Mutagenetix > Incidental Mutation

Incidental Mutation 'R9087:Zfp407'

690728

Institutional Source

Beutler Lab

Gene Symbol

Zfp407

Ensembl Gene

ENSMUSG00000048410

Gene Name

zinc finger protein 407

Synonyms

6430585N13Rik, LOC240469, LOC381139

MMRRC Submission

068906-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9087 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

84128027-84589725 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 84209857 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1876 (T1876A)

Ref Sequence

ENSEMBL: ENSMUSP00000118361 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000125763]

AlphaFold

G3UVV3

Predicted Effect

probably benign
Transcript: ENSMUST00000125450

Predicted Effect

probably damaging
Transcript: ENSMUST00000125763
AA Change: T1876A

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000118361
Gene: ENSMUSG00000048410
AA Change: T1876A

Domain	Start	End	E-Value	Type
low complexity region	20	37	N/A	INTRINSIC
ZnF_C2H2	178	200	8.67e-1	SMART
ZnF_U1	233	267	6.79e-1	SMART
ZnF_C2H2	236	260	4.65e-1	SMART
ZnF_C2H2	522	545	7.05e-1	SMART
ZnF_U1	548	582	1.54e1	SMART
ZnF_C2H2	551	575	1.01e-1	SMART
ZnF_C2H2	582	605	1.41e0	SMART
ZnF_U1	606	639	2.22e0	SMART
ZnF_C2H2	609	632	1.01e2	SMART
ZnF_C2H2	695	718	6.23e-2	SMART
ZnF_U1	721	755	2.96e0	SMART
ZnF_C2H2	724	748	7.11e0	SMART
ZnF_C2H2	840	863	7.55e-1	SMART
ZnF_U1	866	900	3.81e-1	SMART
ZnF_C2H2	869	893	1.07e0	SMART
ZnF_C2H2	1009	1032	6.13e-1	SMART
ZnF_U1	1035	1069	2.22e0	SMART
ZnF_C2H2	1038	1062	5.62e0	SMART
low complexity region	1223	1234	N/A	INTRINSIC
ZnF_C2H2	1405	1428	5.92e0	SMART
ZnF_U1	1432	1466	2.35e0	SMART
ZnF_C2H2	1435	1459	1.76e-1	SMART
ZnF_C2H2	1477	1500	5.42e-2	SMART
ZnF_C2H2	1528	1552	1.68e1	SMART
ZnF_C2H2	1558	1580	1.43e-1	SMART
ZnF_C2H2	1586	1609	9.58e-3	SMART
ZnF_C2H2	1619	1641	2.61e-4	SMART
ZnF_C2H2	1647	1671	1.04e-3	SMART
ZnF_C2H2	1677	1699	9.44e-2	SMART
ZnF_C2H2	1705	1727	1.82e-3	SMART
ZnF_C2H2	1733	1758	4.65e-1	SMART
ZnF_C2H2	1764	1787	1.26e-2	SMART
low complexity region	1876	1887	N/A	INTRINSIC
low complexity region	2017	2032	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger protein whose exact function is not known. It may be involved in transcriptional regulation. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aars	A	G	8: 111,041,537	D180G	probably damaging	Het
Abcb6	A	T	1: 75,173,567	I649K	probably damaging	Het
Ace	T	C	11: 105,981,919	F969S	probably damaging	Het
Ankrd26	A	G	6: 118,559,269		probably null	Het
Apobec1	A	T	6: 122,581,741	L9*	probably null	Het
Atp13a1	A	G	8: 69,803,807	D865G	probably damaging	Het
Barhl1	T	C	2: 28,915,219	Y154C	probably damaging	Het
Bbx	T	C	16: 50,274,635	D106G	probably damaging	Het
Cacna1a	G	A	8: 84,638,803	A2192T	probably benign	Het
Cacnb1	T	C	11: 98,003,007	N563S	possibly damaging	Het
Capn5	A	T	7: 98,126,324	I470N	probably damaging	Het
Cd300c	T	C	11: 114,959,765	T71A	probably damaging	Het
Celf4	T	A	18: 25,504,270	S223C	probably damaging	Het
Cftr	A	C	6: 18,214,181	I119L	possibly damaging	Het
Cmya5	T	C	13: 93,097,203	E459G	possibly damaging	Het
Cntn2	A	G	1: 132,525,370	Y395H	probably damaging	Het
Cntnap3	T	C	13: 64,751,718	D987G	probably damaging	Het
Col5a2	T	A	1: 45,442,658	D102V	unknown	Het
Cpeb2	T	C	5: 43,281,118	F812L		Het
Cpsf3	T	A	12: 21,308,994	L565Q	probably damaging	Het
