Incidental Mutation 'R9088:Asah2'
ID 690789
Institutional Source Beutler Lab
Gene Symbol Asah2
Ensembl Gene ENSMUSG00000024887
Gene Name N-acylsphingosine amidohydrolase 2
Synonyms neutral/alkaline ceramidase
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.299) question?
Stock # R9088 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 31984654-32061469 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 32052960 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 104 (Q104R)
Ref Sequence ENSEMBL: ENSMUSP00000093830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096119]
AlphaFold Q9JHE3
Predicted Effect probably damaging
Transcript: ENSMUST00000096119
AA Change: Q104R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000093830
Gene: ENSMUSG00000024887
AA Change: Q104R

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 56 67 N/A INTRINSIC
Pfam:Ceramidase_alk 78 584 1.4e-222 PFAM
Pfam:Ceramidse_alk_C 586 753 8e-50 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ceramidases (EC 3.5.1.23), such as ASAH2, catalyze hydrolysis of the N-acyl linkage of ceramide, a second messenger in a variety of cellular events, to produce sphingosine. Sphingosine exerts both mitogenic and apoptosis-inducing activities, and its phosphorylated form functions as an intra- and intercellular second messenger (see MIM 603730) (Mitsutake et al., 2001 [PubMed 11328816]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are defective in the intestinal digestion of dietary ceramide but exhibit a normal life span with no obvious abnormalities or significant alterations in total ceramide levels in major organ tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak9 A G 10: 41,406,874 Y1212C Het
Bnipl T A 3: 95,250,984 R9* probably null Het
Bpifa3 A C 2: 154,133,765 N85T possibly damaging Het
C6 T C 15: 4,763,474 Y354H probably damaging Het
Caln1 A T 5: 130,414,776 probably benign Het
Capn3 T C 2: 120,490,970 F378L probably benign Het
Car6 T C 4: 150,197,349 H125R probably damaging Het
Ccdc110 G A 8: 45,941,845 E258K probably damaging Het
Cep295 C A 9: 15,322,519 R2327L probably benign Het
Col14a1 T A 15: 55,363,527 D224E unknown Het
Col16a1 T A 4: 130,077,223 S938T unknown Het
Col4a2 A G 8: 11,443,227 E1340G possibly damaging Het
Col6a6 C T 9: 105,784,077 V278M probably damaging Het
Crybg2 T A 4: 134,072,579 L41Q probably damaging Het
Ctss A T 3: 95,529,556 D50V possibly damaging Het
Ddx56 C T 11: 6,259,612 A500T probably benign Het
Dmbt1 T C 7: 131,116,689 V1713A unknown Het
Dnah1 T C 14: 31,266,013 I3483V probably benign Het
E130308A19Rik T A 4: 59,737,594 F402I probably benign Het
Eml6 A T 11: 29,818,424 H754Q probably damaging Het
Ern2 A G 7: 122,173,667 Y576H probably damaging Het
Fat4 T C 3: 39,007,299 S4344P probably benign Het
Fbxo40 A G 16: 36,969,788 I320T Het
Fbxw22 C T 9: 109,378,884 D440N probably damaging Het
Fgd2 A G 17: 29,364,939 E109G probably damaging Het
Gm17359 G A 3: 79,430,122 G185D probably damaging Het
Gm19410 A T 8: 35,773,612 D214V probably damaging Het
Gm884 T C 11: 103,620,936 K69E unknown Het
Hivep2 T C 10: 14,131,251 Y1198H probably damaging Het
Itpr3 G A 17: 27,118,677 probably benign Het
Lrrc8e G A 8: 4,234,410 V212M probably damaging Het
Map2 A T 1: 66,414,614 S888C probably damaging Het
Met G T 6: 17,548,716 G920* probably null Het
Mlkl G T 8: 111,322,733 R253S Het
Mmachc T A 4: 116,704,632 I102F probably damaging Het
Mnt G T 11: 74,843,054 V504L unknown Het
Mup14 C T 4: 61,302,497 G96D probably damaging Het
Myh13 G A 11: 67,352,059 E933K probably damaging Het
Ncoa6 A G 2: 155,407,806 S1193P probably damaging Het
Nek10 T C 14: 14,931,314 I762T probably damaging Het
Nmur1 G T 1: 86,387,530 F204L probably benign Het
Olfr151 T A 9: 37,730,510 I158F probably damaging Het
Olfr356 A G 2: 36,937,976 N286D probably damaging Het
