Mutagenetix > Incidental Mutation

Incidental Mutation 'R9088:Dmbt1'

690758

Institutional Source

Beutler Lab

Gene Symbol

Dmbt1

Ensembl Gene

ENSMUSG00000047517

Gene Name

deleted in malignant brain tumors 1

Synonyms

Crpd, gp300, hensin, CRP-[b], MUCLIN, ebnerin, CRP-[a], vomeroglandin

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.239) question?

Stock #

R9088 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

130633787-130723357 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 130718418 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1713 (V1713A)

Ref Sequence

ENSEMBL: ENSMUSP00000146685 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084509] [ENSMUST00000124096] [ENSMUST00000208311] [ENSMUST00000213064]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000084509
AA Change: V1702A

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000081556
Gene: ENSMUSG00000047517
AA Change: V1702A

Domain	Start	End	E-Value	Type
SR	37	137	5.54e-59	SMART
SR	186	286	3.6e-58	SMART
SR	324	424	1.21e-59	SMART
SR	463	563	2.97e-59	SMART
SR	602	702	3.36e-58	SMART
SR	741	841	5.17e-59	SMART
low complexity region	848	879	N/A	INTRINSIC
CUB	884	993	4.22e-41	SMART
CUB	1000	1109	7.35e-41	SMART
CUB	1126	1235	3.73e-42	SMART
CUB	1242	1351	2.02e-38	SMART
SR	1371	1471	3.92e-59	SMART
low complexity region	1476	1488	N/A	INTRINSIC
CUB	1494	1603	6.7e-44	SMART
ZP	1612	1860	8.11e-74	SMART
transmembrane domain	1906	1928	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000124096

SMART Domains

Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

Domain	Start	End	E-Value	Type
Pfam:Pkinase	1	118	4.8e-19	PFAM
Pfam:Pkinase_Tyr	1	118	1.7e-50	PFAM
low complexity region	146	160	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000208311
AA Change: V1713A

