Incidental Mutation 'R9088:Gm19410'
ID 690761
Institutional Source Beutler Lab
Gene Symbol Gm19410
Ensembl Gene ENSMUSG00000109372
Gene Name predicted gene, 19410
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock # R9088 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 35765790-35818047 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 35773612 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 214 (D214V)
Ref Sequence ENSEMBL: ENSMUSP00000147162 (fasta)
AlphaFold A0A140LJC7
Predicted Effect probably damaging
Transcript: ENSMUST00000207505
AA Change: D214V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak9 A G 10: 41,406,874 Y1212C Het
Asah2 T C 19: 32,052,960 Q104R probably damaging Het
Bnipl T A 3: 95,250,984 R9* probably null Het
Bpifa3 A C 2: 154,133,765 N85T possibly damaging Het
C6 T C 15: 4,763,474 Y354H probably damaging Het
Caln1 A T 5: 130,414,776 probably benign Het
Capn3 T C 2: 120,490,970 F378L probably benign Het
Car6 T C 4: 150,197,349 H125R probably damaging Het
Ccdc110 G A 8: 45,941,845 E258K probably damaging Het
Cep295 C A 9: 15,322,519 R2327L probably benign Het
Col14a1 T A 15: 55,363,527 D224E unknown Het
Col16a1 T A 4: 130,077,223 S938T unknown Het
Col4a2 A G 8: 11,443,227 E1340G possibly damaging Het
Col6a6 C T 9: 105,784,077 V278M probably damaging Het
Crybg2 T A 4: 134,072,579 L41Q probably damaging Het
Ctss A T 3: 95,529,556 D50V possibly damaging Het
Ddx56 C T 11: 6,259,612 A500T probably benign Het
Dmbt1 T C 7: 131,116,689 V1713A unknown Het
Dnah1 T C 14: 31,266,013 I3483V probably benign Het
E130308A19Rik T A 4: 59,737,594 F402I probably benign Het
Eml6 A T 11: 29,818,424 H754Q probably damaging Het
Ern2 A G 7: 122,173,667 Y576H probably damaging Het
Fat4 T C 3: 39,007,299 S4344P probably benign Het
Fbxo40 A G 16: 36,969,788 I320T Het
Fbxw22 C T 9: 109,378,884 D440N probably damaging Het
Fgd2 A G 17: 29,364,939 E109G probably damaging Het
Gm17359 G A 3: 79,430,122 G185D probably damaging Het
Gm884 T C 11: 103,620,936 K69E unknown Het
Hivep2 T C 10: 14,131,251 Y1198H probably damaging Het
Itpr3 G A 17: 27,118,677 probably benign Het
Lrrc8e G A 8: 4,234,410 V212M probably damaging Het
Map2 A T 1: 66,414,614 S888C probably damaging Het
Met G T 6: 17,548,716 G920* probably null Het
Mlkl G T 8: 111,322,733 R253S Het
Mmachc T A 4: 116,704,632 I102F probably damaging Het
Mnt G T 11: 74,843,054 V504L unknown Het
Mup14 C T 4: 61,302,497 G96D probably damaging Het
Myh13 G A 11: 67,352,059 E933K probably damaging Het
Ncoa6 A G 2: 155,407,806 S1193P probably damaging Het
Nek10 T C 14: 14,931,314 I762T probably damaging Het
Nmur1 G T 1: 86,387,530 F204L probably benign Het
Olfr151 T A 9: 37,730,510 I158F probably damaging Het
Olfr356 A G 2: 36,937,976 N286D probably damaging Het
Olfr672 G T 7: 104,996,094 P270Q probably damaging Het
Pappa2 T C 1: 158,936,357 Y528C probably damaging Het
Patl1 T C 19: 11,942,925 S748P possibly damaging Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Polr1a A G 6: 71,931,783 T531A probably benign Het
Slit3 C T 11: 35,121,636 S41F possibly damaging Het
Snap29 A G 16: 17,428,194 Q226R probably damaging Het
Tmpo A G 10: 91,153,276 probably null Het
Tnfrsf21 G A 17: 43,037,716 G73E probably damaging Het
Tsc1 T A 2: 28,662,605 C119S possibly damaging Het
Uox A G 3: 146,624,614 Y199C probably damaging Het
Vav2 T C 2: 27,297,696 D231G possibly damaging Het
Vmn2r80 A T 10: 79,169,544 K338N probably benign Het
Xylt2 G A 11: 94,670,403 T178I probably benign Het
Zfp931 G T 2: 178,067,801 T264K probably damaging Het
Zgrf1 A G 3: 127,583,677 D857G probably benign Het
Other mutations in Gm19410
AlleleSourceChrCoordTypePredicted EffectPPH Score
BB009:Gm19410 UTSW 8 35795599 missense probably damaging 0.98
BB019:Gm19410 UTSW 8 35795599 missense probably damaging 0.98
R0046:Gm19410 UTSW 8 35802645 missense probably benign 0.31
