Incidental Mutation 'R9087:Cntnap3'
ID 690711
Institutional Source Beutler Lab
Gene Symbol Cntnap3
Ensembl Gene ENSMUSG00000033063
Gene Name contactin associated protein-like 3
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock # R9087 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 64736182-64903955 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 64751718 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 987 (D987G)
Ref Sequence ENSEMBL: ENSMUSP00000089140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091554]
AlphaFold E9PY62
Predicted Effect probably damaging
Transcript: ENSMUST00000091554
AA Change: D987G

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000089140
Gene: ENSMUSG00000033063
AA Change: D987G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
FA58C 33 180 4.88e-17 SMART
LamG 207 345 1.47e-11 SMART
LamG 394 525 1.43e-23 SMART
EGF 553 587 1.33e-1 SMART
FBG 590 775 6.76e-1 SMART
LamG 815 942 1.89e-32 SMART
EGF_like 963 999 6.28e1 SMART
LamG 1040 1178 9.46e-15 SMART
transmembrane domain 1245 1267 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NCP family of cell-recognition molecules. This family represents a distinct subgroup of the neurexins. NCP proteins mediate neuron-glial interactions in vertebrates and glial-glial contact in invertebrates. The protein encoded by this gene may play a role in cell recognition within the nervous system. Alternatively spliced transcript variants encoding different isoforms have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars A G 8: 111,041,537 D180G probably damaging Het
Abcb6 A T 1: 75,173,567 I649K probably damaging Het
Ace T C 11: 105,981,919 F969S probably damaging Het
Ankrd26 A G 6: 118,559,269 probably null Het
Apobec1 A T 6: 122,581,741 L9* probably null Het
Atp13a1 A G 8: 69,803,807 D865G probably damaging Het
Barhl1 T C 2: 28,915,219 Y154C probably damaging Het
Bbx T C 16: 50,274,635 D106G probably damaging Het
Cacna1a G A 8: 84,638,803 A2192T probably benign Het
Cacnb1 T C 11: 98,003,007 N563S possibly damaging Het
Capn5 A T 7: 98,126,324 I470N probably damaging Het
Cd300c T C 11: 114,959,765 T71A probably damaging Het
Celf4 T A 18: 25,504,270 S223C probably damaging Het
Cftr A C 6: 18,214,181 I119L possibly damaging Het
Cmya5 T C 13: 93,097,203 E459G possibly damaging Het
Cntn2 A G 1: 132,525,370 Y395H probably damaging Het
Col5a2 T A 1: 45,442,658 D102V unknown Het
Cpeb2 T C 5: 43,281,118 F812L Het
Cpsf3 T A 12: 21,308,994 L565Q probably damaging Het
Ctnnd1 A C 2: 84,609,578 L796R probably damaging Het
Dach1 A G 14: 98,168,831 L160P probably benign Het
Dennd1a A C 2: 38,021,354 probably null Het
Dnah12 T C 14: 26,824,546 I2431T probably damaging Het
Ep400 A T 5: 110,667,564 Y2887* probably null Het
Erich1 T C 8: 14,033,623 D149G probably damaging Het
Fut2 T C 7: 45,651,069 N93S probably damaging Het
Gba2 C T 4: 43,568,304 A688T probably benign Het
Gcm2 C G 13: 41,109,930 E9Q Het
Gfod1 T C 13: 43,200,362 E379G probably damaging Het
Gfod2 A G 8: 105,728,219 F10L probably damaging Het
Gm4871 T G 5: 145,032,278 H75P possibly damaging Het
Gtpbp3 T A 8: 71,492,355 V418E probably benign Het
Hif1a T A 12: 73,942,325 I688K probably benign Het
Ifi44 G T 3: 151,745,880 S196R probably damaging Het
Igfn1 T C 1: 135,974,868 probably null Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kl A G 5: 150,988,492 K569E probably benign Het
Klkb1 G A 8: 45,275,478 Q415* probably null Het
L1td1 A G 4: 98,736,462 D298G possibly damaging Het
L2hgdh C T 12: 69,702,357 R252Q probably benign Het