Predicted Effect

probably benign
Transcript: ENSMUST00000209015

Predicted Effect

possibly damaging
Transcript: ENSMUST00000213064
AA Change: V1539A

PolyPhen 2 Score 0.784 (Sensitivity: 0.85; Specificity: 0.93)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Loss of sequences from human chromosome 10q has been associated with the progression of human cancers. This gene was originally isolated based on its deletion in a medulloblastoma cell line. This gene is expressed with transcripts of 6.0, 7.5, and 8.0 kb in fetal lung and with one transcript of 8.0 kb in adult lung, although the 7.5 kb transcript has not been characterized. The encoded protein precursor is a glycoprotein containing multiple scavenger receptor cysteine-rich (SRCR) domains separated by SRCR-interspersed domains (SID). Transcript variant 2 (8.0 kb) has been shown to bind surfactant protein D independently of carbohydrate recognition. This indicates that DMBT1 may not be a classical tumor suppressor gene, but rather play a role in the interaction of tumor cells and the immune system. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for one null allele display embryonic lethality and an abnormal inner cell mass. Mice homozygous for a different null allele are viable and fertile with an increased susceptibility to induced colitis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ak9	A	G	10: 41,282,870 (GRCm39)	Y1212C		Het
Asah2	T	C	19: 32,030,360 (GRCm39)	Q104R	probably damaging	Het
Bnipl	T	A	3: 95,158,295 (GRCm39)	R9*	probably null	Het
Bpifa3	A	C	2: 153,975,685 (GRCm39)	N85T	possibly damaging	Het
C6	T	C	15: 4,792,956 (GRCm39)	Y354H	probably damaging	Het
Caln1	A	T	5: 130,443,617 (GRCm39)		probably benign	Het
Capn3	T	C	2: 120,321,451 (GRCm39)	F378L	probably benign	Het
Car6	T	C	4: 150,281,806 (GRCm39)	H125R	probably damaging	Het
Ccdc110	G	A	8: 46,394,882 (GRCm39)	E258K	probably damaging	Het
Cep295	C	A	9: 15,233,815 (GRCm39)	R2327L	probably benign	Het
Col14a1	T	A	15: 55,226,923 (GRCm39)	D224E	unknown	Het
Col16a1	T	A	4: 129,971,016 (GRCm39)	S938T	unknown	Het
Col4a2	A	G	8: 11,493,227 (GRCm39)	E1340G	possibly damaging	Het
Col6a6	C	T	9: 105,661,276 (GRCm39)	V278M	probably damaging	Het
Crybg2	T	A	4: 133,799,890 (GRCm39)	L41Q	probably damaging	Het
Ctss	A	T	3: 95,436,867 (GRCm39)	D50V	possibly damaging	Het
Ddx56	C	T	11: 6,209,612 (GRCm39)	A500T	probably benign	Het
Dnah1	T	C	14: 30,987,970 (GRCm39)	I3483V	probably benign	Het
E130308A19Rik	T	A	4: 59,737,594 (GRCm39)	F402I	probably benign	Het
Eml6	A	T	11: 29,768,424 (GRCm39)	H754Q	probably damaging	Het
Ern2	A	G	7: 121,772,890 (GRCm39)	Y576H	probably damaging	Het
Fat4	T	C	3: 39,061,448 (GRCm39)	S4344P	probably benign	Het
Fbxo40	A	G	16: 36,790,150 (GRCm39)	I320T		Het
Fbxw22	C	T	9: 109,207,952 (GRCm39)	D440N	probably damaging	Het
Fgd2	A	G	17: 29,583,913 (GRCm39)	E109G	probably damaging	Het
Gm19410	A	T	8: 36,240,766 (GRCm39)	D214V	probably damaging	Het
Hivep2	T	C	10: 14,006,995 (GRCm39)	Y1198H	probably damaging	Het
Itpr3	G	A	17: 27,337,651 (GRCm39)		probably benign	Het
Lrrc37	T	C	11: 103,511,762 (GRCm39)	K69E	unknown	Het
Lrrc8e	G	A	8: 4,284,410 (GRCm39)	V212M	probably damaging	Het
Map2	A	T	1: 66,453,773 (GRCm39)	S888C	probably damaging	Het
Met	G	T	6: 17,548,715 (GRCm39)	G920*	probably null	Het
Mlkl	G	T	8: 112,049,365 (GRCm39)	R253S		Het
Mmachc	T	A	4: 116,561,829 (GRCm39)	I102F	probably damaging	Het
Mnt	G	T	11: 74,733,880 (GRCm39)	V504L	unknown	Het
Mup14	C	T	4: 61,258,496 (GRCm39)	G96D	probably damaging	Het
Myh13	G	A	11: 67,242,885 (GRCm39)	E933K	probably damaging	Het
Ncoa6	A	G	2: 155,249,726 (GRCm39)	S1193P	probably damaging	Het
Nek10	T	C	14: 14,931,314 (GRCm38)	I762T	probably damaging	Het
Nmur1	G	T	1: 86,315,252 (GRCm39)	F204L	probably benign	Het
Or1ak2	A	G	2: 36,827,988 (GRCm39)	N286D	probably damaging	Het
Or52e15	G	T	7: 104,645,301 (GRCm39)	P270Q	probably damaging	Het
Or8a1	T	A	9: 37,641,806 (GRCm39)	I158F	probably damaging	Het
Pappa2	T	C	1: 158,763,927 (GRCm39)	Y528C	probably damaging	Het
Patl1	T	C	19: 11,920,289 (GRCm39)	S748P	possibly damaging	Het
Peg10	C	CTCA	6: 4,756,453 (GRCm39)		probably benign	Het
Polr1a	A	G	6: 71,908,767 (GRCm39)	T531A	probably benign	Het
Slit3	C	T	11: 35,012,463 (GRCm39)	S41F	possibly damaging	Het
Snap29	A	G	16: 17,246,058 (GRCm39)	Q226R	probably damaging	Het
Spmip2	G	A	3: 79,337,429 (GRCm39)	G185D	probably damaging	Het
Tmpo	A	G	10: 90,989,138 (GRCm39)		probably null	Het
Tnfrsf21	G	A	17: 43,348,607 (GRCm39)	G73E	probably damaging	Het
Tsc1	T	A	2: 28,552,617 (GRCm39)	C119S	possibly damaging	Het
Uox	A	G	3: 146,330,369 (GRCm39)	Y199C	probably damaging	Het
Vav2	T	C	2: 27,187,708 (GRCm39)	D231G	possibly damaging	Het
Vmn2r80	A	T	10: 79,005,378 (GRCm39)	K338N	probably benign	Het
Xylt2	G	A	11: 94,561,229 (GRCm39)	T178I	probably benign	Het
Zfp931	G	T	2: 177,709,594 (GRCm39)	T264K	probably damaging	Het
Zgrf1	A	G	3: 127,377,326 (GRCm39)	D857G	probably benign	Het

