Incidental Mutation 'R9088:Lrrc8e'
ID 690759
Institutional Source Beutler Lab
Gene Symbol Lrrc8e
Ensembl Gene ENSMUSG00000046589
Gene Name leucine rich repeat containing 8 family, member E
Synonyms 1810049O03Rik, C87354
Accession Numbers
Essential gene? Probably non essential (E-score: 0.117) question?
Stock # R9088 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 4276827-4287470 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 4284410 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 212 (V212M)
Ref Sequence ENSEMBL: ENSMUSP00000052055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003027] [ENSMUST00000053035] [ENSMUST00000062686] [ENSMUST00000110998] [ENSMUST00000110999] [ENSMUST00000145165] [ENSMUST00000207770]
AlphaFold Q66JT1
Predicted Effect probably benign
Transcript: ENSMUST00000003027
SMART Domains Protein: ENSMUSP00000003027
Gene: ENSMUSG00000002948

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 69 89 N/A INTRINSIC
S_TKc 136 396 8.43e-72 SMART
low complexity region 435 455 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000053035
AA Change: V212M

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000052055
Gene: ENSMUSG00000046589
AA Change: V212M

DomainStartEndE-ValueType
Pfam:Pannexin_like 1 330 3.8e-143 PFAM
low complexity region 504 516 N/A INTRINSIC
LRR 603 627 3.97e0 SMART
LRR 628 650 2.33e2 SMART
LRR_TYP 651 674 6.08e-5 SMART
LRR 676 696 6.78e1 SMART
LRR_TYP 697 720 2.43e-4 SMART
LRR 721 742 1.09e2 SMART
LRR_TYP 743 766 9.44e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000062686
SMART Domains Protein: ENSMUSP00000054512
Gene: ENSMUSG00000002948

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 69 89 N/A INTRINSIC
S_TKc 136 396 8.43e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110998
SMART Domains Protein: ENSMUSP00000106626
Gene: ENSMUSG00000002948

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 36 47 N/A INTRINSIC
low complexity region 53 73 N/A INTRINSIC
S_TKc 120 380 8.43e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110999
SMART Domains Protein: ENSMUSP00000106627
Gene: ENSMUSG00000002948

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 36 47 N/A INTRINSIC
low complexity region 53 73 N/A INTRINSIC
S_TKc 120 380 8.43e-72 SMART
low complexity region 419 439 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145165
SMART Domains Protein: ENSMUSP00000117418
Gene: ENSMUSG00000109061

