Incidental Mutation 'R9087:Mmp27'
ID 690695
Institutional Source Beutler Lab
Gene Symbol Mmp27
Ensembl Gene ENSMUSG00000070323
Gene Name matrix metallopeptidase 27
Synonyms LOC234911
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock # R9087 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 7571396-7581885 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 7579857 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 444 (F444S)
Ref Sequence ENSEMBL: ENSMUSP00000113231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120900] [ENSMUST00000151853]
AlphaFold D3YV89
Predicted Effect probably damaging
Transcript: ENSMUST00000120900
AA Change: F444S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113231
Gene: ENSMUSG00000070323
AA Change: F444S

DomainStartEndE-ValueType
Pfam:PG_binding_1 40 100 1e-13 PFAM
ZnMc 116 277 1.76e-50 SMART
HX 300 342 5.97e-4 SMART
HX 344 386 1.1e-7 SMART
HX 391 438 1.09e-6 SMART
HX 440 480 3.2e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000151853
AA Change: F470S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117469
Gene: ENSMUSG00000070323
AA Change: F470S

DomainStartEndE-ValueType
Pfam:PG_binding_1 40 100 1.1e-13 PFAM
ZnMc 116 303 1.81e-43 SMART
HX 326 368 5.97e-4 SMART
HX 370 412 1.1e-7 SMART
HX 417 464 1.09e-6 SMART
HX 466 506 3.2e-4 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000116263
Gene: ENSMUSG00000070323
AA Change: F388S

DomainStartEndE-ValueType
Pfam:PG_binding_1 39 99 1.1e-13 PFAM
ZnMc 115 295 1.41e-13 SMART
HX 245 287 5.97e-4 SMART
HX 289 331 1.1e-7 SMART
HX 336 383 1.09e-6 SMART
HX 385 425 3.2e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins of the matrix metalloproteinase (MMP) family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. Most MMP's are secreted as inactive proproteins which are activated when cleaved by extracellular proteinases. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars A G 8: 111,041,537 D180G probably damaging Het
Abcb6 A T 1: 75,173,567 I649K probably damaging Het
Ace T C 11: 105,981,919 F969S probably damaging Het
Ankrd26 A G 6: 118,559,269 probably null Het
Apobec1 A T 6: 122,581,741 L9* probably null Het
Atp13a1 A G 8: 69,803,807 D865G probably damaging Het
Barhl1 T C 2: 28,915,219 Y154C probably damaging Het
Bbx T C 16: 50,274,635 D106G probably damaging Het
Cacna1a G A 8: 84,638,803 A2192T probably benign Het
Cacnb1 T C 11: 98,003,007 N563S possibly damaging Het
Capn5 A T 7: 98,126,324 I470N probably damaging Het
Cd300c T C 11: 114,959,765 T71A probably damaging Het
Celf4 T A 18: 25,504,270 S223C probably damaging Het
Cftr A C 6: 18,214,181 I119L possibly damaging Het
Cmya5 T C 13: 93,097,203 E459G possibly damaging Het
Cntn2 A G 1: 132,525,370 Y395H probably damaging Het
Cntnap3 T C 13: 64,751,718 D987G probably damaging Het
Col5a2 T A 1: 45,442,658 D102V unknown Het
Cpeb2 T C 5: 43,281,118 F812L Het
Cpsf3 T A 12: 21,308,994 L565Q probably damaging Het
Ctnnd1 A C 2: 84,609,578 L796R probably damaging Het