Other mutations in Dmbt1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Dmbt1	APN	7	130,681,270 (GRCm39)	intron	probably benign
IGL00161:Dmbt1	APN	7	130,711,357 (GRCm39)	missense	probably damaging	1.00
IGL00331:Dmbt1	APN	7	130,701,020 (GRCm39)	missense	possibly damaging	0.46
IGL00769:Dmbt1	APN	7	130,684,230 (GRCm39)	missense	probably damaging	0.99
IGL00792:Dmbt1	APN	7	130,699,337 (GRCm39)	missense	possibly damaging	0.66
IGL00823:Dmbt1	APN	7	130,659,888 (GRCm39)	missense	probably benign	0.26
IGL01072:Dmbt1	APN	7	130,687,098 (GRCm39)	splice site	probably benign
IGL01317:Dmbt1	APN	7	130,642,921 (GRCm39)	missense	probably damaging	1.00
IGL01335:Dmbt1	APN	7	130,690,497 (GRCm39)	missense	possibly damaging	0.95
IGL01372:Dmbt1	APN	7	130,705,409 (GRCm39)	missense	possibly damaging	0.90
IGL01511:Dmbt1	APN	7	130,718,457 (GRCm39)	missense	possibly damaging	0.49
IGL01627:Dmbt1	APN	7	130,682,915 (GRCm39)	missense	probably benign	0.14
IGL01890:Dmbt1	APN	7	130,676,149 (GRCm39)	intron	probably benign
IGL02160:Dmbt1	APN	7	130,684,418 (GRCm39)	missense	probably damaging	1.00
IGL02186:Dmbt1	APN	7	130,694,986 (GRCm39)	splice site	probably benign
IGL02197:Dmbt1	APN	7	130,687,152 (GRCm39)	splice site	probably benign
IGL02332:Dmbt1	APN	7	130,668,343 (GRCm39)	intron	probably benign
IGL02427:Dmbt1	APN	7	130,689,815 (GRCm39)	splice site	probably null
IGL02726:Dmbt1	APN	7	130,676,140 (GRCm39)	intron	probably benign
IGL02967:Dmbt1	APN	7	130,672,919 (GRCm39)	missense	possibly damaging	0.70
IGL03003:Dmbt1	APN	7	130,684,409 (GRCm39)	missense	probably benign	0.05
IGL03089:Dmbt1	APN	7	130,712,778 (GRCm39)	missense	probably damaging	0.99
cavity	UTSW	7	130,713,965 (GRCm39)	missense	unknown
lacunar	UTSW	7	130,699,361 (GRCm39)	missense	probably damaging	0.97
BB005:Dmbt1	UTSW	7	130,639,620 (GRCm39)	missense	probably benign	0.16
BB015:Dmbt1	UTSW	7	130,639,620 (GRCm39)	missense	probably benign	0.16
H8562:Dmbt1	UTSW	7	130,713,805 (GRCm39)	nonsense	probably null
K3955:Dmbt1	UTSW	7	130,721,293 (GRCm39)	missense	probably damaging	0.98
R0051:Dmbt1	UTSW	7	130,721,225 (GRCm39)	missense	possibly damaging	0.79
R0051:Dmbt1	UTSW	7	130,721,225 (GRCm39)	missense	possibly damaging	0.79
R0257:Dmbt1	UTSW	7	130,708,123 (GRCm39)	missense	probably damaging	1.00
R0388:Dmbt1	UTSW	7	130,697,779 (GRCm39)	splice site	probably benign
R0427:Dmbt1	UTSW	7	130,642,632 (GRCm39)	nonsense	probably null
R0478:Dmbt1	UTSW	7	130,642,917 (GRCm39)	missense	possibly damaging	0.93