Lipc C G 9: 70,802,108 K452N probably benign Het
Lrp10 C A 14: 54,468,164 S270R probably damaging Het
Ly6e T G 15: 74,957,800 L14R probably benign Het
Mast3 T C 8: 70,789,686 D90G possibly damaging Het
Mmp27 T C 9: 7,579,857 F444S probably damaging Het
Mrgpra2b A T 7: 47,464,770 N71K probably benign Het
Nbea C A 3: 55,642,736 probably null Het
Ndufb10 A G 17: 24,724,185 probably null Het
Ndufb9 C T 15: 58,939,302 P146S probably benign Het
Nhsl1 T C 10: 18,531,282 V1388A probably damaging Het
Nomo1 C A 7: 46,083,324 D1170E probably benign Het
Nop2 G T 6: 125,137,428 R254L probably benign Het
Nup160 A T 2: 90,684,085 T126S probably benign Het
Olfr1049 A G 2: 86,255,036 M219T probably benign Het
Olfr1107 A G 2: 87,071,955 Y60H probably damaging Het
Olfr344 T C 2: 36,569,333 L245P probably damaging Het
Olfr493 A G 7: 108,346,751 S77P probably damaging Het
Olfr531 A T 7: 140,400,634 C137* probably null Het
Olfr555 A G 7: 102,659,757 K312R probably benign Het
Olfr675 C T 7: 105,024,703 W92* probably null Het
Olfr917 A G 9: 38,665,415 L143P probably damaging Het
Opa1 A G 16: 29,618,235 D654G probably damaging Het
Osbp2 T A 11: 3,717,976 D7V probably damaging Het
Osr2 A T 15: 35,300,864 I189F probably damaging Het
Pdlim5 A G 3: 142,352,833 V50A possibly damaging Het
Pik3r3 A G 4: 116,291,734 N334S probably benign Het
Plk5 C G 10: 80,357,996 R40G probably damaging Het
Ppfia4 A G 1: 134,312,588 I889T probably damaging Het
Prpf38b T C 3: 108,904,341 K403E unknown Het
Rgs20 T G 1: 4,923,967 E31A possibly damaging Het
Rpl11 A T 4: 136,052,689 M12K possibly damaging Het
Rreb1 C A 13: 37,931,668 T1001K probably benign Het
Ruvbl1 A G 6: 88,497,373 K453E probably benign Het
Sdc4 A T 2: 164,429,039 V100D probably benign Het
Simc1 C A 13: 54,524,334 T165K probably benign Het
Slc2a3 A G 6: 122,740,449 V16A probably benign Het
Smbd1 A T 16: 32,806,760 S53T possibly damaging Het
Smndc1 A T 19: 53,383,643 N113K possibly damaging Het
Tas2r139 T G 6: 42,141,234 F100C probably damaging Het
Tubgcp5 A G 7: 55,817,358 Y692C probably damaging Het
Ube2d2a T C 18: 35,800,144 I78T probably benign Het
Ugt2b37 C T 5: 87,254,137 V212I probably benign Het
Wars2 A G 3: 99,216,747 D308G possibly damaging Het
Yeats2 G A 16: 20,211,750 probably null Het
Zfp385a G T 15: 103,315,891 H219N possibly damaging Het
Zfp407 T C 18: 84,209,857 T1876A probably damaging Het
Other mutations in Cntnap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Cntnap3 APN 13 64772731 missense probably damaging 1.00
IGL00782:Cntnap3 APN 13 64745805 splice site probably benign
IGL00976:Cntnap3 APN 13 64794352 missense probably damaging 1.00
IGL01319:Cntnap3 APN 13 64787837 missense probably damaging 1.00
IGL01610:Cntnap3 APN 13 64757301 missense probably damaging 0.98
IGL01861:Cntnap3 APN 13 64799108 missense probably damaging 1.00
IGL02127:Cntnap3 APN 13 64799064 splice site probably benign
IGL02133:Cntnap3 APN 13 64751673 splice site probably benign
IGL02251:Cntnap3 APN 13 64762036 missense probably damaging 1.00
IGL02272:Cntnap3 APN 13 64757411 missense probably damaging 1.00
IGL02370:Cntnap3 APN 13 64751751 missense probably benign
IGL02456:Cntnap3 APN 13 64799058 splice site probably benign
IGL02589:Cntnap3 APN 13 64792430 missense probably benign 0.08
IGL02695:Cntnap3 APN 13 64772132 missense probably benign 0.01
IGL02850:Cntnap3 APN 13 64757409 missense probably damaging 1.00
IGL03038:Cntnap3 APN 13 64741025 missense possibly damaging 0.50
IGL03188:Cntnap3 APN 13 64781745 missense probably damaging 0.97
IGL03327:Cntnap3 APN 13 64887768 nonsense probably null
