Incidental Mutation 'R9088:Polr1a'
ID 690755
Institutional Source Beutler Lab
Gene Symbol Polr1a
Ensembl Gene ENSMUSG00000049553
Gene Name polymerase (RNA) I polypeptide A
Synonyms RPA194, 3010014K16Rik, 194kDa, mRPA1, Rpo1-4
Accession Numbers

Genbank: NM_009088; MGI: 1096397

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9088 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 71909053-71984935 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 71931783 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 531 (T531A)
Ref Sequence ENSEMBL: ENSMUSP00000060858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055296] [ENSMUST00000206556]
AlphaFold O35134
Predicted Effect probably benign
Transcript: ENSMUST00000055296
AA Change: T531A

PolyPhen 2 Score 0.261 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000060858
Gene: ENSMUSG00000049553
AA Change: T531A

DomainStartEndE-ValueType
RPOLA_N 302 649 8.97e-137 SMART
Pfam:RNA_pol_Rpb1_4 846 958 1.3e-26 PFAM
Pfam:RNA_pol_Rpb1_5 965 1669 7e-103 PFAM
low complexity region 1698 1708 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206556
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the largest subunit of the RNA polymerase I complex. The encoded protein represents the catalytic subunit of the complex, which transcribes DNA into ribosomal RNA precursors. Defects in this gene are a cause of the Cincinnati type of acrofacial dysostosis. [provided by RefSeq, May 2016]
Allele List at MGI

