 UTSW 5 110701769 nonsense probably null
R9383:Ep400 UTSW 5 110685485 missense unknown
X0012:Ep400 UTSW 5 110673196 small deletion probably benign
X0021:Ep400 UTSW 5 110682864 missense unknown
Z1176:Ep400 UTSW 5 110756635 missense unknown
Z1177:Ep400 UTSW 5 110683364 missense unknown
Z1177:Ep400 UTSW 5 110733743 missense unknown
Z1188:Ep400 UTSW 5 110755683 missense unknown
Predicted Primers PCR Primer
(F):5'- AGCCTGTTGTAGCAATGTTCATG -3'
(R):5'- TGGCTTAAAGGTAGGGCAATGC -3'

Sequencing Primer
(F):5'- GCAATGTTCATGTGTCTGAAATTC -3'
(R):5'- AGTGAACCTAGTCTCACC -3'
Posted On 2021-12-30