PIT4480001:Cntnap3 UTSW 13 64757210 missense probably damaging 1.00
R0309:Cntnap3 UTSW 13 64757436 splice site probably benign
R0422:Cntnap3 UTSW 13 64757285 missense probably damaging 0.96
R0463:Cntnap3 UTSW 13 64778876 missense probably damaging 1.00
R0491:Cntnap3 UTSW 13 64762045 missense probably benign 0.01
R0499:Cntnap3 UTSW 13 64858678 missense probably benign 0.33
R0550:Cntnap3 UTSW 13 64762000 missense possibly damaging 0.86
R0613:Cntnap3 UTSW 13 64758414 missense probably damaging 1.00
R0666:Cntnap3 UTSW 13 64757397 missense probably damaging 1.00
R0840:Cntnap3 UTSW 13 64787910 missense possibly damaging 0.94
R1577:Cntnap3 UTSW 13 64758290 missense probably damaging 1.00
R1716:Cntnap3 UTSW 13 64762002 missense probably damaging 1.00
R1732:Cntnap3 UTSW 13 64740812 critical splice donor site probably null
R1739:Cntnap3 UTSW 13 64740592 missense probably benign 0.17
R1905:Cntnap3 UTSW 13 64903764 missense probably benign 0.04
R1988:Cntnap3 UTSW 13 64758390 missense probably damaging 1.00
R2086:Cntnap3 UTSW 13 64794262 missense possibly damaging 0.76
R3732:Cntnap3 UTSW 13 64740999 missense possibly damaging 0.73
R3808:Cntnap3 UTSW 13 64781804 missense probably damaging 0.96
R3809:Cntnap3 UTSW 13 64781804 missense probably damaging 0.96
R4384:Cntnap3 UTSW 13 64748460 missense probably damaging 1.00
R4433:Cntnap3 UTSW 13 64778853 missense possibly damaging 0.92
R4631:Cntnap3 UTSW 13 64778883 missense probably benign 0.04
R4645:Cntnap3 UTSW 13 64778788 critical splice donor site probably null
R4702:Cntnap3 UTSW 13 64778862 missense probably benign 0.17
R4876:Cntnap3 UTSW 13 64787706 missense probably benign 0.00
R4994:Cntnap3 UTSW 13 64761984 missense possibly damaging 0.55
R5043:Cntnap3 UTSW 13 64794348 missense probably damaging 1.00
R5214:Cntnap3 UTSW 13 64762010 missense probably damaging 1.00
R5403:Cntnap3 UTSW 13 64761978 missense possibly damaging 0.90
R5571:Cntnap3 UTSW 13 64903758 missense probably damaging 0.98
R5587:Cntnap3 UTSW 13 64746738 missense probably damaging 1.00
R5695:Cntnap3 UTSW 13 64787955 missense probably damaging 0.99
R5834:Cntnap3 UTSW 13 64748577 missense probably benign 0.07
R5892:Cntnap3 UTSW 13 64799180 missense probably damaging 1.00
R5950:Cntnap3 UTSW 13 64787769 missense probably damaging 1.00
R6526:Cntnap3 UTSW 13 64781888 missense possibly damaging 0.96
R6954:Cntnap3 UTSW 13 64748559 missense probably benign 0.00
R7138:Cntnap3 UTSW 13 64781725 critical splice donor site probably null
R7355:Cntnap3 UTSW 13 64771962 missense probably benign
R7425:Cntnap3 UTSW 13 64758252 missense probably damaging 1.00
R7521:Cntnap3 UTSW 13 64772001 missense probably benign 0.22
R7719:Cntnap3 UTSW 13 64772777 nonsense probably null
R7810:Cntnap3 UTSW 13 64793308 missense possibly damaging 0.73
R7871:Cntnap3 UTSW 13 64903773 missense probably benign 0.00
R8259:Cntnap3 UTSW 13 64787867 missense probably damaging 0.99
R8415:Cntnap3 UTSW 13 64738665 missense probably benign 0.31
R8491:Cntnap3 UTSW 13 64785343 missense probably damaging 1.00
R9086:Cntnap3 UTSW 13 64781759 missense probably damaging 1.00
R9398:Cntnap3 UTSW 13 64903834 missense probably benign 0.41
Z1176:Cntnap3 UTSW 13 64740872 frame shift probably null
Z1176:Cntnap3 UTSW 13 64792388 missense probably damaging 0.98
Z1177:Cntnap3 UTSW 13 64781892 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCAGAGAAGGTTGATCTATGAAAC -3'
(R):5'- TGCAGTGCTTCCCTTGTAGG -3'

Sequencing Primer
(F):5'- GGTTGATCTATGAAACAGCCTTAG -3'
(R):5'- CAGAAGGGCTTCCTGGGATGTATC -3'
Posted On 2021-12-30