Incidental Mutation 'R9089:Eftud2'
ID 690838
Institutional Source Beutler Lab
Gene Symbol Eftud2
Ensembl Gene ENSMUSG00000020929
Gene Name elongation factor Tu GTP binding domain containing 2
Synonyms 116kDa, Snrp116, U5-116kD
MMRRC Submission 068907-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9089 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 102729299-102771811 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 102759971 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 125 (S125P)
Ref Sequence ENSEMBL: ENSMUSP00000102675 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021306] [ENSMUST00000107060] [ENSMUST00000138483] [ENSMUST00000173679]
AlphaFold O08810
Predicted Effect probably benign
Transcript: ENSMUST00000021306
AA Change: S126P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021306
Gene: ENSMUSG00000020929
AA Change: S126P

DomainStartEndE-ValueType
Pfam:EFTUD2 3 110 1.1e-42 PFAM
Pfam:GTP_EFTU 127 440 9.6e-47 PFAM
Pfam:GTP_EFTU_D2 489 566 3.8e-15 PFAM
Pfam:EFG_II 584 656 9.9e-11 PFAM
EFG_IV 703 824 1.1e-16 SMART
EFG_C 826 915 1.14e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107060
AA Change: S125P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102675
Gene: ENSMUSG00000020929
AA Change: S125P

DomainStartEndE-ValueType
low complexity region 16 26 N/A INTRINSIC
low complexity region 32 50 N/A INTRINSIC
Pfam:GTP_EFTU 126 439 9.6e-44 PFAM
Pfam:Miro 130 260 2.5e-6 PFAM
Pfam:GTP_EFTU_D2 488 565 7.9e-13 PFAM
Pfam:EFG_II 583 655 8.2e-10 PFAM
EFG_IV 702 823 1.1e-16 SMART
EFG_C 825 914 1.14e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138483
Predicted Effect probably benign
Transcript: ENSMUST00000173679
AA Change: S126P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134327
Gene: ENSMUSG00000020929
AA Change: S126P

DomainStartEndE-ValueType
low complexity region 16 26 N/A INTRINSIC
low complexity region 29 51 N/A INTRINSIC
Pfam:GTP_EFTU 127 430 2.2e-36 PFAM
Pfam:GTP_EFTU_D2 479 556 7.8e-13 PFAM
Pfam:EFG_II 574 646 8.1e-10 PFAM
EFG_IV 693 814 1.1e-16 SMART
EFG_C 816 905 1.14e-14 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GTPase which is a component of the spliceosome complex which processes precursor mRNAs to produce mature mRNAs. Mutations in this gene are associated with mandibulofacial dysostosis with microcephaly. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik T A 17: 48,347,951 (GRCm39) R118* probably null Het
Acadsb T C 7: 131,027,504 (GRCm39) V68A probably damaging Het
Adgb T C 10: 10,318,432 (GRCm39) R137G probably benign Het
Adgrl3 C A 5: 81,808,291 (GRCm39) N622K possibly damaging Het
Ager C A 17: 34,819,579 (GRCm39) P366T probably benign Het
Barx2 C A 9: 31,765,443 (GRCm39) W184L probably damaging Het
Bckdha A C 7: 25,341,144 (GRCm39) N72K probably benign Het
Blm A T 7: 80,162,867 (GRCm39) D161E probably damaging Het
Ccdc121rt2 A T 5: 112,598,757 (GRCm39) R435W probably damaging Het
Cd96 G T 16: 45,870,068 (GRCm39) T467N probably benign Het
Cdk13 A T 13: 17,978,444 (GRCm39) S265T unknown Het
Col6a5 A C 9: 105,766,142 (GRCm39) I1926S probably damaging Het
Csgalnact2 A T 6: 118,097,983 (GRCm39) V361D probably damaging Het
Cstf1 T A 2: 172,217,807 (GRCm39) M140K Het
Ddx41 A T 13: 55,683,424 (GRCm39) S128T probably benign Het
Deaf1 A T 7: 140,877,465 (GRCm39) V554D probably damaging Het
Dido1 C T 2: 180,303,293 (GRCm39) S1537N probably benign Het
Dmwd T C 7: 18,811,980 (GRCm39) S145P probably damaging Het
Gga1 A G 15: 78,773,952 (GRCm39) D325G probably damaging Het
Gm43518 T C 5: 124,072,329 (GRCm39) probably null Het