All alleles(18) : Gene trapped(18)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak9 A G 10: 41,406,874 Y1212C Het
Asah2 T C 19: 32,052,960 Q104R probably damaging Het
Bnipl T A 3: 95,250,984 R9* probably null Het
Bpifa3 A C 2: 154,133,765 N85T possibly damaging Het
C6 T C 15: 4,763,474 Y354H probably damaging Het
Caln1 A T 5: 130,414,776 probably benign Het
Capn3 T C 2: 120,490,970 F378L probably benign Het
Car6 T C 4: 150,197,349 H125R probably damaging Het
Ccdc110 G A 8: 45,941,845 E258K probably damaging Het
Cep295 C A 9: 15,322,519 R2327L probably benign Het
Col14a1 T A 15: 55,363,527 D224E unknown Het
Col16a1 T A 4: 130,077,223 S938T unknown Het
Col4a2 A G 8: 11,443,227 E1340G possibly damaging Het
Col6a6 C T 9: 105,784,077 V278M probably damaging Het
Crybg2 T A 4: 134,072,579 L41Q probably damaging Het
Ctss A T 3: 95,529,556 D50V possibly damaging Het
Ddx56 C T 11: 6,259,612 A500T probably benign Het
Dmbt1 T C 7: 131,116,689 V1713A unknown Het
Dnah1 T C 14: 31,266,013 I3483V probably benign Het
E130308A19Rik T A 4: 59,737,594 F402I probably benign Het
Eml6 A T 11: 29,818,424 H754Q probably damaging Het
Ern2 A G 7: 122,173,667 Y576H probably damaging Het
Fat4 T C 3: 39,007,299 S4344P probably benign Het
Fbxo40 A G 16: 36,969,788 I320T Het
Fbxw22 C T 9: 109,378,884 D440N probably damaging Het
Fgd2 A G 17: 29,364,939 E109G probably damaging Het
Gm17359 G A 3: 79,430,122 G185D probably damaging Het
Gm19410 A T 8: 35,773,612 D214V probably damaging Het
Gm884 T C 11: 103,620,936 K69E unknown Het
Hivep2 T C 10: 14,131,251 Y1198H probably damaging Het
Itpr3 G A 17: 27,118,677 probably benign Het
Lrrc8e G A 8: 4,234,410 V212M probably damaging Het
Map2 A T 1: 66,414,614 S888C probably damaging Het
Met G T 6: 17,548,716 G920* probably null Het
Mlkl G T 8: 111,322,733 R253S Het
Mmachc T A 4: 116,704,632 I102F probably damaging Het
Mnt G T 11: 74,843,054 V504L unknown Het
Mup14 C T 4: 61,302,497 G96D probably damaging Het
Myh13 G A 11: 67,352,059 E933K probably damaging Het
Ncoa6 A G 2: 155,407,806 S1193P probably damaging Het
Nek10 T C 14: 14,931,314 I762T probably damaging Het
Nmur1 G T 1: 86,387,530 F204L probably benign Het
Olfr151 T A 9: 37,730,510 I158F probably damaging Het
Olfr356 A G 2: 36,937,976 N286D probably damaging Het
Olfr672 G T 7: 104,996,094 P270Q probably damaging Het
Pappa2 T C 1: 158,936,357 Y528C probably damaging Het
Patl1 T C 19: 11,942,925 S748P possibly damaging Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Slit3 C T 11: 35,121,636 S41F possibly damaging Het
Snap29 A G 16: 17,428,194 Q226R probably damaging Het
Tmpo A G 10: 91,153,276 probably null Het
Tnfrsf21 G A 17: 43,037,716 G73E probably damaging Het
Tsc1 T A 2: 28,662,605 C119S possibly damaging Het
Uox A G 3: 146,624,614 Y199C probably damaging Het
Vav2 T C 2: 27,297,696 D231G possibly damaging Het
Vmn2r80 A T 10: 79,169,544 K338N probably benign Het
Xylt2 G A 11: 94,670,403 T178I probably benign Het
Zfp931 G T 2: 178,067,801 T264K probably damaging Het
Zgrf1 A G 3: 127,583,677 D857G probably benign Het
Other mutations in Polr1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01363:Polr1a APN 6 71948486 missense probably benign 0.32
IGL01834:Polr1a APN 6 71948462 missense probably benign
IGL01902:Polr1a APN 6 71963748 missense probably damaging 1.00
IGL02101:Polr1a APN 6 71950802 missense probably benign 0.00
IGL02325:Polr1a APN 6 71920657 missense probably benign 0.38
IGL02398:Polr1a APN 6 71936556 splice site probably benign
IGL02528:Polr1a APN 6 71964717 missense probably benign
IGL02555:Polr1a APN 6 71920457 missense probably damaging 0.98
IGL02613:Polr1a APN 6 71967320 missense probably damaging 1.00
IGL02693:Polr1a APN 6 71963846 splice site probably benign
IGL02892:Polr1a APN 6 71931696 missense possibly damaging 0.70
IGL03059:Polr1a APN 6 71936512 missense probably benign
IGL03174:Polr1a APN 6 71977347 missense possibly damaging 0.82
D4043:Polr1a UTSW 6 71941417 missense possibly damaging 0.92
R0092:Polr1a UTSW 6 71967455 splice site probably benign
R0217:Polr1a UTSW 6 71963703 missense probably benign 0.19
R0267:Polr1a UTSW 6 71974139 missense probably damaging 0.99
R0329:Polr1a UTSW 6 71966416 missense possibly damaging 0.96
R0330:Polr1a UTSW 6 71966416 missense possibly damaging 0.96
R0352:Polr1a UTSW 6 71920763 splice site probably benign
R0411:Polr1a UTSW 6 71978421 missense possibly damaging 0.95
R0446:Polr1a UTSW 6 71950664 critical splice donor site probably null