R0502:Dmbt1	UTSW	7	130,699,403 (GRCm39)	splice site	probably null
R0538:Dmbt1	UTSW	7	130,651,631 (GRCm39)	splice site	probably benign
R0626:Dmbt1	UTSW	7	130,703,811 (GRCm39)	missense	probably damaging	0.97
R0631:Dmbt1	UTSW	7	130,699,383 (GRCm39)	missense	possibly damaging	0.90
R0948:Dmbt1	UTSW	7	130,694,847 (GRCm39)	missense	possibly damaging	0.95
R1169:Dmbt1	UTSW	7	130,676,254 (GRCm39)	critical splice donor site	probably null
R1413:Dmbt1	UTSW	7	130,651,944 (GRCm39)	missense	probably damaging	1.00
R1458:Dmbt1	UTSW	7	130,646,217 (GRCm39)	splice site	probably benign
R1463:Dmbt1	UTSW	7	130,711,366 (GRCm39)	critical splice donor site	probably null
R1509:Dmbt1	UTSW	7	130,676,061 (GRCm39)	intron	probably benign
R1990:Dmbt1	UTSW	7	130,660,018 (GRCm39)	missense	probably damaging	0.98
R2018:Dmbt1	UTSW	7	130,712,718 (GRCm39)	missense	possibly damaging	0.93
R2019:Dmbt1	UTSW	7	130,712,718 (GRCm39)	missense	possibly damaging	0.93
R2042:Dmbt1	UTSW	7	130,708,089 (GRCm39)	missense	probably damaging	0.99
R2056:Dmbt1	UTSW	7	130,707,900 (GRCm39)	missense	possibly damaging	0.80
R2057:Dmbt1	UTSW	7	130,707,900 (GRCm39)	missense	possibly damaging	0.80
R2058:Dmbt1	UTSW	7	130,707,900 (GRCm39)	missense	possibly damaging	0.80
R2059:Dmbt1	UTSW	7	130,707,900 (GRCm39)	missense	possibly damaging	0.80
R2061:Dmbt1	UTSW	7	130,700,863 (GRCm39)	missense	possibly damaging	0.66
R2092:Dmbt1	UTSW	7	130,651,748 (GRCm39)	missense	probably damaging	1.00
R2102:Dmbt1	UTSW	7	130,703,762 (GRCm39)	missense	probably damaging	0.97
R2155:Dmbt1	UTSW	7	130,699,305 (GRCm39)	missense	possibly damaging	0.66
R2243:Dmbt1	UTSW	7	130,648,292 (GRCm39)	missense	probably benign	0.03
R2256:Dmbt1	UTSW	7	130,692,224 (GRCm39)	missense	probably benign	0.01
R2391:Dmbt1	UTSW	7	130,708,198 (GRCm39)	missense	probably damaging	1.00
R2394:Dmbt1	UTSW	7	130,696,464 (GRCm39)	nonsense	probably null
R3014:Dmbt1	UTSW	7	130,633,827 (GRCm39)	intron	probably benign
R3155:Dmbt1	UTSW	7	130,651,887 (GRCm39)	nonsense	probably null
R3176:Dmbt1	UTSW	7	130,689,801 (GRCm39)	missense	probably benign	0.19
R3276:Dmbt1	UTSW	7	130,689,801 (GRCm39)	missense	probably benign	0.19
R3442:Dmbt1	UTSW	7	130,707,979 (GRCm39)	missense	probably damaging	1.00
R3807:Dmbt1	UTSW	7	130,713,819 (GRCm39)	missense	possibly damaging	0.77
R4060:Dmbt1	UTSW	7	130,675,932 (GRCm39)	intron	probably benign
R4396:Dmbt1	UTSW	7	130,718,361 (GRCm39)	missense	probably damaging	0.98
R4453:Dmbt1	UTSW	7	130,642,664 (GRCm39)	missense	probably damaging	1.00