Got1l1 A T 8: 27,690,889 (GRCm39) V53E probably damaging Het
Helz2 A T 2: 180,881,433 (GRCm39) C350S probably damaging Het
Ipo7 T A 7: 109,643,666 (GRCm39) F398I possibly damaging Het
Itga11 A G 9: 62,678,662 (GRCm39) N943S probably damaging Het
Itpa T A 2: 130,509,857 (GRCm39) probably null Het
Itpr3 G A 17: 27,337,651 (GRCm39) probably benign Het
Kbtbd4 A T 2: 90,737,909 (GRCm39) N220Y possibly damaging Het
Kdm5b T A 1: 134,535,506 (GRCm39) F594L probably damaging Het
Klhdc4 C T 8: 122,524,684 (GRCm39) V446I probably benign Het
Klk1b1 A G 7: 43,620,668 (GRCm39) I253V possibly damaging Het
Kynu T A 2: 43,489,620 (GRCm39) M135K probably damaging Het
Lgi1 T C 19: 38,294,095 (GRCm39) I289T possibly damaging Het
Lhx2 A G 2: 38,250,045 (GRCm39) N288S probably damaging Het
Lrp6 G C 6: 134,488,169 (GRCm39) A309G probably damaging Het
Map2 T A 1: 66,452,098 (GRCm39) N329K probably benign Het
Med15 G A 16: 17,473,421 (GRCm39) P476L unknown Het
Muc16 A T 9: 18,555,846 (GRCm39) N3482K unknown Het
Nemf A C 12: 69,400,628 (GRCm39) V149G probably damaging Het
Notch3 T C 17: 32,370,521 (GRCm39) S706G probably benign Het
Nphp4 T C 4: 152,645,673 (GRCm39) V1227A possibly damaging Het
Or1e31 A G 11: 73,690,052 (GRCm39) F177S probably damaging Het
Or2a52 A T 6: 43,144,917 (GRCm39) R308S probably benign Het
Or6c70 A G 10: 129,710,488 (GRCm39) L46P probably damaging Het
Parp2 A G 14: 51,052,327 (GRCm39) T102A probably damaging Het
Pcdhgc3 T C 18: 37,941,264 (GRCm39) V555A possibly damaging Het
Plk5 C G 10: 80,193,830 (GRCm39) R40G probably damaging Het
Ralgapa1 A C 12: 55,723,351 (GRCm39) L1725R probably damaging Het
Reln G T 5: 22,130,198 (GRCm39) D2704E probably benign Het
Sart3 C A 5: 113,891,756 (GRCm39) E405D possibly damaging Het
Scin A T 12: 40,131,703 (GRCm39) L277* probably null Het
Sec62 T A 3: 30,868,383 (GRCm39) V204E probably benign Het
Serpina3a T C 12: 104,085,956 (GRCm39) I137T possibly damaging Het
Sh3rf1 T C 8: 61,825,613 (GRCm39) M536T probably benign Het
Slc45a4 T C 15: 73,457,953 (GRCm39) H532R probably damaging Het
Svs5 A G 2: 164,079,341 (GRCm39) F189L probably benign Het
Synm T C 7: 67,408,766 (GRCm39) D204G probably damaging Het
Tmtc1 A T 6: 148,147,215 (GRCm39) H827Q possibly damaging Het
Tnfrsf25 T A 4: 152,201,929 (GRCm39) C135* probably null Het
Unc13b T G 4: 43,095,847 (GRCm39) I85S probably damaging Het
Ush2a T A 1: 188,487,374 (GRCm39) Y3047* probably null Het
Vmn1r75 T C 7: 11,614,453 (GRCm39) S62P probably damaging Het
Vps50 T C 6: 3,536,884 (GRCm39) V285A probably benign Het
Vwa5b1 T A 4: 138,296,742 (GRCm39) D1095V probably benign Het
Zdhhc21 T A 4: 82,725,292 (GRCm39) D208V probably damaging Het
Zfp422 A C 6: 116,604,086 (GRCm39) probably benign Het
Other mutations in Eftud2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Eftud2 APN 11 102,756,389 (GRCm39) splice site probably benign
IGL01765:Eftud2 APN 11 102,730,082 (GRCm39) missense probably damaging 0.99
IGL01868:Eftud2 APN 11 102,759,953 (GRCm39) missense probably benign 0.08
IGL02161:Eftud2 APN 11 102,745,702 (GRCm39) splice site probably benign
IGL02165:Eftud2 APN 11 102,742,573 (GRCm39) splice site probably benign
IGL02218:Eftud2 APN 11 102,761,039 (GRCm39) missense possibly damaging 0.46
IGL02386:Eftud2 APN 11 102,742,580 (GRCm39) splice site probably null
IGL02664:Eftud2 APN 11 102,732,538 (GRCm39) missense probably damaging 1.00
IGL02677:Eftud2 APN 11 102,737,440 (GRCm39) missense probably damaging 1.00
IGL02792:Eftud2 APN 11 102,761,082 (GRCm39) splice site probably benign
IGL02870:Eftud2 APN 11 102,753,452 (GRCm39) missense probably damaging 0.97
