Mutagenetix > Incidental Mutation

Incidental Mutation 'R9088:Lrrc8e'

690759

Institutional Source

Beutler Lab

Gene Symbol

Lrrc8e

Ensembl Gene

ENSMUSG00000046589

Gene Name

leucine rich repeat containing 8 family, member E

Synonyms

1810049O03Rik, C87354

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.180) question?

Stock #

R9088 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

4226827-4237470 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 4234410 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 212 (V212M)

Ref Sequence

ENSEMBL: ENSMUSP00000052055 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003027] [ENSMUST00000053035] [ENSMUST00000062686] [ENSMUST00000110998] [ENSMUST00000110999] [ENSMUST00000145165] [ENSMUST00000207770]

AlphaFold

Q66JT1

Predicted Effect

probably benign
Transcript: ENSMUST00000003027

SMART Domains

Protein: ENSMUSP00000003027
Gene: ENSMUSG00000002948

Domain	Start	End	E-Value	Type
coiled coil region	1	30	N/A	INTRINSIC
low complexity region	69	89	N/A	INTRINSIC
S_TKc	136	396	8.43e-72	SMART
low complexity region	435	455	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000053035
AA Change: V212M

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000052055
Gene: ENSMUSG00000046589
AA Change: V212M

Domain	Start	End	E-Value	Type
Pfam:Pannexin_like	1	330	3.8e-143	PFAM
low complexity region	504	516	N/A	INTRINSIC
LRR	603	627	3.97e0	SMART
LRR	628	650	2.33e2	SMART
LRR_TYP	651	674	6.08e-5	SMART
LRR	676	696	6.78e1	SMART
LRR_TYP	697	720	2.43e-4	SMART
LRR	721	742	1.09e2	SMART
LRR_TYP	743	766	9.44e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000062686

SMART Domains

Protein: ENSMUSP00000054512
Gene: ENSMUSG00000002948

Domain	Start	End	E-Value	Type
coiled coil region	1	30	N/A	INTRINSIC
low complexity region	69	89	N/A	INTRINSIC
S_TKc	136	396	8.43e-72	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000110998

SMART Domains

Protein: ENSMUSP00000106626
Gene: ENSMUSG00000002948

Domain	Start	End	E-Value	Type
coiled coil region	1	30	N/A	INTRINSIC
low complexity region	36	47	N/A	INTRINSIC
low complexity region	53	73	N/A	INTRINSIC
S_TKc	120	380	8.43e-72	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000110999

SMART Domains

Protein: ENSMUSP00000106627
Gene: ENSMUSG00000002948

Domain	Start	End	E-Value	Type
coiled coil region	1	30	N/A	INTRINSIC
low complexity region	36	47	N/A	INTRINSIC
low complexity region	53	73	N/A	INTRINSIC
S_TKc	120	380	8.43e-72	SMART
low complexity region	419	439	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000145165

SMART Domains

Protein: ENSMUSP00000117418
Gene: ENSMUSG00000109061

Domain	Start	End	E-Value	Type
coiled coil region	1	30	N/A	INTRINSIC
low complexity region	69	89	N/A	INTRINSIC
S_TKc	136	396	8.43e-72	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000207770