Ctnnd1	A	C	2: 84,609,578	L796R	probably damaging	Het
Dach1	A	G	14: 98,168,831	L160P	probably benign	Het
Dennd1a	A	C	2: 38,021,354		probably null	Het
Dnah12	T	C	14: 26,824,546	I2431T	probably damaging	Het
Ep400	A	T	5: 110,667,564	Y2887*	probably null	Het
Erich1	T	C	8: 14,033,623	D149G	probably damaging	Het
Fut2	T	C	7: 45,651,069	N93S	probably damaging	Het
Gba2	C	T	4: 43,568,304	A688T	probably benign	Het
Gcm2	C	G	13: 41,109,930	E9Q		Het
Gfod1	T	C	13: 43,200,362	E379G	probably damaging	Het
Gfod2	A	G	8: 105,728,219	F10L	probably damaging	Het
Gm4871	T	G	5: 145,032,278	H75P	possibly damaging	Het
Gtpbp3	T	A	8: 71,492,355	V418E	probably benign	Het
Hif1a	T	A	12: 73,942,325	I688K	probably benign	Het
Ifi44	G	T	3: 151,745,880	S196R	probably damaging	Het
Igfn1	T	C	1: 135,974,868		probably null	Het
Itpr3	G	A	17: 27,118,677		probably benign	Het
Kl	A	G	5: 150,988,492	K569E	probably benign	Het
Klkb1	G	A	8: 45,275,478	Q415*	probably null	Het
L1td1	A	G	4: 98,736,462	D298G	possibly damaging	Het
L2hgdh	C	T	12: 69,702,357	R252Q	probably benign	Het
Lipc	C	G	9: 70,802,108	K452N	probably benign	Het
Lrp10	C	A	14: 54,468,164	S270R	probably damaging	Het
Ly6e	T	G	15: 74,957,800	L14R	probably benign	Het
Mast3	T	C	8: 70,789,686	D90G	possibly damaging	Het
Mmp27	T	C	9: 7,579,857	F444S	probably damaging	Het
Mrgpra2b	A	T	7: 47,464,770	N71K	probably benign	Het
Nbea	C	A	3: 55,642,736		probably null	Het
Ndufb10	A	G	17: 24,724,185		probably null	Het
Ndufb9	C	T	15: 58,939,302	P146S	probably benign	Het
Nhsl1	T	C	10: 18,531,282	V1388A	probably damaging	Het
Nomo1	C	A	7: 46,083,324	D1170E	probably benign	Het
Nop2	G	T	6: 125,137,428	R254L	probably benign	Het
Nup160	A	T	2: 90,684,085	T126S	probably benign	Het
Olfr1049	A	G	2: 86,255,036	M219T	probably benign	Het
Olfr1107	A	G	2: 87,071,955	Y60H	probably damaging	Het
Olfr344	T	C	2: 36,569,333	L245P	probably damaging	Het
Olfr493	A	G	7: 108,346,751	S77P	probably damaging	Het
Olfr531	A	T	7: 140,400,634	C137*	probably null	Het
Olfr555	A	G	7: 102,659,757	K312R	probably benign	Het
Olfr675	C	T	7: 105,024,703	W92*	probably null	Het
Olfr917	A	G	9: 38,665,415	L143P	probably damaging	Het
Opa1	A	G	16: 29,618,235	D654G	probably damaging	Het
Osbp2	T	A	11: 3,717,976	D7V	probably damaging	Het
Osr2	A	T	15: 35,300,864	I189F	probably damaging	Het
Pdlim5	A	G	3: 142,352,833	V50A	possibly damaging	Het
Pik3r3	A	G	4: 116,291,734	N334S	probably benign	Het
Plk5	C	G	10: 80,357,996	R40G	probably damaging	Het
Ppfia4	A	G	1: 134,312,588	I889T	probably damaging	Het
Prpf38b	T	C	3: 108,904,341	K403E	unknown	Het
Rgs20	T	G	1: 4,923,967	E31A	possibly damaging	Het
Rpl11	A	T	4: 136,052,689	M12K	possibly damaging	Het
Rreb1	C	A	13: 37,931,668	T1001K	probably benign	Het
Ruvbl1	A	G	6: 88,497,373	K453E	probably benign	Het
Sdc4	A	T	2: 164,429,039	V100D	probably benign	Het
Simc1	C	A	13: 54,524,334	T165K	probably benign	Het
Slc2a3	A	G	6: 122,740,449	V16A	probably benign	Het
Smbd1	A	T	16: 32,806,760	S53T	possibly damaging	Het
Smndc1	A	T	19: 53,383,643	N113K	possibly damaging	Het
Tas2r139	T	G	6: 42,141,234	F100C	probably damaging	Het
Tubgcp5	A	G	7: 55,817,358	Y692C	probably damaging	Het
Ube2d2a	T	C	18: 35,800,144	I78T	probably benign	Het
Ugt2b37	C	T	5: 87,254,137	V212I	probably benign	Het
Wars2	A	G	3: 99,216,747	D308G	possibly damaging	Het
Yeats2	G	A	16: 20,211,750		probably null	Het
Zfp385a	G	T	15: 103,315,891	H219N	possibly damaging	Het