IGL03131:Eftud2 APN 11 102,761,009 (GRCm39) missense probably damaging 1.00
R0137:Eftud2 UTSW 11 102,759,443 (GRCm39) missense possibly damaging 0.94
R0244:Eftud2 UTSW 11 102,755,551 (GRCm39) missense probably damaging 0.97
R0358:Eftud2 UTSW 11 102,755,627 (GRCm39) splice site probably benign
R0463:Eftud2 UTSW 11 102,755,597 (GRCm39) missense probably damaging 1.00
R0511:Eftud2 UTSW 11 102,735,048 (GRCm39) missense probably damaging 1.00
R0525:Eftud2 UTSW 11 102,730,079 (GRCm39) missense probably damaging 1.00
R0586:Eftud2 UTSW 11 102,737,446 (GRCm39) missense probably damaging 1.00
R0751:Eftud2 UTSW 11 102,730,079 (GRCm39) missense probably damaging 1.00
R1034:Eftud2 UTSW 11 102,740,010 (GRCm39) missense probably benign
R1079:Eftud2 UTSW 11 102,730,870 (GRCm39) nonsense probably null
R1208:Eftud2 UTSW 11 102,755,592 (GRCm39) missense probably benign 0.22
R1208:Eftud2 UTSW 11 102,755,592 (GRCm39) missense probably benign 0.22
R1220:Eftud2 UTSW 11 102,742,573 (GRCm39) splice site probably benign
R1438:Eftud2 UTSW 11 102,750,868 (GRCm39) missense probably damaging 1.00
R1520:Eftud2 UTSW 11 102,730,266 (GRCm39) missense probably damaging 1.00
R1569:Eftud2 UTSW 11 102,745,597 (GRCm39) splice site probably benign
R2270:Eftud2 UTSW 11 102,755,607 (GRCm39) missense probably damaging 1.00
R3500:Eftud2 UTSW 11 102,735,006 (GRCm39) missense probably damaging 1.00
R3686:Eftud2 UTSW 11 102,735,027 (GRCm39) missense probably damaging 1.00
R3687:Eftud2 UTSW 11 102,735,027 (GRCm39) missense probably damaging 1.00
R3688:Eftud2 UTSW 11 102,735,027 (GRCm39) missense probably damaging 1.00
R3808:Eftud2 UTSW 11 102,732,289 (GRCm39) splice site probably null
R3892:Eftud2 UTSW 11 102,737,013 (GRCm39) missense probably damaging 0.99
R4003:Eftud2 UTSW 11 102,750,936 (GRCm39) missense possibly damaging 0.51
R4091:Eftud2 UTSW 11 102,730,242 (GRCm39) splice site probably null
R4794:Eftud2 UTSW 11 102,761,003 (GRCm39) missense probably benign 0.14
R4841:Eftud2 UTSW 11 102,745,640 (GRCm39) missense probably damaging 1.00
R4842:Eftud2 UTSW 11 102,745,640 (GRCm39) missense probably damaging 1.00
R5151:Eftud2 UTSW 11 102,758,670 (GRCm39) critical splice donor site probably null
R5208:Eftud2 UTSW 11 102,732,011 (GRCm39) missense probably damaging 1.00
R6199:Eftud2 UTSW 11 102,730,883 (GRCm39) missense probably damaging 1.00
R6357:Eftud2 UTSW 11 102,755,606 (GRCm39) missense probably damaging 1.00
R6720:Eftud2 UTSW 11 102,729,449 (GRCm39) nonsense probably null
R7604:Eftud2 UTSW 11 102,738,838 (GRCm39) missense possibly damaging 0.87
R7886:Eftud2 UTSW 11 102,730,934 (GRCm39) missense probably damaging 1.00
R8017:Eftud2 UTSW 11 102,734,174 (GRCm39) critical splice donor site probably null
R8019:Eftud2 UTSW 11 102,734,174 (GRCm39) critical splice donor site probably null
R8139:Eftud2 UTSW 11 102,758,685 (GRCm39) missense probably benign 0.04
R8431:Eftud2 UTSW 11 102,737,062 (GRCm39) missense probably benign 0.08
R8545:Eftud2 UTSW 11 102,731,097 (GRCm39) missense probably damaging 1.00
R8676:Eftud2 UTSW 11 102,759,447 (GRCm39) missense probably damaging 1.00
R9173:Eftud2 UTSW 11 102,734,242 (GRCm39) missense probably damaging 1.00
R9277:Eftud2 UTSW 11 102,750,855 (GRCm39) missense probably damaging 1.00
R9313:Eftud2 UTSW 11 102,730,262 (GRCm39) missense probably benign 0.03
R9604:Eftud2 UTSW 11 102,737,056 (GRCm39) missense probably benign 0.11
R9664:Eftud2 UTSW 11 102,759,422 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGATGGAATGACACAACGGTTC -3'
(R):5'- TGATCTTGGTTTCCAGCCTG -3'

Sequencing Primer
(F):5'- TGGAATGACACAACGGTTCCATAAG -3'
(R):5'- CCTGTGTTGTCTTGTGAGCACC -3'
Posted On 2021-12-30