Mutagenetix > Incidental Mutation

Incidental Mutation 'R9087:Mast3'

690690

Institutional Source

Beutler Lab

Gene Symbol

Mast3

Ensembl Gene

ENSMUSG00000031833

Gene Name

microtubule associated serine/threonine kinase 3

Synonyms

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_199308.2. MGI:2683541

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9087 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

70778117-70805054 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 70789686 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 90 (D90G)

Ref Sequence

ENSEMBL: ENSMUSP00000148291 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166004] [ENSMUST00000211948] [ENSMUST00000212001] [ENSMUST00000212038] [ENSMUST00000212551] [ENSMUST00000212673] [ENSMUST00000212757] [ENSMUST00000212875]

AlphaFold

Q3U214

Predicted Effect

probably benign
Transcript: ENSMUST00000166004

SMART Domains

Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833

Domain	Start	End	E-Value	Type
low complexity region	43	59	N/A	INTRINSIC
Pfam:DUF1908	64	337	4.4e-128	PFAM
S_TKc	373	646	2.77e-99	SMART
S_TK_X	647	710	2.39e-1	SMART
low complexity region	820	833	N/A	INTRINSIC
low complexity region	910	942	N/A	INTRINSIC
PDZ	958	1038	3.8e-15	SMART
low complexity region	1053	1074	N/A	INTRINSIC
low complexity region	1089	1121	N/A	INTRINSIC
low complexity region	1124	1150	N/A	INTRINSIC
low complexity region	1180	1204	N/A	INTRINSIC
low complexity region	1231	1248	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000211948

Predicted Effect

probably benign
Transcript: ENSMUST00000212001

Predicted Effect

probably benign
Transcript: ENSMUST00000212038

Predicted Effect

possibly damaging
Transcript: ENSMUST00000212551
AA Change: D90G

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)

Predicted Effect

probably benign
Transcript: ENSMUST00000212673
AA Change: D62G

PolyPhen 2 Score 0.361 (Sensitivity: 0.90; Specificity: 0.89)