Other mutations in Zfp407

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00499:Zfp407	APN	18	84561752	missense	probably damaging	0.99
IGL02105:Zfp407	APN	18	84562720	nonsense	probably null
IGL02110:Zfp407	APN	18	84559040	missense	probably benign	0.00
IGL02343:Zfp407	APN	18	84209724	missense	possibly damaging	0.71
IGL02456:Zfp407	APN	18	84558641	missense	probably damaging	1.00
IGL02705:Zfp407	APN	18	84559031	nonsense	probably null
IGL02946:Zfp407	APN	18	84560709	missense	probably damaging	1.00
IGL03069:Zfp407	APN	18	84350975	missense	probably damaging	1.00
IGL03145:Zfp407	APN	18	84209721	missense	probably damaging	0.99
IGL03403:Zfp407	APN	18	84560797	missense	probably damaging	1.00
IGL03134:Zfp407	UTSW	18	84209955	missense	probably damaging	0.99
PIT4362001:Zfp407	UTSW	18	84561268	missense	possibly damaging	0.87
PIT4520001:Zfp407	UTSW	18	84432420	missense	probably damaging	0.99
R0087:Zfp407	UTSW	18	84560411	missense	probably damaging	1.00
R0243:Zfp407	UTSW	18	84558711	missense	probably damaging	1.00
R0594:Zfp407	UTSW	18	84562567	missense	possibly damaging	0.87
R0766:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R0787:Zfp407	UTSW	18	84209022	missense	probably damaging	1.00
R0787:Zfp407	UTSW	18	84209346	missense	probably benign	0.00
R1065:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1086:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1165:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1186:Zfp407	UTSW	18	84209448	missense	probably benign	0.39
R1203:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1312:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1345:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1385:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1421:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1430:Zfp407	UTSW	18	84209455	missense	probably benign	0.18
R1436:Zfp407	UTSW	18	84343071	splice site	probably benign
R1498:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1526:Zfp407	UTSW	18	84561033	missense	possibly damaging	0.61
R1579:Zfp407	UTSW	18	84209638	missense	probably benign	0.00
R1594:Zfp407	UTSW	18	84209331	missense	probably benign	0.01
R1628:Zfp407	UTSW	18	84354533	missense	probably damaging	1.00
R1698:Zfp407	UTSW	18	84562157	missense	probably damaging	1.00
R1962:Zfp407	UTSW	18	84559336	missense	probably benign	0.01
R1984:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1985:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1986:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R2151:Zfp407	UTSW	18	84209649	missense	possibly damaging	0.55
R2152:Zfp407	UTSW	18	84209649	missense	possibly damaging	0.55
R2154:Zfp407	UTSW	18	84209649	missense	possibly damaging	0.55
R2259:Zfp407	UTSW	18	84209793	missense	probably damaging	1.00
R2353:Zfp407	UTSW	18	84559880	missense	probably damaging	1.00
R2845:Zfp407	UTSW	18	84558397	nonsense	probably null
R3407:Zfp407	UTSW	18	84558872	missense	probably benign	0.08
R3432:Zfp407	UTSW	18	84208746	missense	probably damaging	1.00
R3892:Zfp407	UTSW	18	84560352	missense	probably damaging	1.00