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 69 89 N/A INTRINSIC
S_TKc 136 396 8.43e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207770
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a small, conserved family of proteins with similar structure, including a string of extracellular leucine-rich repeats. A related protein was shown to be involved in B-cell development. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak9 A G 10: 41,282,870 (GRCm39) Y1212C Het
Asah2 T C 19: 32,030,360 (GRCm39) Q104R probably damaging Het
Bnipl T A 3: 95,158,295 (GRCm39) R9* probably null Het
Bpifa3 A C 2: 153,975,685 (GRCm39) N85T possibly damaging Het
C6 T C 15: 4,792,956 (GRCm39) Y354H probably damaging Het
Caln1 A T 5: 130,443,617 (GRCm39) probably benign Het
Capn3 T C 2: 120,321,451 (GRCm39) F378L probably benign Het
Car6 T C 4: 150,281,806 (GRCm39) H125R probably damaging Het
Ccdc110 G A 8: 46,394,882 (GRCm39) E258K probably damaging Het
Cep295 C A 9: 15,233,815 (GRCm39) R2327L probably benign Het
Col14a1 T A 15: 55,226,923 (GRCm39) D224E unknown Het
Col16a1 T A 4: 129,971,016 (GRCm39) S938T unknown Het
Col4a2 A G 8: 11,493,227 (GRCm39) E1340G possibly damaging Het
Col6a6 C T 9: 105,661,276 (GRCm39) V278M probably damaging Het
Crybg2 T A 4: 133,799,890 (GRCm39) L41Q probably damaging Het
Ctss A T 3: 95,436,867 (GRCm39) D50V possibly damaging Het
Ddx56 C T 11: 6,209,612 (GRCm39) A500T probably benign Het
Dmbt1 T C 7: 130,718,418 (GRCm39) V1713A unknown Het
Dnah1 T C 14: 30,987,970 (GRCm39) I3483V probably benign Het
E130308A19Rik T A 4: 59,737,594 (GRCm39) F402I probably benign Het
Eml6 A T 11: 29,768,424 (GRCm39) H754Q probably damaging Het
Ern2 A G 7: 121,772,890 (GRCm39) Y576H probably damaging Het
Fat4 T C 3: 39,061,448 (GRCm39) S4344P probably benign Het
Fbxo40 A G 16: 36,790,150 (GRCm39) I320T Het
Fbxw22 C T 9: 109,207,952 (GRCm39) D440N probably damaging Het
Fgd2 A G 17: 29,583,913 (GRCm39) E109G probably damaging Het
Gm19410 A T 8: 36,240,766 (GRCm39) D214V probably damaging Het
Hivep2 T C 10: 14,006,995 (GRCm39) Y1198H probably damaging Het
Itpr3 G A 17: 27,337,651 (GRCm39) probably benign Het
Lrrc37 T C 11: 103,511,762 (GRCm39) K69E unknown Het
Map2 A T 1: 66,453,773 (GRCm39) S888C probably damaging Het
Met G T 6: 17,548,715 (GRCm39) G920* probably null Het
Mlkl G T 8: 112,049,365 (GRCm39) R253S Het
Mmachc T A 4: 116,561,829 (GRCm39) I102F probably damaging Het
Mnt G T 11: 74,733,880 (GRCm39) V504L unknown Het
Mup14 C T 4: 61,258,496 (GRCm39) G96D probably damaging Het
Myh13 G A 11: 67,242,885 (GRCm39) E933K probably damaging Het
Ncoa6 A G 2: 155,249,726 (GRCm39) S1193P probably damaging Het
Nek10 T C 14: 14,931,314 (GRCm38) I762T probably damaging Het
Nmur1 G T 1: 86,315,252 (GRCm39) F204L probably benign Het
Or1ak2 A G 2: 36,827,988 (GRCm39) N286D probably damaging Het
Or52e15 G T 7: 104,645,301 (GRCm39) P270Q probably damaging Het
Or8a1 T A 9: 37,641,806 (GRCm39) I158F probably damaging Het
Pappa2 T C 1: 158,763,927 (GRCm39) Y528C probably damaging Het
Patl1 T C 19: 11,920,289 (GRCm39) S748P possibly damaging Het
Peg10 C CTCA 6: 4,756,453 (GRCm39) probably benign Het
Polr1a A G 6: 71,908,767 (GRCm39) T531A probably benign Het
Slit3 C T 11: 35,012,463 (GRCm39) S41F possibly damaging Het
Snap29 A G 16: 17,246,058 (GRCm39) Q226R probably damaging Het
Spmip2 G A 3: 79,337,429 (GRCm39) G185D probably damaging Het
Tmpo A G 10: 90,989,138 (GRCm39) probably null Het
Tnfrsf21 G A 17: 43,348,607 (GRCm39) G73E probably damaging Het
Tsc1 T A 2: 28,552,617 (GRCm39) C119S possibly damaging Het
Uox A G 3: 146,330,369 (GRCm39) Y199C probably damaging Het
Vav2 T C 2: 27,187,708 (GRCm39) D231G possibly damaging Het