R5001:Dmbt1	UTSW	7	130,651,742 (GRCm39)	missense	probably damaging	1.00
R5051:Dmbt1	UTSW	7	130,696,472 (GRCm39)	missense	probably benign	0.01
R5156:Dmbt1	UTSW	7	130,699,400 (GRCm39)	critical splice donor site	probably null
R5225:Dmbt1	UTSW	7	130,696,465 (GRCm39)	missense	possibly damaging	0.84
R5281:Dmbt1	UTSW	7	130,684,349 (GRCm39)	missense	probably damaging	1.00
R5308:Dmbt1	UTSW	7	130,642,751 (GRCm39)	missense	probably damaging	1.00
R5447:Dmbt1	UTSW	7	130,721,240 (GRCm39)	missense	probably damaging	0.99
R5467:Dmbt1	UTSW	7	130,642,723 (GRCm39)	missense	probably damaging	1.00
R5497:Dmbt1	UTSW	7	130,665,133 (GRCm39)	intron	probably benign
R5526:Dmbt1	UTSW	7	130,642,920 (GRCm39)	missense	probably damaging	1.00
R5554:Dmbt1	UTSW	7	130,701,030 (GRCm39)	nonsense	probably null
R5566:Dmbt1	UTSW	7	130,708,003 (GRCm39)	missense	probably damaging	1.00
R5595:Dmbt1	UTSW	7	130,655,797 (GRCm39)	missense	probably benign	0.17
R6154:Dmbt1	UTSW	7	130,711,370 (GRCm39)	splice site	probably null
R6188:Dmbt1	UTSW	7	130,699,361 (GRCm39)	missense	probably damaging	0.97
R6214:Dmbt1	UTSW	7	130,668,463 (GRCm39)	missense	possibly damaging	0.95
R6215:Dmbt1	UTSW	7	130,668,463 (GRCm39)	missense	possibly damaging	0.95
R6391:Dmbt1	UTSW	7	130,659,984 (GRCm39)	missense	probably damaging	1.00
R6397:Dmbt1	UTSW	7	130,705,308 (GRCm39)	missense	possibly damaging	0.46
R6436:Dmbt1	UTSW	7	130,718,370 (GRCm39)	missense	probably benign	0.01
R6603:Dmbt1	UTSW	7	130,648,240 (GRCm39)	splice site	probably null
R6719:Dmbt1	UTSW	7	130,721,332 (GRCm39)	missense	possibly damaging	0.83
R6781:Dmbt1	UTSW	7	130,648,291 (GRCm39)	missense	probably benign	0.16
R7148:Dmbt1	UTSW	7	130,668,464 (GRCm39)	nonsense	probably null
R7191:Dmbt1	UTSW	7	130,646,250 (GRCm39)	missense	unknown
R7269:Dmbt1	UTSW	7	130,668,351 (GRCm39)	missense	unknown
R7288:Dmbt1	UTSW	7	130,685,519 (GRCm39)	nonsense	probably null
R7296:Dmbt1	UTSW	7	130,713,861 (GRCm39)	missense	unknown
R7349:Dmbt1	UTSW	7	130,642,854 (GRCm39)	missense	unknown
R7386:Dmbt1	UTSW	7	130,713,965 (GRCm39)	missense	unknown
R7428:Dmbt1	UTSW	7	130,710,192 (GRCm39)	missense	possibly damaging	0.53
R7481:Dmbt1	UTSW	7	130,681,241 (GRCm39)	critical splice acceptor site	probably null
R7486:Dmbt1	UTSW	7	130,668,192 (GRCm39)	missense	unknown
R7513:Dmbt1	UTSW	7	130,692,242 (GRCm39)	missense	unknown
R7553:Dmbt1	UTSW	7	130,706,597 (GRCm39)	missense	unknown
R7567:Dmbt1	UTSW	7	130,663,093 (GRCm39)	splice site	probably null
R7584:Dmbt1	UTSW	7	130,690,481 (GRCm39)	nonsense	probably null
