Mutagenetix > Incidental Mutation

Incidental Mutation 'R9087:Cntnap3'

690711

Institutional Source

Beutler Lab

Gene Symbol

Cntnap3

Ensembl Gene

ENSMUSG00000033063

Gene Name

contactin associated protein-like 3

Synonyms

MMRRC Submission

068906-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.076) question?

Stock #

R9087 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

64736182-64903955 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 64751718 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 987 (D987G)

Ref Sequence

ENSEMBL: ENSMUSP00000089140 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091554]

AlphaFold

E9PY62

Predicted Effect

probably damaging
Transcript: ENSMUST00000091554
AA Change: D987G

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000089140
Gene: ENSMUSG00000033063
AA Change: D987G

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
FA58C	33	180	4.88e-17	SMART
LamG	207	345	1.47e-11	SMART
LamG	394	525	1.43e-23	SMART
EGF	553	587	1.33e-1	SMART
FBG	590	775	6.76e-1	SMART
LamG	815	942	1.89e-32	SMART
EGF_like	963	999	6.28e1	SMART
LamG	1040	1178	9.46e-15	SMART
transmembrane domain	1245	1267	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NCP family of cell-recognition molecules. This family represents a distinct subgroup of the neurexins. NCP proteins mediate neuron-glial interactions in vertebrates and glial-glial contact in invertebrates. The protein encoded by this gene may play a role in cell recognition within the nervous system. Alternatively spliced transcript variants encoding different isoforms have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aars	A	G	8: 111,041,537	D180G	probably damaging	Het
Abcb6	A	T	1: 75,173,567	I649K	probably damaging	Het
Ace	T	C	11: 105,981,919	F969S	probably damaging	Het
Ankrd26	A	G	6: 118,559,269		probably null	Het
Apobec1	A	T	6: 122,581,741	L9*	probably null	Het
Atp13a1	A	G	8: 69,803,807	D865G	probably damaging	Het
Barhl1	T	C	2: 28,915,219	Y154C	probably damaging	Het
Bbx	T	C	16: 50,274,635	D106G	probably damaging	Het
Cacna1a	G	A	8: 84,638,803	A2192T	probably benign	Het
Cacnb1	T	C	11: 98,003,007	N563S	possibly damaging	Het
Capn5	A	T	7: 98,126,324	I470N	probably damaging	Het
Cd300c	T	C	11: 114,959,765	T71A	probably damaging	Het
Celf4	T	A	18: 25,504,270	S223C	probably damaging	Het
Cftr	A	C	6: 18,214,181	I119L	possibly damaging	Het
Cmya5	T	C	13: 93,097,203	E459G	possibly damaging	Het
Cntn2	A	G	1: 132,525,370	Y395H	probably damaging	Het
Col5a2	T	A	1: 45,442,658	D102V	unknown	Het
Cpeb2	T	C	5: 43,281,118	F812L		Het
Cpsf3	T	A	12: 21,308,994	L565Q	probably damaging	Het
Ctnnd1	A	C	2: 84,609,578	L796R	probably damaging	Het
Dach1	A	G	14: 98,168,831	L160P	probably benign	Het
Dennd1a	A	C	2: 38,021,354		probably null	Het
Dnah12	T	C	14: 26,824,546	I2431T	probably damaging	Het
Ep400	A	T	5: 110,667,564	Y2887*	probably null	Het
Erich1	T	C	8: 14,033,623	D149G	probably damaging	Het
Fut2	T	C	7: 45,651,069	N93S	probably damaging	Het
Gba2	C	T	4: 43,568,304	A688T	probably benign	Het
