Incidental Mutation 'R9087:Mmp27'
ID 690695
Institutional Source Beutler Lab
Gene Symbol Mmp27
Ensembl Gene ENSMUSG00000070323
Gene Name matrix metallopeptidase 27
Synonyms LOC234911
MMRRC Submission 068906-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.059) question?
Stock # R9087 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 7571397-7581886 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 7579858 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 444 (F444S)
Ref Sequence ENSEMBL: ENSMUSP00000113231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120900] [ENSMUST00000151853]
AlphaFold D3YV89
Predicted Effect probably damaging
Transcript: ENSMUST00000120900
AA Change: F444S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113231
Gene: ENSMUSG00000070323
AA Change: F444S

DomainStartEndE-ValueType
Pfam:PG_binding_1 40 100 1e-13 PFAM
ZnMc 116 277 1.76e-50 SMART
HX 300 342 5.97e-4 SMART
HX 344 386 1.1e-7 SMART
HX 391 438 1.09e-6 SMART
HX 440 480 3.2e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000151853
AA Change: F470S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117469
Gene: ENSMUSG00000070323
AA Change: F470S

DomainStartEndE-ValueType
Pfam:PG_binding_1 40 100 1.1e-13 PFAM
ZnMc 116 303 1.81e-43 SMART
HX 326 368 5.97e-4 SMART
HX 370 412 1.1e-7 SMART
HX 417 464 1.09e-6 SMART
HX 466 506 3.2e-4 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000116263
Gene: ENSMUSG00000070323
AA Change: F388S

DomainStartEndE-ValueType
Pfam:PG_binding_1 39 99 1.1e-13 PFAM
ZnMc 115 295 1.41e-13 SMART
HX 245 287 5.97e-4 SMART
HX 289 331 1.1e-7 SMART
HX 336 383 1.09e-6 SMART
HX 385 425 3.2e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins of the matrix metalloproteinase (MMP) family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. Most MMP's are secreted as inactive proproteins which are activated when cleaved by extracellular proteinases. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars1 A G 8: 111,768,169 (GRCm39) D180G probably damaging Het
Abcb6 A T 1: 75,150,211 (GRCm39) I649K probably damaging Het
Ace T C 11: 105,872,745 (GRCm39) F969S probably damaging Het
Ankrd26 A G 6: 118,536,230 (GRCm39) probably null Het
Apobec1 A T 6: 122,558,700 (GRCm39) L9* probably null Het
Atp13a1 A G 8: 70,256,457 (GRCm39) D865G probably damaging Het
Barhl1 T C 2: 28,805,231 (GRCm39) Y154C probably damaging Het
Bbx T C 16: 50,094,998 (GRCm39) D106G probably damaging Het
Cacna1a G A 8: 85,365,432 (GRCm39) A2192T probably benign Het
Cacnb1 T C 11: 97,893,833 (GRCm39) N563S possibly damaging Het
Capn5 A T 7: 97,775,531 (GRCm39) I470N probably damaging Het
Cd300c T C 11: 114,850,591 (GRCm39) T71A probably damaging Het
Celf4 T A 18: 25,637,327 (GRCm39) S223C probably damaging Het
Cftr A C 6: 18,214,180 (GRCm39) I119L possibly damaging Het
Cmya5 T C 13: 93,233,711 (GRCm39) E459G possibly damaging Het
Cntn2 A G 1: 132,453,108 (GRCm39) Y395H probably damaging Het
Cntnap3 T C 13: 64,899,532 (GRCm39) D987G probably damaging Het
Col5a2 T A 1: 45,481,818 (GRCm39) D102V unknown Het
Cpeb2 T C 5: 43,438,461 (GRCm39) F812L Het
Cpsf3 T A 12: 21,358,995 (GRCm39) L565Q probably damaging Het
Ctnnd1 A C 2: 84,439,922 (GRCm39) L796R probably damaging Het
Dach1 A G 14: 98,406,267 (GRCm39) L160P probably benign Het
Dennd1a A C 2: 37,911,366 (GRCm39) probably null Het
Dnah12 T C 14: 26,546,503 (GRCm39) I2431T probably damaging Het