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a small, conserved family of proteins with similar structure, including a string of extracellular leucine-rich repeats. A related protein was shown to be involved in B-cell development. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jun 2012]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ak9	A	G	10: 41,406,874	Y1212C		Het
Asah2	T	C	19: 32,052,960	Q104R	probably damaging	Het
Bnipl	T	A	3: 95,250,984	R9*	probably null	Het
Bpifa3	A	C	2: 154,133,765	N85T	possibly damaging	Het
C6	T	C	15: 4,763,474	Y354H	probably damaging	Het
Caln1	A	T	5: 130,414,776		probably benign	Het
Capn3	T	C	2: 120,490,970	F378L	probably benign	Het
Car6	T	C	4: 150,197,349	H125R	probably damaging	Het
Ccdc110	G	A	8: 45,941,845	E258K	probably damaging	Het
Cep295	C	A	9: 15,322,519	R2327L	probably benign	Het
Col14a1	T	A	15: 55,363,527	D224E	unknown	Het
Col16a1	T	A	4: 130,077,223	S938T	unknown	Het
Col4a2	A	G	8: 11,443,227	E1340G	possibly damaging	Het
Col6a6	C	T	9: 105,784,077	V278M	probably damaging	Het
Crybg2	T	A	4: 134,072,579	L41Q	probably damaging	Het
Ctss	A	T	3: 95,529,556	D50V	possibly damaging	Het
Ddx56	C	T	11: 6,259,612	A500T	probably benign	Het
Dmbt1	T	C	7: 131,116,689	V1713A	unknown	Het
Dnah1	T	C	14: 31,266,013	I3483V	probably benign	Het
E130308A19Rik	T	A	4: 59,737,594	F402I	probably benign	Het
Eml6	A	T	11: 29,818,424	H754Q	probably damaging	Het
Ern2	A	G	7: 122,173,667	Y576H	probably damaging	Het
Fat4	T	C	3: 39,007,299	S4344P	probably benign	Het
Fbxo40	A	G	16: 36,969,788	I320T		Het
Fbxw22	C	T	9: 109,378,884	D440N	probably damaging	Het
Fgd2	A	G	17: 29,364,939	E109G	probably damaging	Het
Gm17359	G	A	3: 79,430,122	G185D	probably damaging	Het
Gm19410	A	T	8: 35,773,612	D214V	probably damaging	Het
Gm884	T	C	11: 103,620,936	K69E	unknown	Het
Hivep2	T	C	10: 14,131,251	Y1198H	probably damaging	Het
Itpr3	G	A	17: 27,118,677		probably benign	Het
Map2	A	T	1: 66,414,614	S888C	probably damaging	Het
Met	G	T	6: 17,548,716	G920*	probably null	Het
Mlkl	G	T	8: 111,322,733	R253S		Het
Mmachc	T	A	4: 116,704,632	I102F	probably damaging	Het
Mnt	G	T	11: 74,843,054	V504L	unknown	Het
Mup14	C	T	4: 61,302,497	G96D	probably damaging	Het
Myh13	G	A	11: 67,352,059	E933K	probably damaging	Het
Ncoa6	A	G	2: 155,407,806	S1193P	probably damaging	Het
Nek10	T	C	14: 14,931,314	I762T	probably damaging	Het
Nmur1	G	T	1: 86,387,530	F204L	probably benign	Het
Olfr151	T	A	9: 37,730,510	I158F	probably damaging	Het
Olfr356	A	G	2: 36,937,976	N286D	probably damaging	Het
Olfr672	G	T	7: 104,996,094	P270Q	probably damaging	Het
Pappa2	T	C	1: 158,936,357	Y528C	probably damaging	Het
Patl1	T	C	19: 11,942,925	S748P	possibly damaging	Het
Peg10	C	CTCA	6: 4,756,453		probably benign	Het
Polr1a	A	G	6: 71,931,783	T531A	probably benign	Het
Slit3	C	T	11: 35,121,636	S41F	possibly damaging	Het
Snap29	A	G	16: 17,428,194	Q226R	probably damaging	Het
Tmpo	A	G	10: 91,153,276		probably null	Het
Tnfrsf21	G	A	17: 43,037,716	G73E	probably damaging	Het
Tsc1	T	A	2: 28,662,605	C119S	possibly damaging	Het
Uox	A	G	3: 146,624,614	Y199C	probably damaging	Het
Vav2	T	C	2: 27,297,696	D231G	possibly damaging	Het
Vmn2r80	A	T	10: 79,169,544	K338N	probably benign	Het
Xylt2	G	A	11: 94,670,403	T178I	probably benign	Het
Zfp931	G	T	2: 178,067,801	T264K	probably damaging	Het
Zgrf1	A	G	3: 127,583,677	D857G	probably benign	Het