Predicted Effect

probably benign
Transcript: ENSMUST00000212757

Predicted Effect

probably benign
Transcript: ENSMUST00000212875

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aars	A	G	8: 111,041,537	D180G	probably damaging	Het
Abcb6	A	T	1: 75,173,567	I649K	probably damaging	Het
Ace	T	C	11: 105,981,919	F969S	probably damaging	Het
Ankrd26	A	G	6: 118,559,269		probably null	Het
Apobec1	A	T	6: 122,581,741	L9*	probably null	Het
Atp13a1	A	G	8: 69,803,807	D865G	probably damaging	Het
Barhl1	T	C	2: 28,915,219	Y154C	probably damaging	Het
Bbx	T	C	16: 50,274,635	D106G	probably damaging	Het
Cacna1a	G	A	8: 84,638,803	A2192T	probably benign	Het
Cacnb1	T	C	11: 98,003,007	N563S	possibly damaging	Het
Capn5	A	T	7: 98,126,324	I470N	probably damaging	Het
Cd300c	T	C	11: 114,959,765	T71A	probably damaging	Het
Celf4	T	A	18: 25,504,270	S223C	probably damaging	Het
Cftr	A	C	6: 18,214,181	I119L	possibly damaging	Het
Cmya5	T	C	13: 93,097,203	E459G	possibly damaging	Het
Cntn2	A	G	1: 132,525,370	Y395H	probably damaging	Het
Cntnap3	T	C	13: 64,751,718	D987G	probably damaging	Het
Col5a2	T	A	1: 45,442,658	D102V	unknown	Het
Cpeb2	T	C	5: 43,281,118	F812L		Het
Cpsf3	T	A	12: 21,308,994	L565Q	probably damaging	Het
Ctnnd1	A	C	2: 84,609,578	L796R	probably damaging	Het
Dach1	A	G	14: 98,168,831	L160P	probably benign	Het
Dennd1a	A	C	2: 38,021,354		probably null	Het
Dnah12	T	C	14: 26,824,546	I2431T	probably damaging	Het
Ep400	A	T	5: 110,667,564	Y2887*	probably null	Het
Erich1	T	C	8: 14,033,623	D149G	probably damaging	Het
Fut2	T	C	7: 45,651,069	N93S	probably damaging	Het
Gba2	C	T	4: 43,568,304	A688T	probably benign	Het
Gcm2	C	G	13: 41,109,930	E9Q		Het
Gfod1	T	C	13: 43,200,362	E379G	probably damaging	Het
Gfod2	A	G	8: 105,728,219	F10L	probably damaging	Het
Gm4871	T	G	5: 145,032,278	H75P	possibly damaging	Het
Gtpbp3	T	A	8: 71,492,355	V418E	probably benign	Het
Hif1a	T	A	12: 73,942,325	I688K	probably benign	Het
Ifi44	G	T	3: 151,745,880	S196R	probably damaging	Het
Igfn1	T	C	1: 135,974,868		probably null	Het
Itpr3	G	A	17: 27,118,677		probably benign	Het
Kl	A	G	5: 150,988,492	K569E	probably benign	Het
Klkb1	G	A	8: 45,275,478	Q415*	probably null	Het
L1td1	A	G	4: 98,736,462	D298G	possibly damaging	Het
L2hgdh	C	T	12: 69,702,357	R252Q	probably benign	Het
Lipc	C	G	9: 70,802,108	K452N	probably benign	Het
Lrp10	C	A	14: 54,468,164	S270R	probably damaging	Het
Ly6e	T	G	15: 74,957,800	L14R	probably benign	Het
Mmp27	T	C	9: 7,579,857	F444S	probably damaging	Het
Mrgpra2b	A	T	7: 47,464,770	N71K	probably benign	Het
Nbea	C	A	3: 55,642,736		probably null	Het
Ndufb10	A	G	17: 24,724,185		probably null	Het
Ndufb9	C	T	15: 58,939,302	P146S	probably benign	Het
Nhsl1	T	C	10: 18,531,282	V1388A	probably damaging	Het
Nomo1	C	A	7: 46,083,324	D1170E	probably benign	Het
Nop2	G	T	6: 125,137,428	R254L	probably benign	Het
Nup160	A	T	2: 90,684,085	T126S	probably benign	Het
Olfr1049	A	G	2: 86,255,036	M219T	probably benign	Het
Olfr1107	A	G	2: 87,071,955	Y60H	probably damaging	Het
Olfr344	T	C	2: 36,569,333	L245P	probably damaging	Het
Olfr493	A	G	7: 108,346,751	S77P	probably damaging	Het
Olfr531	A	T	7: 140,400,634	C137*	probably null	Het
Olfr555	A	G	7: 102,659,757	K312R	probably benign	Het
Olfr675	C	T	7: 105,024,703	W92*	probably null	Het
Olfr917	A	G	9: 38,665,415	L143P	probably damaging	Het
Opa1	A	G	16: 29,618,235	D654G	probably damaging	Het
Osbp2	T	A	11: 3,717,976	D7V	probably damaging	Het
Osr2	A	T	15: 35,300,864	I189F	probably damaging	Het
Pdlim5	A	G	3: 142,352,833	V50A	possibly damaging	Het
Pik3r3	A	G	4: 116,291,734	N334S	probably benign	Het
Plk5	C	G	10: 80,357,996	R40G	probably damaging	Het
Ppfia4	A	G	1: 134,312,588	I889T	probably damaging	Het
Prpf38b	T	C	3: 108,904,341	K403E	unknown	Het
Rgs20	T	G	1: 4,923,967	E31A	possibly damaging	Het
Rpl11	A	T	4: 136,052,689	M12K	possibly damaging	Het
Rreb1	C	A	13: 37,931,668	T1001K	probably benign	Het
Ruvbl1	A	G	6: 88,497,373	K453E	probably benign	Het
Sdc4	A	T	2: 164,429,039	V100D	probably benign	Het
Simc1	C	A	13: 54,524,334	T165K	probably benign	Het
Slc2a3	A	G	6: 122,740,449	V16A	probably benign	Het
Smbd1	A	T	16: 32,806,760	S53T	possibly damaging	Het
Smndc1	A	T	19: 53,383,643	N113K	possibly damaging	Het
Tas2r139	T	G	6: 42,141,234	F100C	probably damaging	Het
Tubgcp5	A	G	7: 55,817,358	Y692C	probably damaging	Het
Ube2d2a	T	C	18: 35,800,144	I78T	probably benign	Het
Ugt2b37	C	T	5: 87,254,137	V212I	probably benign	Het
Wars2	A	G	3: 99,216,747	D308G	possibly damaging	Het
Yeats2	G	A	16: 20,211,750		probably null	Het
Zfp385a	G	T	15: 103,315,891	H219N	possibly damaging	Het
Zfp407	T	C	18: 84,209,857	T1876A	probably damaging	Het