R0846:Polr1a UTSW 6 71924643 missense probably damaging 1.00
R1035:Polr1a UTSW 6 71967916 missense probably benign
R1294:Polr1a UTSW 6 71912902 missense probably damaging 0.99
R1460:Polr1a UTSW 6 71941384 missense probably damaging 0.99
R1657:Polr1a UTSW 6 71941535 missense probably damaging 1.00
R1846:Polr1a UTSW 6 71976188 missense probably damaging 0.98
R1862:Polr1a UTSW 6 71909203 missense probably damaging 0.96
R1865:Polr1a UTSW 6 71966524 missense probably damaging 1.00
R1903:Polr1a UTSW 6 71967914 missense probably benign 0.02
R1937:Polr1a UTSW 6 71936552 critical splice donor site probably null
R2063:Polr1a UTSW 6 71936285 splice site probably null
R2071:Polr1a UTSW 6 71976074 missense possibly damaging 0.64
R2084:Polr1a UTSW 6 71950809 missense possibly damaging 0.69
R2377:Polr1a UTSW 6 71972826 critical splice donor site probably null
R2410:Polr1a UTSW 6 71974882 missense probably benign
R3001:Polr1a UTSW 6 71965644 missense probably benign 0.02
R3001:Polr1a UTSW 6 71913016 missense probably benign 0.01
R3002:Polr1a UTSW 6 71913016 missense probably benign 0.01
R3002:Polr1a UTSW 6 71965644 missense probably benign 0.02
R3924:Polr1a UTSW 6 71929450 missense probably benign 0.00
R4105:Polr1a UTSW 6 71976191 missense probably damaging 0.98
R4125:Polr1a UTSW 6 71965706 missense probably benign 0.00
R4271:Polr1a UTSW 6 71953022 missense probably benign 0.02
R4440:Polr1a UTSW 6 71950848 missense probably damaging 0.98
R4667:Polr1a UTSW 6 71917821 missense probably benign 0.30
R4769:Polr1a UTSW 6 71950868 missense probably benign 0.01
R4801:Polr1a UTSW 6 71976070 missense probably benign 0.00
R4802:Polr1a UTSW 6 71976070 missense probably benign 0.00
R4828:Polr1a UTSW 6 71966401 missense possibly damaging 0.93
R4911:Polr1a UTSW 6 71909229 missense possibly damaging 0.67
R5071:Polr1a UTSW 6 71931709 missense possibly damaging 0.71
R5165:Polr1a UTSW 6 71967925 missense probably damaging 1.00
R5223:Polr1a UTSW 6 71967907 missense possibly damaging 0.73
R5239:Polr1a UTSW 6 71913037 missense probably damaging 1.00
R5546:Polr1a UTSW 6 71929366 missense possibly damaging 0.64
R5599:Polr1a UTSW 6 71967362 missense possibly damaging 0.95
R5696:Polr1a UTSW 6 71929426 missense probably benign 0.05
R5850:Polr1a UTSW 6 71926683 missense probably benign 0.00
R6274:Polr1a UTSW 6 71954890 splice site probably null
R6526:Polr1a UTSW 6 71929443 missense possibly damaging 0.89
R6578:Polr1a UTSW 6 71976041 missense possibly damaging 0.93
R6660:Polr1a UTSW 6 71967374 missense probably damaging 0.98
R6892:Polr1a UTSW 6 71964712 missense possibly damaging 0.72
R7274:Polr1a UTSW 6 71920516 nonsense probably null
R7291:Polr1a UTSW 6 71941456 missense probably benign 0.02
R7311:Polr1a UTSW 6 71950879 missense possibly damaging 0.53
R7431:Polr1a UTSW 6 71926659 missense probably benign 0.14
R7479:Polr1a UTSW 6 71936297 missense probably damaging 1.00
R7607:Polr1a UTSW 6 71913021 missense probably benign
R7739:Polr1a UTSW 6 71954835 missense possibly damaging 0.94
R7746:Polr1a UTSW 6 71941512 missense probably damaging 1.00
R7764:Polr1a UTSW 6 71953070 missense probably damaging 1.00
R7835:Polr1a UTSW 6 71915142 missense probably benign 0.02
R8029:Polr1a UTSW 6 71912956 nonsense probably null
R8057:Polr1a UTSW 6 71931660 missense possibly damaging 0.95
R8144:Polr1a UTSW 6 71950616 missense probably benign
R8170:Polr1a UTSW 6 71920749 missense probably benign
R8320:Polr1a UTSW 6 71941384 missense probably damaging 0.99
R8328:Polr1a UTSW 6 71920734 missense probably benign
R8331:Polr1a UTSW 6 71976179 missense probably damaging 1.00
R8362:Polr1a UTSW 6 71964667 missense probably benign 0.00
R8511:Polr1a UTSW 6 71920520 missense probably benign 0.01
R8709:Polr1a UTSW 6 71974848 missense probably benign
R8745:Polr1a UTSW 6 71954771 missense probably damaging 1.00
R8784:Polr1a UTSW 6 71950628 missense probably benign
R9055:Polr1a UTSW 6 71915069 missense possibly damaging 0.46
R9211:Polr1a UTSW 6 71966537 missense probably damaging 1.00
R9228:Polr1a UTSW 6 71954771 missense probably damaging 1.00
R9240:Polr1a UTSW 6 71963677 nonsense probably null
R9267:Polr1a UTSW 6 71965558 missense probably benign
R9302:Polr1a UTSW 6 71924699 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGACTTACCCTCAGCCAGTTAC -3'
(R):5'- GCCAATCCCAGAGATGCTATG -3'

Sequencing Primer
(F):5'- AGTTACCCCCTGGAACGTG -3'
(R):5'- GTGAGGACCCTGATCAACTTC -3'
Posted On 2021-12-30