Gcm2	C	G	13: 41,109,930	E9Q		Het
Gfod1	T	C	13: 43,200,362	E379G	probably damaging	Het
Gfod2	A	G	8: 105,728,219	F10L	probably damaging	Het
Gm4871	T	G	5: 145,032,278	H75P	possibly damaging	Het
Gtpbp3	T	A	8: 71,492,355	V418E	probably benign	Het
Hif1a	T	A	12: 73,942,325	I688K	probably benign	Het
Ifi44	G	T	3: 151,745,880	S196R	probably damaging	Het
Igfn1	T	C	1: 135,974,868		probably null	Het
Itpr3	G	A	17: 27,118,677		probably benign	Het
Kl	A	G	5: 150,988,492	K569E	probably benign	Het
Klkb1	G	A	8: 45,275,478	Q415*	probably null	Het
L1td1	A	G	4: 98,736,462	D298G	possibly damaging	Het
L2hgdh	C	T	12: 69,702,357	R252Q	probably benign	Het
Lipc	C	G	9: 70,802,108	K452N	probably benign	Het
Lrp10	C	A	14: 54,468,164	S270R	probably damaging	Het
Ly6e	T	G	15: 74,957,800	L14R	probably benign	Het
Mast3	T	C	8: 70,789,686	D90G	possibly damaging	Het
Mmp27	T	C	9: 7,579,857	F444S	probably damaging	Het
Mrgpra2b	A	T	7: 47,464,770	N71K	probably benign	Het
Nbea	C	A	3: 55,642,736		probably null	Het
Ndufb10	A	G	17: 24,724,185		probably null	Het
Ndufb9	C	T	15: 58,939,302	P146S	probably benign	Het
Nhsl1	T	C	10: 18,531,282	V1388A	probably damaging	Het
Nomo1	C	A	7: 46,083,324	D1170E	probably benign	Het
Nop2	G	T	6: 125,137,428	R254L	probably benign	Het
Nup160	A	T	2: 90,684,085	T126S	probably benign	Het
Olfr1049	A	G	2: 86,255,036	M219T	probably benign	Het
Olfr1107	A	G	2: 87,071,955	Y60H	probably damaging	Het
Olfr344	T	C	2: 36,569,333	L245P	probably damaging	Het
Olfr493	A	G	7: 108,346,751	S77P	probably damaging	Het
Olfr531	A	T	7: 140,400,634	C137*	probably null	Het
Olfr555	A	G	7: 102,659,757	K312R	probably benign	Het
Olfr675	C	T	7: 105,024,703	W92*	probably null	Het
Olfr917	A	G	9: 38,665,415	L143P	probably damaging	Het
Opa1	A	G	16: 29,618,235	D654G	probably damaging	Het
Osbp2	T	A	11: 3,717,976	D7V	probably damaging	Het
Osr2	A	T	15: 35,300,864	I189F	probably damaging	Het
Pdlim5	A	G	3: 142,352,833	V50A	possibly damaging	Het
Pik3r3	A	G	4: 116,291,734	N334S	probably benign	Het
Plk5	C	G	10: 80,357,996	R40G	probably damaging	Het
Ppfia4	A	G	1: 134,312,588	I889T	probably damaging	Het
Prpf38b	T	C	3: 108,904,341	K403E	unknown	Het
Rgs20	T	G	1: 4,923,967	E31A	possibly damaging	Het
Rpl11	A	T	4: 136,052,689	M12K	possibly damaging	Het
Rreb1	C	A	13: 37,931,668	T1001K	probably benign	Het
Ruvbl1	A	G	6: 88,497,373	K453E	probably benign	Het
Sdc4	A	T	2: 164,429,039	V100D	probably benign	Het
Simc1	C	A	13: 54,524,334	T165K	probably benign	Het
Slc2a3	A	G	6: 122,740,449	V16A	probably benign	Het
Smbd1	A	T	16: 32,806,760	S53T	possibly damaging	Het
Smndc1	A	T	19: 53,383,643	N113K	possibly damaging	Het
Tas2r139	T	G	6: 42,141,234	F100C	probably damaging	Het
Tubgcp5	A	G	7: 55,817,358	Y692C	probably damaging	Het
Ube2d2a	T	C	18: 35,800,144	I78T	probably benign	Het
Ugt2b37	C	T	5: 87,254,137	V212I	probably benign	Het
Wars2	A	G	3: 99,216,747	D308G	possibly damaging	Het
Yeats2	G	A	16: 20,211,750		probably null	Het
Zfp385a	G	T	15: 103,315,891	H219N	possibly damaging	Het
Zfp407	T	C	18: 84,209,857	T1876A	probably damaging	Het