R6026:Gm19410 UTSW 8 35812426 missense probably benign 0.03
R6039:Gm19410 UTSW 8 35809364 missense probably benign 0.44
R6039:Gm19410 UTSW 8 35809364 missense probably benign 0.44
R6185:Gm19410 UTSW 8 35807510 missense possibly damaging 0.87
R6239:Gm19410 UTSW 8 35778764 missense probably damaging 0.98
R6303:Gm19410 UTSW 8 35807560 missense possibly damaging 0.96
R6377:Gm19410 UTSW 8 35803582 nonsense probably null
R6545:Gm19410 UTSW 8 35790498 missense possibly damaging 0.93
R6700:Gm19410 UTSW 8 35807510 missense possibly damaging 0.87
R6720:Gm19410 UTSW 8 35807576 missense probably benign 0.12
R6795:Gm19410 UTSW 8 35795522 missense probably damaging 0.98
R6808:Gm19410 UTSW 8 35772579 missense probably damaging 0.99
R6810:Gm19410 UTSW 8 35772579 missense probably damaging 0.99
R6811:Gm19410 UTSW 8 35772579 missense probably damaging 0.99
R6966:Gm19410 UTSW 8 35817973 missense possibly damaging 0.84
R7264:Gm19410 UTSW 8 35785766 missense probably benign 0.01
R7267:Gm19410 UTSW 8 35814843 missense possibly damaging 0.80
R7355:Gm19410 UTSW 8 35807072 missense probably benign 0.00
R7423:Gm19410 UTSW 8 35804607 missense probably benign 0.28
R7494:Gm19410 UTSW 8 35795530 missense probably damaging 0.99
R7516:Gm19410 UTSW 8 35796279 missense probably benign 0.30
R7517:Gm19410 UTSW 8 35773618 missense possibly damaging 0.45
R7526:Gm19410 UTSW 8 35790612 missense probably damaging 0.98
R7527:Gm19410 UTSW 8 35802232 missense probably damaging 0.99
R7545:Gm19410 UTSW 8 35802625 missense probably damaging 0.99
R7549:Gm19410 UTSW 8 35799346 missense probably benign 0.20
R7564:Gm19410 UTSW 8 35806997 missense probably benign 0.00
R7615:Gm19410 UTSW 8 35796359 missense probably damaging 1.00
R7622:Gm19410 UTSW 8 35810347 missense possibly damaging 0.91
R7655:Gm19410 UTSW 8 35809099 missense probably benign
R7656:Gm19410 UTSW 8 35809099 missense probably benign
R7703:Gm19410 UTSW 8 35799385 missense probably damaging 0.98
R7750:Gm19410 UTSW 8 35807498 missense possibly damaging 0.68
R7760:Gm19410 UTSW 8 35802337 missense probably damaging 0.99
R7837:Gm19410 UTSW 8 35808980 missense possibly damaging 0.91
R7932:Gm19410 UTSW 8 35795599 missense probably damaging 0.98
R7942:Gm19410 UTSW 8 35771786 missense probably damaging 0.98
R7970:Gm19410 UTSW 8 35815647 missense probably benign 0.00
R8088:Gm19410 UTSW 8 35806841 missense probably benign 0.45
R8228:Gm19410 UTSW 8 35785838 missense possibly damaging 0.53
R8382:Gm19410 UTSW 8 35809148 missense probably damaging 0.99
R8757:Gm19410 UTSW 8 35808965 missense possibly damaging 0.83
R8879:Gm19410 UTSW 8 35771868 missense probably damaging 0.99
R9010:Gm19410 UTSW 8 35814857 missense probably benign 0.02
R9060:Gm19410 UTSW 8 35802326 missense probably damaging 1.00
R9104:Gm19410 UTSW 8 35780467 missense probably damaging 0.99
R9186:Gm19410 UTSW 8 35815475 missense possibly damaging 0.90
R9290:Gm19410 UTSW 8 35802232 missense probably damaging 0.99
R9334:Gm19410 UTSW 8 35803568 nonsense probably null
R9398:Gm19410 UTSW 8 35805202 missense probably benign 0.00
R9439:Gm19410 UTSW 8 35781656 missense probably damaging 0.96
R9445:Gm19410 UTSW 8 35772498 missense possibly damaging 0.75
R9511:Gm19410 UTSW 8 35790694 missense probably damaging 0.99
R9520:Gm19410 UTSW 8 35795483 missense probably benign 0.15
R9523:Gm19410 UTSW 8 35790454 missense probably benign 0.01
R9669:Gm19410 UTSW 8 35780339 missense possibly damaging 0.45
R9711:Gm19410 UTSW 8 35812339 missense possibly damaging 0.85
R9728:Gm19410 UTSW 8 35780440 missense possibly damaging 0.95
R9759:Gm19410 UTSW 8 35785784 missense possibly damaging 0.53
Z1176:Gm19410 UTSW 8 35792611 missense possibly damaging 0.79
Z1177:Gm19410 UTSW 8 35808965 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GCCACGTAACCTACTGAAAGA -3'
(R):5'- AGGGACAAAGATAACTGCCTC -3'

Sequencing Primer
(F):5'- CACGTAACCTACTGAAAGAGTTGTC -3'
(R):5'- CAAGCATTCTCTCAAGGAGTTGGTC -3'
Posted On 2021-12-30