Dach1 A G 14: 98,168,831 L160P probably benign Het
Dennd1a A C 2: 38,021,354 probably null Het
Dnah12 T C 14: 26,824,546 I2431T probably damaging Het
Ep400 A T 5: 110,667,564 Y2887* probably null Het
Erich1 T C 8: 14,033,623 D149G probably damaging Het
Fut2 T C 7: 45,651,069 N93S probably damaging Het
Gba2 C T 4: 43,568,304 A688T probably benign Het
Gcm2 C G 13: 41,109,930 E9Q Het
Gfod1 T C 13: 43,200,362 E379G probably damaging Het
Gfod2 A G 8: 105,728,219 F10L probably damaging Het
Gm4871 T G 5: 145,032,278 H75P possibly damaging Het
Gtpbp3 T A 8: 71,492,355 V418E probably benign Het
Hif1a T A 12: 73,942,325 I688K probably benign Het
Ifi44 G T 3: 151,745,880 S196R probably damaging Het
Igfn1 T C 1: 135,974,868 probably null Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kl A G 5: 150,988,492 K569E probably benign Het
Klkb1 G A 8: 45,275,478 Q415* probably null Het
L1td1 A G 4: 98,736,462 D298G possibly damaging Het
L2hgdh C T 12: 69,702,357 R252Q probably benign Het
Lipc C G 9: 70,802,108 K452N probably benign Het
Lrp10 C A 14: 54,468,164 S270R probably damaging Het
Ly6e T G 15: 74,957,800 L14R probably benign Het
Mast3 T C 8: 70,789,686 D90G possibly damaging Het
Mrgpra2b A T 7: 47,464,770 N71K probably benign Het
Nbea C A 3: 55,642,736 probably null Het
Ndufb10 A G 17: 24,724,185 probably null Het
Ndufb9 C T 15: 58,939,302 P146S probably benign Het
Nhsl1 T C 10: 18,531,282 V1388A probably damaging Het
Nomo1 C A 7: 46,083,324 D1170E probably benign Het
Nop2 G T 6: 125,137,428 R254L probably benign Het
Nup160 A T 2: 90,684,085 T126S probably benign Het
Olfr1049 A G 2: 86,255,036 M219T probably benign Het
Olfr1107 A G 2: 87,071,955 Y60H probably damaging Het
Olfr344 T C 2: 36,569,333 L245P probably damaging Het
Olfr493 A G 7: 108,346,751 S77P probably damaging Het
Olfr531 A T 7: 140,400,634 C137* probably null Het
Olfr555 A G 7: 102,659,757 K312R probably benign Het
Olfr675 C T 7: 105,024,703 W92* probably null Het
Olfr917 A G 9: 38,665,415 L143P probably damaging Het
Opa1 A G 16: 29,618,235 D654G probably damaging Het
Osbp2 T A 11: 3,717,976 D7V probably damaging Het
Osr2 A T 15: 35,300,864 I189F probably damaging Het
Pdlim5 A G 3: 142,352,833 V50A possibly damaging Het
Pik3r3 A G 4: 116,291,734 N334S probably benign Het
Plk5 C G 10: 80,357,996 R40G probably damaging Het
Ppfia4 A G 1: 134,312,588 I889T probably damaging Het
Prpf38b T C 3: 108,904,341 K403E unknown Het
Rgs20 T G 1: 4,923,967 E31A possibly damaging Het
Rpl11 A T 4: 136,052,689 M12K possibly damaging Het
Rreb1 C A 13: 37,931,668 T1001K probably benign Het
Ruvbl1 A G 6: 88,497,373 K453E probably benign Het
Sdc4 A T 2: 164,429,039 V100D probably benign Het
Simc1 C A 13: 54,524,334 T165K probably benign Het
Slc2a3 A G 6: 122,740,449 V16A probably benign Het
Smbd1 A T 16: 32,806,760 S53T possibly damaging Het
Smndc1 A T 19: 53,383,643 N113K possibly damaging Het
Tas2r139 T G 6: 42,141,234 F100C probably damaging Het
Tubgcp5 A G 7: 55,817,358 Y692C probably damaging Het
