Incidental Mutation 'R9088:Fgd2'
ID 690786
Institutional Source Beutler Lab
Gene Symbol Fgd2
Ensembl Gene ENSMUSG00000024013
Gene Name FYVE, RhoGEF and PH domain containing 2
Synonyms Tcd-2, tcs2, Tcd2, tcs-2
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.342) question?
Stock # R9088 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 29360914-29379660 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 29364939 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 109 (E109G)
Ref Sequence ENSEMBL: ENSMUSP00000024810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024810] [ENSMUST00000123989]
AlphaFold Q8BY35
Predicted Effect probably damaging
Transcript: ENSMUST00000024810
AA Change: E109G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024810
Gene: ENSMUSG00000024013
AA Change: E109G

DomainStartEndE-ValueType
RhoGEF 106 289 4.49e-66 SMART
PH 320 420 2.09e-16 SMART
FYVE 450 519 1.07e-28 SMART
PH 545 643 5.09e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000123989
AA Change: E109G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118828
Gene: ENSMUSG00000024013
AA Change: E109G

DomainStartEndE-ValueType
RhoGEF 106 289 4.49e-66 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of guanine nucleotide exchange factors (GEFs) which control cytoskeleton-dependent membrane rearrangements by activating the cell division cycle 42 (CDC42) protein. This gene is expressed in B lymphocytes, macrophages, and dendritic cells. The encoded protein may play a role in leukocyte signaling and vesicle trafficking in antigen-presenting cells in the immune system. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak9 A G 10: 41,406,874 Y1212C Het
Asah2 T C 19: 32,052,960 Q104R probably damaging Het
Bnipl T A 3: 95,250,984 R9* probably null Het
Bpifa3 A C 2: 154,133,765 N85T possibly damaging Het
C6 T C 15: 4,763,474 Y354H probably damaging Het
Caln1 A T 5: 130,414,776 probably benign Het
Capn3 T C 2: 120,490,970 F378L probably benign Het
Car6 T C 4: 150,197,349 H125R probably damaging Het
Ccdc110 G A 8: 45,941,845 E258K probably damaging Het
Cep295 C A 9: 15,322,519 R2327L probably benign Het
Col14a1 T A 15: 55,363,527 D224E unknown Het
Col16a1 T A 4: 130,077,223 S938T unknown Het
Col4a2 A G 8: 11,443,227 E1340G possibly damaging Het
Col6a6 C T 9: 105,784,077 V278M probably damaging Het
Crybg2 T A 4: 134,072,579 L41Q probably damaging Het
Ctss A T 3: 95,529,556 D50V possibly damaging Het
Ddx56 C T 11: 6,259,612 A500T probably benign Het
Dmbt1 T C 7: 131,116,689 V1713A unknown Het
Dnah1 T C 14: 31,266,013 I3483V probably benign Het
E130308A19Rik T A 4: 59,737,594 F402I probably benign Het
Eml6 A T 11: 29,818,424 H754Q probably damaging Het
Ern2 A G 7: 122,173,667 Y576H probably damaging Het
Fat4 T C 3: 39,007,299 S4344P probably benign Het
Fbxo40 A G 16: 36,969,788 I320T Het
Fbxw22 C T 9: 109,378,884 D440N probably damaging Het
Gm17359 G A 3: 79,430,122 G185D probably damaging Het
Gm19410 A T 8: 35,773,612 D214V probably damaging Het
Gm884 T C 11: 103,620,936 K69E unknown Het
Hivep2 T C 10: 14,131,251 Y1198H probably damaging Het
Itpr3 G A 17: 27,118,677 probably benign Het
Lrrc8e G A 8: 4,234,410 V212M probably damaging Het
Map2 A T 1: 66,414,614 S888C probably damaging Het
Met G T 6: 17,548,716 G920* probably null Het
Mlkl G T 8: 111,322,733 R253S Het
Mmachc T A 4: 116,704,632 I102F probably damaging Het