R7736:Dmbt1	UTSW	7	130,718,625 (GRCm39)	missense	unknown
R7758:Dmbt1	UTSW	7	130,722,926 (GRCm39)	missense	unknown
R7928:Dmbt1	UTSW	7	130,639,620 (GRCm39)	missense	probably benign	0.16
R8080:Dmbt1	UTSW	7	130,690,500 (GRCm39)	missense	unknown
R8098:Dmbt1	UTSW	7	130,710,188 (GRCm39)	nonsense	probably null
R8125:Dmbt1	UTSW	7	130,700,953 (GRCm39)	missense	unknown
R8177:Dmbt1	UTSW	7	130,708,162 (GRCm39)	missense	possibly damaging	0.46
R8350:Dmbt1	UTSW	7	130,687,147 (GRCm39)	critical splice donor site	probably null
R8366:Dmbt1	UTSW	7	130,668,330 (GRCm39)	missense	unknown
R8378:Dmbt1	UTSW	7	130,708,195 (GRCm39)	missense	probably damaging	0.96
R8399:Dmbt1	UTSW	7	130,684,317 (GRCm39)	missense	unknown
R8400:Dmbt1	UTSW	7	130,684,317 (GRCm39)	missense	unknown
R8445:Dmbt1	UTSW	7	130,692,110 (GRCm39)	missense	unknown
R8450:Dmbt1	UTSW	7	130,687,147 (GRCm39)	critical splice donor site	probably null
R8511:Dmbt1	UTSW	7	130,703,742 (GRCm39)	missense	unknown
R8688:Dmbt1	UTSW	7	130,659,984 (GRCm39)	missense	unknown
R8850:Dmbt1	UTSW	7	130,692,134 (GRCm39)	missense	unknown
R8852:Dmbt1	UTSW	7	130,642,853 (GRCm39)	missense	unknown
R8871:Dmbt1	UTSW	7	130,718,597 (GRCm39)	missense	unknown
R8943:Dmbt1	UTSW	7	130,721,372 (GRCm39)	missense	possibly damaging	0.68
R8978:Dmbt1	UTSW	7	130,639,611 (GRCm39)	missense	possibly damaging	0.53
R9004:Dmbt1	UTSW	7	130,713,798 (GRCm39)	missense	unknown
R9020:Dmbt1	UTSW	7	130,712,787 (GRCm39)	missense	possibly damaging	0.86
R9230:Dmbt1	UTSW	7	130,639,642 (GRCm39)	missense	probably benign	0.01
R9304:Dmbt1	UTSW	7	130,700,855 (GRCm39)	missense	unknown
R9377:Dmbt1	UTSW	7	130,694,832 (GRCm39)	missense	unknown
R9428:Dmbt1	UTSW	7	130,668,208 (GRCm39)	missense	unknown
R9474:Dmbt1	UTSW	7	130,675,987 (GRCm39)	missense	unknown
R9573:Dmbt1	UTSW	7	130,657,910 (GRCm39)	critical splice donor site	probably null
R9675:Dmbt1	UTSW	7	130,712,652 (GRCm39)	missense	probably damaging	0.98
R9689:Dmbt1	UTSW	7	130,660,015 (GRCm39)	missense	unknown
R9781:Dmbt1	UTSW	7	130,639,599 (GRCm39)	missense	probably benign	0.00
X0024:Dmbt1	UTSW	7	130,713,977 (GRCm39)	nonsense	probably null
X0062:Dmbt1	UTSW	7	130,696,581 (GRCm39)	missense	possibly damaging	0.81
Z1176:Dmbt1	UTSW	7	130,690,542 (GRCm39)	missense	unknown
Z1177:Dmbt1	UTSW	7	130,684,215 (GRCm39)	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- TGCAGGAGTCTGACTGTGTC -3'
(R):5'- GTGTCCACAAACAGAGCCAAGG -3'

Sequencing Primer
(F):5'- CAGGAGTCTGACTGTGTCATCTC -3'
(R):5'- GCCTGAAGGTACAAATTCTGGTCC -3'

Posted On

2021-12-30