Other mutations in Lrrc8e

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Lrrc8e	APN	8	4235921	missense	probably benign
IGL00943:Lrrc8e	APN	8	4235658	missense	probably damaging	1.00
IGL00979:Lrrc8e	APN	8	4235080	missense	probably damaging	1.00
IGL01138:Lrrc8e	APN	8	4234084	missense	probably damaging	1.00
IGL01458:Lrrc8e	APN	8	4236141	missense	probably damaging	1.00
IGL02524:Lrrc8e	APN	8	4235392	missense	probably damaging	1.00
IGL02831:Lrrc8e	APN	8	4235429	missense	probably damaging	0.96
IGL03135:Lrrc8e	APN	8	4235776	missense	probably damaging	1.00
R0242:Lrrc8e	UTSW	8	4235401	missense	probably benign	0.00
R0242:Lrrc8e	UTSW	8	4235401	missense	probably benign	0.00
R0312:Lrrc8e	UTSW	8	4235733	missense	probably benign
R0601:Lrrc8e	UTSW	8	4235239	splice site	probably null
R1167:Lrrc8e	UTSW	8	4235337	missense	probably benign
R1405:Lrrc8e	UTSW	8	4231754	missense	probably damaging	1.00
R1405:Lrrc8e	UTSW	8	4231754	missense	probably damaging	1.00
R1540:Lrrc8e	UTSW	8	4234990	missense	probably benign	0.41
R1677:Lrrc8e	UTSW	8	4234190	missense	probably damaging	1.00
R1916:Lrrc8e	UTSW	8	4235202	missense	probably benign	0.01
R2185:Lrrc8e	UTSW	8	4234986	nonsense	probably null
R2290:Lrrc8e	UTSW	8	4231770	missense	probably damaging	1.00
R3424:Lrrc8e	UTSW	8	4234611	missense	probably damaging	1.00
R4628:Lrrc8e	UTSW	8	4233981	missense	probably damaging	1.00
R4996:Lrrc8e	UTSW	8	4235166	missense	probably damaging	1.00
R5169:Lrrc8e	UTSW	8	4234329	missense	probably benign
R5516:Lrrc8e	UTSW	8	4235818	missense	probably damaging	1.00
R5870:Lrrc8e	UTSW	8	4235725	missense	possibly damaging	0.60
R6687:Lrrc8e	UTSW	8	4234798	missense	probably damaging	1.00
R6700:Lrrc8e	UTSW	8	4236034	missense	probably damaging	1.00
R7344:Lrrc8e	UTSW	8	4234815	missense	probably damaging	1.00
R7350:Lrrc8e	UTSW	8	4235626	missense	probably benign	0.14
R7555:Lrrc8e	UTSW	8	4234363	missense	probably benign	0.05
R7691:Lrrc8e	UTSW	8	4234534	missense	probably damaging	1.00
R8112:Lrrc8e	UTSW	8	4235575	missense	probably benign	0.14
R8184:Lrrc8e	UTSW	8	4235140	missense	probably damaging	0.99
R8328:Lrrc8e	UTSW	8	4235641	missense	probably damaging	1.00
R8355:Lrrc8e	UTSW	8	4234018	missense	probably benign	0.02
R8487:Lrrc8e	UTSW	8	4234218	missense	probably damaging	1.00
R8810:Lrrc8e	UTSW	8	4235070	missense	probably benign	0.03
R8971:Lrrc8e	UTSW	8	4234141	missense	probably damaging	1.00
R9150:Lrrc8e	UTSW	8	4236030	missense	probably benign	0.06
R9225:Lrrc8e	UTSW	8	4234561	missense	probably damaging	1.00
R9255:Lrrc8e	UTSW	8	4234504	missense	probably damaging	1.00
R9442:Lrrc8e	UTSW	8	4233964	missense	probably benign	0.01
R9463:Lrrc8e	UTSW	8	4235185	missense	probably damaging	0.99
R9475:Lrrc8e	UTSW	8	4235346	missense	probably benign
Z1176:Lrrc8e	UTSW	8	4234822	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TTCATCTCCATCCTGGGCAAG -3'
(R):5'- CACCAGAAAGCTGATCTTCTCC -3'

Sequencing Primer
(F):5'- GCAAGTGCTTTGATTCTCCATGGAC -3'
(R):5'- AGCTGATCTTCTCCACATAGATCAGG -3'

Posted On

2021-12-30