Vmn2r80 A T 10: 79,005,378 (GRCm39) K338N probably benign Het
Xylt2 G A 11: 94,561,229 (GRCm39) T178I probably benign Het
Zfp931 G T 2: 177,709,594 (GRCm39) T264K probably damaging Het
Zgrf1 A G 3: 127,377,326 (GRCm39) D857G probably benign Het
Other mutations in Lrrc8e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Lrrc8e APN 8 4,285,921 (GRCm39) missense probably benign
IGL00943:Lrrc8e APN 8 4,285,658 (GRCm39) missense probably damaging 1.00
IGL00979:Lrrc8e APN 8 4,285,080 (GRCm39) missense probably damaging 1.00
IGL01138:Lrrc8e APN 8 4,284,084 (GRCm39) missense probably damaging 1.00
IGL01458:Lrrc8e APN 8 4,286,141 (GRCm39) missense probably damaging 1.00
IGL02524:Lrrc8e APN 8 4,285,392 (GRCm39) missense probably damaging 1.00
IGL02831:Lrrc8e APN 8 4,285,429 (GRCm39) missense probably damaging 0.96
IGL03135:Lrrc8e APN 8 4,285,776 (GRCm39) missense probably damaging 1.00
R0242:Lrrc8e UTSW 8 4,285,401 (GRCm39) missense probably benign 0.00
R0242:Lrrc8e UTSW 8 4,285,401 (GRCm39) missense probably benign 0.00
R0312:Lrrc8e UTSW 8 4,285,733 (GRCm39) missense probably benign
R0601:Lrrc8e UTSW 8 4,285,239 (GRCm39) splice site probably null
R1167:Lrrc8e UTSW 8 4,285,337 (GRCm39) missense probably benign
R1405:Lrrc8e UTSW 8 4,281,754 (GRCm39) missense probably damaging 1.00
R1405:Lrrc8e UTSW 8 4,281,754 (GRCm39) missense probably damaging 1.00
R1540:Lrrc8e UTSW 8 4,284,990 (GRCm39) missense probably benign 0.41
R1677:Lrrc8e UTSW 8 4,284,190 (GRCm39) missense probably damaging 1.00
R1916:Lrrc8e UTSW 8 4,285,202 (GRCm39) missense probably benign 0.01
R2185:Lrrc8e UTSW 8 4,284,986 (GRCm39) nonsense probably null
R2290:Lrrc8e UTSW 8 4,281,770 (GRCm39) missense probably damaging 1.00
R3424:Lrrc8e UTSW 8 4,284,611 (GRCm39) missense probably damaging 1.00
R4628:Lrrc8e UTSW 8 4,283,981 (GRCm39) missense probably damaging 1.00
R4996:Lrrc8e UTSW 8 4,285,166 (GRCm39) missense probably damaging 1.00
R5169:Lrrc8e UTSW 8 4,284,329 (GRCm39) missense probably benign
R5516:Lrrc8e UTSW 8 4,285,818 (GRCm39) missense probably damaging 1.00
R5870:Lrrc8e UTSW 8 4,285,725 (GRCm39) missense possibly damaging 0.60
R6687:Lrrc8e UTSW 8 4,284,798 (GRCm39) missense probably damaging 1.00
R6700:Lrrc8e UTSW 8 4,286,034 (GRCm39) missense probably damaging 1.00
R7344:Lrrc8e UTSW 8 4,284,815 (GRCm39) missense probably damaging 1.00
R7350:Lrrc8e UTSW 8 4,285,626 (GRCm39) missense probably benign 0.14
R7555:Lrrc8e UTSW 8 4,284,363 (GRCm39) missense probably benign 0.05
R7691:Lrrc8e UTSW 8 4,284,534 (GRCm39) missense probably damaging 1.00
R8112:Lrrc8e UTSW 8 4,285,575 (GRCm39) missense probably benign 0.14
R8184:Lrrc8e UTSW 8 4,285,140 (GRCm39) missense probably damaging 0.99
R8328:Lrrc8e UTSW 8 4,285,641 (GRCm39) missense probably damaging 1.00
R8355:Lrrc8e UTSW 8 4,284,018 (GRCm39) missense probably benign 0.02
R8487:Lrrc8e UTSW 8 4,284,218 (GRCm39) missense probably damaging 1.00
R8810:Lrrc8e UTSW 8 4,285,070 (GRCm39) missense probably benign 0.03
R8971:Lrrc8e UTSW 8 4,284,141 (GRCm39) missense probably damaging 1.00
R9150:Lrrc8e UTSW 8 4,286,030 (GRCm39) missense probably benign 0.06
R9225:Lrrc8e UTSW 8 4,284,561 (GRCm39) missense probably damaging 1.00
R9255:Lrrc8e UTSW 8 4,284,504 (GRCm39) missense probably damaging 1.00
R9442:Lrrc8e UTSW 8 4,283,964 (GRCm39) missense probably benign 0.01
R9463:Lrrc8e UTSW 8 4,285,185 (GRCm39) missense probably damaging 0.99
R9475:Lrrc8e UTSW 8 4,285,346 (GRCm39) missense probably benign
Z1176:Lrrc8e UTSW 8 4,284,822 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TTCATCTCCATCCTGGGCAAG -3'
(R):5'- CACCAGAAAGCTGATCTTCTCC -3'

Sequencing Primer
(F):5'- GCAAGTGCTTTGATTCTCCATGGAC -3'
(R):5'- AGCTGATCTTCTCCACATAGATCAGG -3'
Posted On 2021-12-30