Other mutations in Mast3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00952:Mast3	APN	8	70780683	splice site	probably benign
IGL01411:Mast3	APN	8	70779583	missense	possibly damaging	0.50
IGL01475:Mast3	APN	8	70779530	missense	probably damaging	1.00
IGL01886:Mast3	APN	8	70782139	missense	possibly damaging	0.94
IGL02104:Mast3	APN	8	70787906	missense	possibly damaging	0.78
IGL02236:Mast3	APN	8	70789244	missense	probably benign	0.36
IGL02437:Mast3	APN	8	70780558	missense	possibly damaging	0.79
IGL02704:Mast3	APN	8	70786875	missense	probably damaging	1.00
IGL03155:Mast3	APN	8	70789217	missense	probably damaging	1.00
IGL03366:Mast3	APN	8	70781563	nonsense	probably null
gravy	UTSW	8	70786635	missense	probably damaging	1.00
stuffing	UTSW	8	70784797	frame shift	probably null
turkey	UTSW	8	70785482	missense	probably damaging	1.00
BB010:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
BB020:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
R0037:Mast3	UTSW	8	70783699	critical splice donor site	probably null
R0280:Mast3	UTSW	8	70783795	missense	probably damaging	1.00
R0280:Mast3	UTSW	8	70787920	missense	possibly damaging	0.65
R0731:Mast3	UTSW	8	70781321	missense	probably damaging	1.00
R1101:Mast3	UTSW	8	70786663	missense	probably damaging	1.00
R1177:Mast3	UTSW	8	70780324	missense	probably damaging	1.00
R1208:Mast3	UTSW	8	70788272	splice site	probably null
R1208:Mast3	UTSW	8	70788272	splice site	probably null
R1333:Mast3	UTSW	8	70781294	missense	probably damaging	1.00
R1543:Mast3	UTSW	8	70792311	missense	possibly damaging	0.93
R1544:Mast3	UTSW	8	70786172	missense	probably damaging	1.00
R1738:Mast3	UTSW	8	70784556	missense	probably benign	0.38
R1842:Mast3	UTSW	8	70780393	missense	possibly damaging	0.91
R1936:Mast3	UTSW	8	70784800	missense	probably damaging	1.00
R2015:Mast3	UTSW	8	70787363	missense	probably benign	0.00
R2219:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R2220:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R3711:Mast3	UTSW	8	70779607	missense	probably benign	0.13
R3919:Mast3	UTSW	8	70779422	missense	probably benign	0.02
R4027:Mast3	UTSW	8	70787908	missense	probably damaging	1.00
R4060:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4061:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4062:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4063:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4588:Mast3	UTSW	8	70780607	nonsense	probably null
R4672:Mast3	UTSW	8	70784797	frame shift	probably null
R4770:Mast3	UTSW	8	70786220	missense	probably damaging	1.00
R4822:Mast3	UTSW	8	70780366	missense	probably damaging	1.00
R4830:Mast3	UTSW	8	70788915	missense	possibly damaging	0.87
R5196:Mast3	UTSW	8	70788245	missense	probably damaging	1.00
R5333:Mast3	UTSW	8	70783501	missense	probably benign	0.03
R5428:Mast3	UTSW	8	70784733	missense	possibly damaging	0.95
R5656:Mast3	UTSW	8	70786221	missense	probably damaging	1.00
R5920:Mast3	UTSW	8	70787933	missense	probably benign	0.00
R6177:Mast3	UTSW	8	70790018	missense	probably damaging	1.00
R6186:Mast3	UTSW	8	70785483	missense	probably damaging	1.00
R6407:Mast3	UTSW	8	70782128	missense	probably benign	0.02
R6614:Mast3	UTSW	8	70781966	missense	possibly damaging	0.95
R6804:Mast3	UTSW	8	70786732	missense	probably benign	0.29
R6873:Mast3	UTSW	8	70786592	nonsense	probably null
R6930:Mast3	UTSW	8	70799471	nonsense	probably null
R6948:Mast3	UTSW	8	70785482	missense	probably damaging	1.00
R7084:Mast3	UTSW	8	70779473	missense	probably benign	0.14
R7253:Mast3	UTSW	8	70789682	critical splice donor site	probably null
R7316:Mast3	UTSW	8	70779788	missense	probably damaging	1.00
R7357:Mast3	UTSW	8	70784859	missense	probably damaging	1.00
R7405:Mast3	UTSW	8	70786171	missense	probably damaging	1.00
R7429:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7430:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7521:Mast3	UTSW	8	70788768	missense	probably benign	0.16
R7576:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R7933:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
R7998:Mast3	UTSW	8	70783570	missense	probably benign
R8021:Mast3	UTSW	8	70788252	missense	probably benign	0.02
R8204:Mast3	UTSW	8	70788281	missense	probably benign	0.00
R8327:Mast3	UTSW	8	70779418	missense	probably damaging	1.00
R8357:Mast3	UTSW	8	70780441	missense	probably benign	0.39
R8415:Mast3	UTSW	8	70781222	missense	probably damaging	1.00
R8457:Mast3	UTSW	8	70780441	missense	probably benign	0.39
R8530:Mast3	UTSW	8	70788233	missense	possibly damaging	0.92
R8891:Mast3	UTSW	8	70781157	missense	probably damaging	1.00
R8930:Mast3	UTSW	8	70781733	splice site	probably benign
R9002:Mast3	UTSW	8	70781260	missense	probably damaging	1.00
R9085:Mast3	UTSW	8	70796717	missense	unknown
R9148:Mast3	UTSW	8	70780447	missense	probably damaging	0.98
R9364:Mast3	UTSW	8	70786182	missense	probably damaging	1.00
R9779:Mast3	UTSW	8	70785483	missense	probably damaging	1.00
Z1177:Mast3	UTSW	8	70789038	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- CAACTCAGGGATATCCAAGGGG -3'
(R):5'- TCGGAACTTCTCTGCTGCAG -3'

Sequencing Primer
(F):5'- TGGTGGAATTAAAGGCCC -3'
(R):5'- GCAGCAGCCATCAGTTTCC -3'

Posted On

2021-12-30