Other mutations in Cntnap3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00433:Cntnap3	APN	13	64772731	missense	probably damaging	1.00
IGL00782:Cntnap3	APN	13	64745805	splice site	probably benign
IGL00976:Cntnap3	APN	13	64794352	missense	probably damaging	1.00
IGL01319:Cntnap3	APN	13	64787837	missense	probably damaging	1.00
IGL01610:Cntnap3	APN	13	64757301	missense	probably damaging	0.98
IGL01861:Cntnap3	APN	13	64799108	missense	probably damaging	1.00
IGL02127:Cntnap3	APN	13	64799064	splice site	probably benign
IGL02133:Cntnap3	APN	13	64751673	splice site	probably benign
IGL02251:Cntnap3	APN	13	64762036	missense	probably damaging	1.00
IGL02272:Cntnap3	APN	13	64757411	missense	probably damaging	1.00
IGL02370:Cntnap3	APN	13	64751751	missense	probably benign
IGL02456:Cntnap3	APN	13	64799058	splice site	probably benign
IGL02589:Cntnap3	APN	13	64792430	missense	probably benign	0.08
IGL02695:Cntnap3	APN	13	64772132	missense	probably benign	0.01
IGL02850:Cntnap3	APN	13	64757409	missense	probably damaging	1.00
IGL03038:Cntnap3	APN	13	64741025	missense	possibly damaging	0.50
IGL03188:Cntnap3	APN	13	64781745	missense	probably damaging	0.97
IGL03327:Cntnap3	APN	13	64887768	nonsense	probably null
PIT4480001:Cntnap3	UTSW	13	64757210	missense	probably damaging	1.00
R0309:Cntnap3	UTSW	13	64757436	splice site	probably benign
R0422:Cntnap3	UTSW	13	64757285	missense	probably damaging	0.96
R0463:Cntnap3	UTSW	13	64778876	missense	probably damaging	1.00
R0491:Cntnap3	UTSW	13	64762045	missense	probably benign	0.01
R0499:Cntnap3	UTSW	13	64858678	missense	probably benign	0.33
R0550:Cntnap3	UTSW	13	64762000	missense	possibly damaging	0.86
R0613:Cntnap3	UTSW	13	64758414	missense	probably damaging	1.00
R0666:Cntnap3	UTSW	13	64757397	missense	probably damaging	1.00
R0840:Cntnap3	UTSW	13	64787910	missense	possibly damaging	0.94
R1577:Cntnap3	UTSW	13	64758290	missense	probably damaging	1.00
R1716:Cntnap3	UTSW	13	64762002	missense	probably damaging	1.00
R1732:Cntnap3	UTSW	13	64740812	critical splice donor site	probably null
R1739:Cntnap3	UTSW	13	64740592	missense	probably benign	0.17
R1905:Cntnap3	UTSW	13	64903764	missense	probably benign	0.04
R1988:Cntnap3	UTSW	13	64758390	missense	probably damaging	1.00
R2086:Cntnap3	UTSW	13	64794262	missense	possibly damaging	0.76
R3732:Cntnap3	UTSW	13	64740999	missense	possibly damaging	0.73
R3808:Cntnap3	UTSW	13	64781804	missense	probably damaging	0.96
R3809:Cntnap3	UTSW	13	64781804	missense	probably damaging	0.96
R4384:Cntnap3	UTSW	13	64748460	missense	probably damaging	1.00
R4433:Cntnap3	UTSW	13	64778853	missense	possibly damaging	0.92
R4631:Cntnap3	UTSW	13	64778883	missense	probably benign	0.04
R4645:Cntnap3	UTSW	13	64778788	critical splice donor site	probably null
R4702:Cntnap3	UTSW	13	64778862	missense	probably benign	0.17
R4876:Cntnap3	UTSW	13	64787706	missense	probably benign	0.00
R4994:Cntnap3	UTSW	13	64761984	missense	possibly damaging	0.55
R5043:Cntnap3	UTSW	13	64794348	missense	probably damaging	1.00
R5214:Cntnap3	UTSW	13	64762010	missense	probably damaging	1.00
R5403:Cntnap3	UTSW	13	64761978	missense	possibly damaging	0.90
R5571:Cntnap3	UTSW	13	64903758	missense	probably damaging	0.98
R5587:Cntnap3	UTSW	13	64746738	missense	probably damaging	1.00
R5695:Cntnap3	UTSW	13	64787955	missense	probably damaging	0.99
R5834:Cntnap3	UTSW	13	64748577	missense	probably benign	0.07
R5892:Cntnap3	UTSW	13	64799180	missense	probably damaging	1.00
R5950:Cntnap3	UTSW	13	64787769	missense	probably damaging	1.00
R6526:Cntnap3	UTSW	13	64781888	missense	possibly damaging	0.96
R6954:Cntnap3	UTSW	13	64748559	missense	probably benign	0.00
R7138:Cntnap3	UTSW	13	64781725	critical splice donor site	probably null
R7355:Cntnap3	UTSW	13	64771962	missense	probably benign
R7425:Cntnap3	UTSW	13	64758252	missense	probably damaging	1.00
R7521:Cntnap3	UTSW	13	64772001	missense	probably benign	0.22
R7719:Cntnap3	UTSW	13	64772777	nonsense	probably null
R7810:Cntnap3	UTSW	13	64793308	missense	possibly damaging	0.73
R7871:Cntnap3	UTSW	13	64903773	missense	probably benign	0.00
R8259:Cntnap3	UTSW	13	64787867	missense	probably damaging	0.99
R8415:Cntnap3	UTSW	13	64738665	missense	probably benign	0.31
R8491:Cntnap3	UTSW	13	64785343	missense	probably damaging	1.00
R9086:Cntnap3	UTSW	13	64781759	missense	probably damaging	1.00
R9398:Cntnap3	UTSW	13	64903834	missense	probably benign	0.41
R9475:Cntnap3	UTSW	13	64799135	missense	probably damaging	1.00
R9625:Cntnap3	UTSW	13	64858765	missense	probably damaging	1.00
R9679:Cntnap3	UTSW	13	64751748	missense	probably damaging	1.00
Z1176:Cntnap3	UTSW	13	64740872	frame shift	probably null
Z1176:Cntnap3	UTSW	13	64792388	missense	probably damaging	0.98
Z1177:Cntnap3	UTSW	13	64781892	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CCAGAGAAGGTTGATCTATGAAAC -3'
(R):5'- TGCAGTGCTTCCCTTGTAGG -3'

Sequencing Primer
(F):5'- GGTTGATCTATGAAACAGCCTTAG -3'
(R):5'- CAGAAGGGCTTCCTGGGATGTATC -3'

Posted On

2021-12-30