Ube2d2a T C 18: 35,800,144 I78T probably benign Het
Ugt2b37 C T 5: 87,254,137 V212I probably benign Het
Wars2 A G 3: 99,216,747 D308G possibly damaging Het
Yeats2 G A 16: 20,211,750 probably null Het
Zfp385a G T 15: 103,315,891 H219N possibly damaging Het
Zfp407 T C 18: 84,209,857 T1876A probably damaging Het
Other mutations in Mmp27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Mmp27 APN 9 7573504 splice site probably benign
IGL00656:Mmp27 APN 9 7581382 missense possibly damaging 0.80
IGL00937:Mmp27 APN 9 7578899 critical splice acceptor site probably benign 0.00
IGL01101:Mmp27 APN 9 7573415 missense probably damaging 1.00
IGL01134:Mmp27 APN 9 7573297 missense probably benign 0.06
IGL01631:Mmp27 APN 9 7573288 critical splice acceptor site probably benign 0.00
IGL02967:Mmp27 APN 9 7571590 missense probably benign 0.03
IGL03024:Mmp27 APN 9 7581376 missense probably benign 0.17
R0662:Mmp27 UTSW 9 7577650 missense probably benign 0.00
R0715:Mmp27 UTSW 9 7581155 splice site probably benign
R0826:Mmp27 UTSW 9 7579009 missense probably damaging 1.00
R1191:Mmp27 UTSW 9 7579066 splice site probably null
R1793:Mmp27 UTSW 9 7571458 start codon destroyed probably null 0.00
R1983:Mmp27 UTSW 9 7578897 splice site probably null
R2074:Mmp27 UTSW 9 7577739 missense possibly damaging 0.50
R2172:Mmp27 UTSW 9 7577378 nonsense probably null
R2445:Mmp27 UTSW 9 7581181 missense probably benign 0.12
R2961:Mmp27 UTSW 9 7573602 missense probably damaging 1.00
R4825:Mmp27 UTSW 9 7581194 missense probably damaging 1.00
R4888:Mmp27 UTSW 9 7581368 missense probably benign 0.00
R4938:Mmp27 UTSW 9 7578982 missense probably damaging 0.97
R5095:Mmp27 UTSW 9 7572158 missense probably damaging 1.00
R5095:Mmp27 UTSW 9 7579000 missense probably damaging 1.00
R5121:Mmp27 UTSW 9 7581368 missense probably benign 0.00
R5446:Mmp27 UTSW 9 7573515 splice site probably benign
R5485:Mmp27 UTSW 9 7573362 missense probably damaging 1.00
R5516:Mmp27 UTSW 9 7579062 missense probably null 1.00
R6682:Mmp27 UTSW 9 7573605 missense probably benign 0.02
R6712:Mmp27 UTSW 9 7572176 missense probably damaging 1.00
R6737:Mmp27 UTSW 9 7571954 missense possibly damaging 0.78
R7282:Mmp27 UTSW 9 7578230 missense probably damaging 0.98
R7368:Mmp27 UTSW 9 7577317 missense probably damaging 1.00
R7689:Mmp27 UTSW 9 7579001 missense probably damaging 1.00
R8006:Mmp27 UTSW 9 7578984 missense probably damaging 0.97
R8185:Mmp27 UTSW 9 7573491 missense unknown
R8537:Mmp27 UTSW 9 7579775 missense probably benign 0.00
R9039:Mmp27 UTSW 9 7581249 missense probably benign 0.01
R9188:Mmp27 UTSW 9 7579791 missense possibly damaging 0.55
R9280:Mmp27 UTSW 9 7579811 missense probably benign 0.09
R9367:Mmp27 UTSW 9 7573549 missense probably damaging 1.00
X0021:Mmp27 UTSW 9 7573298 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTGTTTCTCTCTACCAGGCC -3'
(R):5'- CAGTTTAGCACTTGTTGGCTCAG -3'

Sequencing Primer
(F):5'- GCTGCTTGACTCTAAACTAGGCAG -3'
(R):5'- CAGTTTGAGAATGTCTACAGGGG -3'
Posted On 2021-12-30