Mnt G T 11: 74,843,054 V504L unknown Het
Mup14 C T 4: 61,302,497 G96D probably damaging Het
Myh13 G A 11: 67,352,059 E933K probably damaging Het
Ncoa6 A G 2: 155,407,806 S1193P probably damaging Het
Nek10 T C 14: 14,931,314 I762T probably damaging Het
Nmur1 G T 1: 86,387,530 F204L probably benign Het
Olfr151 T A 9: 37,730,510 I158F probably damaging Het
Olfr356 A G 2: 36,937,976 N286D probably damaging Het
Olfr672 G T 7: 104,996,094 P270Q probably damaging Het
Pappa2 T C 1: 158,936,357 Y528C probably damaging Het
Patl1 T C 19: 11,942,925 S748P possibly damaging Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Polr1a A G 6: 71,931,783 T531A probably benign Het
Slit3 C T 11: 35,121,636 S41F possibly damaging Het
Snap29 A G 16: 17,428,194 Q226R probably damaging Het
Tmpo A G 10: 91,153,276 probably null Het
Tnfrsf21 G A 17: 43,037,716 G73E probably damaging Het
Tsc1 T A 2: 28,662,605 C119S possibly damaging Het
Uox A G 3: 146,624,614 Y199C probably damaging Het
Vav2 T C 2: 27,297,696 D231G possibly damaging Het
Vmn2r80 A T 10: 79,169,544 K338N probably benign Het
Xylt2 G A 11: 94,670,403 T178I probably benign Het
Zfp931 G T 2: 178,067,801 T264K probably damaging Het
Zgrf1 A G 3: 127,583,677 D857G probably benign Het
Other mutations in Fgd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01397:Fgd2 APN 17 29367975 missense probably damaging 1.00
IGL01505:Fgd2 APN 17 29366997 missense probably damaging 1.00
IGL03240:Fgd2 APN 17 29361161 splice site probably benign
ceci UTSW 17 29368376 splice site probably null
R0046:Fgd2 UTSW 17 29374990 splice site probably benign
R0271:Fgd2 UTSW 17 29367008 missense possibly damaging 0.94
R0594:Fgd2 UTSW 17 29365552 missense probably damaging 1.00
R0612:Fgd2 UTSW 17 29378347 missense probably benign 0.45
R1470:Fgd2 UTSW 17 29374108 splice site probably benign
R1551:Fgd2 UTSW 17 29378409 missense probably damaging 1.00
R1596:Fgd2 UTSW 17 29376930 missense probably benign 0.43
R1664:Fgd2 UTSW 17 29369299 missense probably damaging 1.00
R1689:Fgd2 UTSW 17 29363722 missense probably benign
R1691:Fgd2 UTSW 17 29378944 nonsense probably null
R1695:Fgd2 UTSW 17 29368245 missense possibly damaging 0.88
R2697:Fgd2 UTSW 17 29376921 missense probably damaging 1.00
R3500:Fgd2 UTSW 17 29365601 missense possibly damaging 0.74
R3689:Fgd2 UTSW 17 29378950 missense probably benign 0.00
R4583:Fgd2 UTSW 17 29367078 missense possibly damaging 0.87
R4871:Fgd2 UTSW 17 29373249 missense possibly damaging 0.89
R5011:Fgd2 UTSW 17 29374980 critical splice donor site probably null
R5209:Fgd2 UTSW 17 29368376 splice site probably null
R7106:Fgd2 UTSW 17 29376970 nonsense probably null
R7139:Fgd2 UTSW 17 29373255 missense probably damaging 1.00
R7712:Fgd2 UTSW 17 29376912 missense probably benign 0.01
R7833:Fgd2 UTSW 17 29367395 missense possibly damaging 0.81
R7834:Fgd2 UTSW 17 29364951 missense probably damaging 1.00
R7913:Fgd2 UTSW 17 29374045 missense probably damaging 1.00
R8547:Fgd2 UTSW 17 29364960 missense probably damaging 0.99
R8686:Fgd2 UTSW 17 29379023 missense probably benign
R9525:Fgd2 UTSW 17 29364981 missense probably damaging 1.00
Z1177:Fgd2 UTSW 17 29378326 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TTAACCTGAAGACTCAGCCCTG -3'
(R):5'- CATGAGGTGCTAAAGGGCTCAG -3'

Sequencing Primer
(F):5'- CCTTTCTAGGCTGTACTATGAAAGC -3'
(R):5'- CTAAAGGGCTCAGTTCTGATGC -3'
Posted On 2021-12-30