Ep400 A T 5: 110,815,430 (GRCm39) Y2887* probably null Het
Erich1 T C 8: 14,083,623 (GRCm39) D149G probably damaging Het
Fut2 T C 7: 45,300,493 (GRCm39) N93S probably damaging Het
Gba2 C T 4: 43,568,304 (GRCm39) A688T probably benign Het
Gcm2 C G 13: 41,263,406 (GRCm39) E9Q Het
Gfod1 T C 13: 43,353,838 (GRCm39) E379G probably damaging Het
Gfod2 A G 8: 106,454,851 (GRCm39) F10L probably damaging Het
Gm4871 T G 5: 144,969,088 (GRCm39) H75P possibly damaging Het
Gtpbp3 T A 8: 71,944,999 (GRCm39) V418E probably benign Het
Hif1a T A 12: 73,989,099 (GRCm39) I688K probably benign Het
Ifi44 G T 3: 151,451,517 (GRCm39) S196R probably damaging Het
Igfn1 T C 1: 135,902,606 (GRCm39) probably null Het
Itpr3 G A 17: 27,337,651 (GRCm39) probably benign Het
Kl A G 5: 150,911,957 (GRCm39) K569E probably benign Het
Klkb1 G A 8: 45,728,515 (GRCm39) Q415* probably null Het
L1td1 A G 4: 98,624,699 (GRCm39) D298G possibly damaging Het
L2hgdh C T 12: 69,749,131 (GRCm39) R252Q probably benign Het
Lipc C G 9: 70,709,390 (GRCm39) K452N probably benign Het
Lrp10 C A 14: 54,705,621 (GRCm39) S270R probably damaging Het
Ly6e T G 15: 74,829,649 (GRCm39) L14R probably benign Het
Mast3 T C 8: 71,242,330 (GRCm39) D90G possibly damaging Het
Mrgpra2b A T 7: 47,114,518 (GRCm39) N71K probably benign Het
Nbea C A 3: 55,550,157 (GRCm39) probably null Het
Ndufb10 A G 17: 24,943,159 (GRCm39) probably null Het
Ndufb9 C T 15: 58,811,151 (GRCm39) P146S probably benign Het
Nhsl1 T C 10: 18,407,030 (GRCm39) V1388A probably damaging Het
Nomo1 C A 7: 45,732,748 (GRCm39) D1170E probably benign Het
Nop2 G T 6: 125,114,391 (GRCm39) R254L probably benign Het
Nup160 A T 2: 90,514,429 (GRCm39) T126S probably benign Het
Opa1 A G 16: 29,437,053 (GRCm39) D654G probably damaging Het
Or1j15 T C 2: 36,459,345 (GRCm39) L245P probably damaging Het
Or2j6 A T 7: 139,980,547 (GRCm39) C137* probably null Het
Or51h1 A G 7: 102,308,964 (GRCm39) K312R probably benign Het
Or52e8b C T 7: 104,673,910 (GRCm39) W92* probably null Het
Or5aq1b A G 2: 86,902,299 (GRCm39) Y60H probably damaging Het
Or5p68 A G 7: 107,945,958 (GRCm39) S77P probably damaging Het
Or8b52 A G 9: 38,576,711 (GRCm39) L143P probably damaging Het
Or8k18 A G 2: 86,085,380 (GRCm39) M219T probably benign Het
Osbp2 T A 11: 3,667,976 (GRCm39) D7V probably damaging Het
Osr2 A T 15: 35,301,010 (GRCm39) I189F probably damaging Het
Pdlim5 A G 3: 142,058,594 (GRCm39) V50A possibly damaging Het
Pik3r3 A G 4: 116,148,931 (GRCm39) N334S probably benign Het
Plk5 C G 10: 80,193,830 (GRCm39) R40G probably damaging Het
Ppfia4 A G 1: 134,240,326 (GRCm39) I889T probably damaging Het
Prpf38b T C 3: 108,811,657 (GRCm39) K403E unknown Het
Rgs20 T G 1: 4,994,190 (GRCm39) E31A possibly damaging Het
Rpl11 A T 4: 135,780,000 (GRCm39) M12K possibly damaging Het
Rreb1 C A 13: 38,115,644 (GRCm39) T1001K probably benign Het
Ruvbl1 A G 6: 88,474,355 (GRCm39) K453E probably benign Het
Sdc4 A T 2: 164,270,959 (GRCm39) V100D probably benign Het
Simc1 C A 13: 54,672,147 (GRCm39) T165K probably benign Het
Slc2a3 A G 6: 122,717,408 (GRCm39) V16A probably benign Het
Smbd1 A T 16: 32,627,130 (GRCm39) S53T possibly damaging Het
Smndc1 A T 19: 53,372,074 (GRCm39) N113K possibly damaging Het
Tas2r139 T G 6: 42,118,168 (GRCm39) F100C probably damaging Het
Tubgcp5 A G 7: 55,467,106 (GRCm39) Y692C probably damaging Het
Ube2d2a T C 18: 35,933,197 (GRCm39) I78T probably benign Het