Olfr672 G T 7: 104,996,094 P270Q probably damaging Het
Pappa2 T C 1: 158,936,357 Y528C probably damaging Het
Patl1 T C 19: 11,942,925 S748P possibly damaging Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Polr1a A G 6: 71,931,783 T531A probably benign Het
Slit3 C T 11: 35,121,636 S41F possibly damaging Het
Snap29 A G 16: 17,428,194 Q226R probably damaging Het
Tmpo A G 10: 91,153,276 probably null Het
Tnfrsf21 G A 17: 43,037,716 G73E probably damaging Het
Tsc1 T A 2: 28,662,605 C119S possibly damaging Het
Uox A G 3: 146,624,614 Y199C probably damaging Het
Vav2 T C 2: 27,297,696 D231G possibly damaging Het
Vmn2r80 A T 10: 79,169,544 K338N probably benign Het
Xylt2 G A 11: 94,670,403 T178I probably benign Het
Zfp931 G T 2: 178,067,801 T264K probably damaging Het
Zgrf1 A G 3: 127,583,677 D857G probably benign Het
Other mutations in Asah2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Asah2 APN 19 32008681 splice site probably benign
IGL02001:Asah2 APN 19 32043539 nonsense probably null
IGL02228:Asah2 APN 19 32016714 missense probably benign 0.09
IGL02377:Asah2 APN 19 32009414 missense probably benign 0.30
IGL03070:Asah2 APN 19 32006344 missense probably damaging 1.00
IGL03233:Asah2 APN 19 32054631 missense probably benign 0.18
IGL03244:Asah2 APN 19 31986942 missense probably damaging 1.00
R0008:Asah2 UTSW 19 32003731 nonsense probably null
R0103:Asah2 UTSW 19 32018977 missense probably benign 0.01
R0103:Asah2 UTSW 19 32018977 missense probably benign 0.01
R0302:Asah2 UTSW 19 32052956 missense probably benign 0.01
R0497:Asah2 UTSW 19 32054631 missense probably benign 0.18
R0614:Asah2 UTSW 19 32016728 missense probably damaging 1.00
R0639:Asah2 UTSW 19 32008639 missense probably damaging 0.99
R0715:Asah2 UTSW 19 32016776 missense probably damaging 0.97
R1332:Asah2 UTSW 19 32044941 missense probably damaging 1.00
R1336:Asah2 UTSW 19 32044941 missense probably damaging 1.00
R2045:Asah2 UTSW 19 32052956 missense probably benign 0.01
R2062:Asah2 UTSW 19 32024874 missense probably damaging 0.99
R4083:Asah2 UTSW 19 31986784 missense probably benign 0.01
R4698:Asah2 UTSW 19 32054471 splice site probably null
R4731:Asah2 UTSW 19 31995358 missense probably benign 0.41
R4732:Asah2 UTSW 19 31995358 missense probably benign 0.41
R4733:Asah2 UTSW 19 31995358 missense probably benign 0.41
R4773:Asah2 UTSW 19 32052858 missense probably damaging 1.00
R4930:Asah2 UTSW 19 32052906 missense probably benign 0.35
R5081:Asah2 UTSW 19 32014308 missense probably benign 0.07
R5741:Asah2 UTSW 19 32008615 missense probably damaging 1.00
R5873:Asah2 UTSW 19 32003682 critical splice donor site probably null
R5905:Asah2 UTSW 19 32016514 missense probably damaging 1.00
R6027:Asah2 UTSW 19 32044951 missense probably benign 0.01
R6028:Asah2 UTSW 19 32016514 missense probably damaging 1.00
R6187:Asah2 UTSW 19 32024867 missense probably damaging 0.99
R6667:Asah2 UTSW 19 31995358 missense probably benign 0.41
R6968:Asah2 UTSW 19 32012513 missense probably benign
R7010:Asah2 UTSW 19 32054554 missense probably benign 0.00
R7404:Asah2 UTSW 19 32057854 missense probably benign 0.13
R7575:Asah2 UTSW 19 32016703 missense probably benign 0.11
R7797:Asah2 UTSW 19 32022361 missense probably damaging 1.00
R8492:Asah2 UTSW 19 32006259 missense probably benign 0.25
R8682:Asah2 UTSW 19 32052877 missense probably damaging 1.00
R8766:Asah2 UTSW 19 32057880 missense possibly damaging 0.46
R8873:Asah2 UTSW 19 32044888 critical splice donor site probably null
R8974:Asah2 UTSW 19 32052905 missense probably benign
R9405:Asah2 UTSW 19 32008645 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- AGGAAGGGCATCCACCTATG -3'
(R):5'- CTTTCTCTGTACAAATACCAAAGGC -3'

Sequencing Primer
(F):5'- ACACCTTACTTTGAAGGTAGGAG -3'
(R):5'- CCAAAGGCTTTATCATGATTTTGG -3'
Posted On 2021-12-30