R4026:Zfp407	UTSW	18	84559596	missense	possibly damaging	0.82
R4107:Zfp407	UTSW	18	84343007	missense	possibly damaging	0.82
R4398:Zfp407	UTSW	18	84562731	nonsense	probably null
R4447:Zfp407	UTSW	18	84562694	missense	possibly damaging	0.95
R4752:Zfp407	UTSW	18	84562914	missense	probably benign	0.01
R4881:Zfp407	UTSW	18	84559703	missense	probably benign	0.27
R4936:Zfp407	UTSW	18	84559464	missense	probably benign	0.00
R5194:Zfp407	UTSW	18	84561309	missense	probably benign	0.05
R5243:Zfp407	UTSW	18	84561091	missense	probably damaging	1.00
R5258:Zfp407	UTSW	18	84315926	missense	probably damaging	1.00
R5591:Zfp407	UTSW	18	84561137	missense	probably damaging	1.00
R5633:Zfp407	UTSW	18	84561044	missense	probably benign	0.35
R5739:Zfp407	UTSW	18	84208742	makesense	probably null
R5806:Zfp407	UTSW	18	84558614	missense	probably damaging	1.00
R5820:Zfp407	UTSW	18	84560524	missense	probably benign	0.01
R6187:Zfp407	UTSW	18	84559009	missense	possibly damaging	0.87
R6512:Zfp407	UTSW	18	84560349	missense	probably damaging	1.00
R6521:Zfp407	UTSW	18	84432411	missense	probably damaging	1.00
R6748:Zfp407	UTSW	18	84208830	missense	probably damaging	0.98
R6882:Zfp407	UTSW	18	84343069	splice site	probably null
R6899:Zfp407	UTSW	18	84561434	missense	possibly damaging	0.86
R7038:Zfp407	UTSW	18	84561857	missense	probably damaging	1.00
R7076:Zfp407	UTSW	18	84558476	missense	probably damaging	1.00
R7326:Zfp407	UTSW	18	84559042	missense	possibly damaging	0.77
R7397:Zfp407	UTSW	18	84561819	missense	possibly damaging	0.59
R7402:Zfp407	UTSW	18	84561536	missense	probably benign	0.02
R7783:Zfp407	UTSW	18	84209922	missense	possibly damaging	0.69
R7800:Zfp407	UTSW	18	84560675	missense	probably damaging	0.99
R7904:Zfp407	UTSW	18	84561256	missense	not run
R7942:Zfp407	UTSW	18	84559629	missense	probably benign	0.02
R7955:Zfp407	UTSW	18	84559291	missense	probably benign	0.02
R7988:Zfp407	UTSW	18	84559400	missense	possibly damaging	0.60
R8125:Zfp407	UTSW	18	84561185	missense	probably damaging	1.00
R8237:Zfp407	UTSW	18	84560144	missense	possibly damaging	0.87
R8364:Zfp407	UTSW	18	84552868	critical splice donor site	probably null
R8443:Zfp407	UTSW	18	84209862	missense	probably damaging	1.00
R8487:Zfp407	UTSW	18	84562770	nonsense	probably null
R8497:Zfp407	UTSW	18	84559896	missense	probably damaging	0.98
R8808:Zfp407	UTSW	18	84343060	missense	probably benign	0.17
R8848:Zfp407	UTSW	18	84560694	missense	probably damaging	1.00
R8913:Zfp407	UTSW	18	84560528	missense	probably damaging	0.99
R8962:Zfp407	UTSW	18	84558932	missense	probably damaging	1.00
R9452:Zfp407	UTSW	18	84562454	missense	probably benign	0.02
R9691:Zfp407	UTSW	18	84560187	missense	probably benign	0.03
R9766:Zfp407	UTSW	18	84559449	missense	probably benign	0.06
RF003:Zfp407	UTSW	18	84209563	missense	probably benign	0.17
Z1177:Zfp407	UTSW	18	84209954	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- GTCCACACTGTGACTTTCCATGG -3'
(R):5'- AGGACAAGGAGCCACGTTTG -3'

Sequencing Primer
(F):5'- ACTGTGACTTTCCATGGAACCC -3'
(R):5'- TTTGTGGAGACAGACAGCCC -3'

Posted On

2021-12-30