Ugt2b37 C T 5: 87,401,996 (GRCm39) V212I probably benign Het
Wars2 A G 3: 99,124,063 (GRCm39) D308G possibly damaging Het
Yeats2 G A 16: 20,030,500 (GRCm39) probably null Het
Zfp385a G T 15: 103,224,318 (GRCm39) H219N possibly damaging Het
Zfp407 T C 18: 84,227,982 (GRCm39) T1876A probably damaging Het
Other mutations in Mmp27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Mmp27 APN 9 7,573,505 (GRCm39) splice site probably benign
IGL00656:Mmp27 APN 9 7,581,383 (GRCm39) missense possibly damaging 0.80
IGL00937:Mmp27 APN 9 7,578,900 (GRCm39) critical splice acceptor site probably benign 0.00
IGL01101:Mmp27 APN 9 7,573,416 (GRCm39) missense probably damaging 1.00
IGL01134:Mmp27 APN 9 7,573,298 (GRCm39) missense probably benign 0.06
IGL01631:Mmp27 APN 9 7,573,289 (GRCm39) critical splice acceptor site probably benign 0.00
IGL02967:Mmp27 APN 9 7,571,591 (GRCm39) missense probably benign 0.03
IGL03024:Mmp27 APN 9 7,581,377 (GRCm39) missense probably benign 0.17
R0662:Mmp27 UTSW 9 7,577,651 (GRCm39) missense probably benign 0.00
R0715:Mmp27 UTSW 9 7,581,156 (GRCm39) splice site probably benign
R0826:Mmp27 UTSW 9 7,579,010 (GRCm39) missense probably damaging 1.00
R1191:Mmp27 UTSW 9 7,579,067 (GRCm39) splice site probably null
R1793:Mmp27 UTSW 9 7,571,459 (GRCm39) start codon destroyed probably null 0.00
R1983:Mmp27 UTSW 9 7,578,898 (GRCm39) splice site probably null
R2074:Mmp27 UTSW 9 7,577,740 (GRCm39) missense possibly damaging 0.50
R2172:Mmp27 UTSW 9 7,577,379 (GRCm39) nonsense probably null
R2445:Mmp27 UTSW 9 7,581,182 (GRCm39) missense probably benign 0.12
R2961:Mmp27 UTSW 9 7,573,603 (GRCm39) missense probably damaging 1.00
R4825:Mmp27 UTSW 9 7,581,195 (GRCm39) missense probably damaging 1.00
R4888:Mmp27 UTSW 9 7,581,369 (GRCm39) missense probably benign 0.00
R4938:Mmp27 UTSW 9 7,578,983 (GRCm39) missense probably damaging 0.97
R5095:Mmp27 UTSW 9 7,579,001 (GRCm39) missense probably damaging 1.00
R5095:Mmp27 UTSW 9 7,572,159 (GRCm39) missense probably damaging 1.00
R5121:Mmp27 UTSW 9 7,581,369 (GRCm39) missense probably benign 0.00
R5446:Mmp27 UTSW 9 7,573,516 (GRCm39) splice site probably benign
R5485:Mmp27 UTSW 9 7,573,363 (GRCm39) missense probably damaging 1.00
R5516:Mmp27 UTSW 9 7,579,063 (GRCm39) missense probably null 1.00
R6682:Mmp27 UTSW 9 7,573,606 (GRCm39) missense probably benign 0.02
R6712:Mmp27 UTSW 9 7,572,177 (GRCm39) missense probably damaging 1.00
R6737:Mmp27 UTSW 9 7,571,955 (GRCm39) missense possibly damaging 0.78
R7282:Mmp27 UTSW 9 7,578,231 (GRCm39) missense probably damaging 0.98
R7368:Mmp27 UTSW 9 7,577,318 (GRCm39) missense probably damaging 1.00
R7689:Mmp27 UTSW 9 7,579,002 (GRCm39) missense probably damaging 1.00
R8006:Mmp27 UTSW 9 7,578,985 (GRCm39) missense probably damaging 0.97
R8185:Mmp27 UTSW 9 7,573,492 (GRCm39) missense unknown
R8537:Mmp27 UTSW 9 7,579,776 (GRCm39) missense probably benign 0.00
R9039:Mmp27 UTSW 9 7,581,250 (GRCm39) missense probably benign 0.01
R9188:Mmp27 UTSW 9 7,579,792 (GRCm39) missense possibly damaging 0.55
R9280:Mmp27 UTSW 9 7,579,812 (GRCm39) missense probably benign 0.09
R9367:Mmp27 UTSW 9 7,573,550 (GRCm39) missense probably damaging 1.00
X0021:Mmp27 UTSW 9 7,573,299 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTGTTTCTCTCTACCAGGCC -3'
(R):5'- CAGTTTAGCACTTGTTGGCTCAG -3'

Sequencing Primer
(F):5'- GCTGCTTGACTCTAAACTAGGCAG -3'
(R):5'- CAGTTTGAGAATGTCTACAGGGG -3'
Posted On 2021-12-30