Incidental Mutation 'R9090:Als2'
ID 690859
Institutional Source Beutler Lab
Gene Symbol Als2
Ensembl Gene ENSMUSG00000026024
Gene Name alsin Rho guanine nucleotide exchange factor
Synonyms 3222402C23Rik, Als2cr6, 9430073A21Rik, Alsin
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.696) question?
Stock # R9090 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 59162926-59237231 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 59203030 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 622 (T622K)
Ref Sequence ENSEMBL: ENSMUSP00000027178 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027178] [ENSMUST00000163058]
AlphaFold Q920R0
Predicted Effect probably benign
Transcript: ENSMUST00000027178
AA Change: T622K

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000027178
Gene: ENSMUSG00000026024
AA Change: T622K

DomainStartEndE-ValueType
Pfam:RCC1_2 93 122 1.1e-9 PFAM
Pfam:RCC1 109 165 9.5e-11 PFAM
Pfam:RCC1 170 216 6.6e-11 PFAM
low complexity region 268 282 N/A INTRINSIC
low complexity region 465 483 N/A INTRINSIC
Pfam:RCC1 521 568 5.4e-13 PFAM
Pfam:RCC1_2 555 584 8.3e-12 PFAM
Pfam:RCC1 571 619 3.4e-11 PFAM
Pfam:RhoGEF 688 877 6.5e-10 PFAM
PH 895 1001 2.17e0 SMART
MORN 1041 1062 1.34e-5 SMART
MORN 1064 1085 1.95e-1 SMART
MORN 1092 1113 6.68e-6 SMART
MORN 1115 1136 9.39e0 SMART
MORN 1143 1164 1.49e1 SMART
MORN 1167 1188 1.13e1 SMART
MORN 1190 1211 2.28e0 SMART
MORN 1213 1235 5.95e1 SMART
low complexity region 1470 1483 N/A INTRINSIC
Pfam:VPS9 1546 1650 8.6e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163058
AA Change: T622K

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000125753
Gene: ENSMUSG00000026024
AA Change: T622K

DomainStartEndE-ValueType
Pfam:RCC1_2 93 122 9.9e-10 PFAM
Pfam:RCC1 109 165 9.5e-12 PFAM
Pfam:RCC1 170 216 4.9e-12 PFAM
low complexity region 268 282 N/A INTRINSIC
low complexity region 465 483 N/A INTRINSIC
Pfam:RCC1 521 568 4.6e-14 PFAM
Pfam:RCC1_2 555 584 1.2e-11 PFAM
Pfam:RCC1 571 619 8.6e-11 PFAM
Pfam:RhoGEF 688 877 2.6e-10 PFAM
PH 895 1001 2.17e0 SMART
MORN 1041 1062 1.34e-5 SMART
MORN 1064 1085 1.95e-1 SMART
MORN 1092 1113 6.68e-6 SMART
MORN 1115 1136 9.39e0 SMART
MORN 1143 1164 1.49e1 SMART
MORN 1167 1188 1.13e1 SMART
MORN 1190 1211 2.28e0 SMART
MORN 1213 1235 5.95e1 SMART
low complexity region 1470 1483 N/A INTRINSIC
Pfam:VPS9 1546 1650 1e-24 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains an ATS1/RCC1-like domain, a RhoGEF domain, and a vacuolar protein sorting 9 (VPS9) domain, all of which are guanine-nucleotide exchange factors that activate members of the Ras superfamily of GTPases. The protein functions as a guanine nucleotide exchange factor for the small GTPase RAB5. The protein localizes with RAB5 on early endosomal compartments, and functions as a modulator for endosomal dynamics. Mutations in this gene result in several forms of juvenile lateral sclerosis and infantile-onset ascending spastic paralysis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous null mutations in this gene may result in increased body weight, altered endosome trafficking, modest motor behavioral abnormalities, altered anxiety responses, impaired axonal transport, and mild neurolopathogical deficits including axonal degeneration in the corticospinal tract. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A T 11: 120,011,114 S819T probably damaging Het
Abca13 A T 11: 9,291,698 D1187V probably damaging Het
AF366264 T C 8: 13,836,697 T465A possibly damaging Het
Ak9 C A 10: 41,424,627 T1611K unknown Het
Ankrd40 G A 11: 94,334,436 A98T probably benign Het
Ap1b1 T C 11: 5,023,174 L339P probably damaging Het
Appl1 A C 14: 26,947,127 H363Q probably benign Het
Atf6 T C 1: 170,794,676 N459D probably damaging Het
Ccdc129 G T 6: 55,967,066 R417L probably benign Het
Ccdc6 A T 10: 70,189,163 Q432L unknown Het
Ccl21a T A 4: 42,773,486 Q84L probably damaging Het
Cct4 A G 11: 23,001,389 I348V probably benign Het
Cd300ld2 A G 11: 115,013,724 Y106H probably damaging Het
Cdh19 C T 1: 110,949,217 E131K probably damaging Het
Cdon A G 9: 35,491,879 D1095G probably damaging Het
Cep85l T A 10: 53,281,574 R678* probably null Het
Chst3 T A 10: 60,185,643 S461C probably damaging Het
Clk1 A G 1: 58,420,153 I149T possibly damaging Het
Clvs2 T A 10: 33,513,305 D313V possibly damaging Het
Dap3 T C 3: 88,933,606 T75A probably benign Het
Dnaaf1 T A 8: 119,597,653 F631L probably benign Het
Dnah14 A T 1: 181,769,760 N3549I probably benign Het
Dnah17 A T 11: 118,041,044 Y3701N probably damaging Het
Dock6 A G 9: 21,841,500 V339A possibly damaging Het
Dpp6 T A 5: 27,598,834 C259* probably null Het
Dqx1 A G 6: 83,059,043 T119A probably benign Het
Dync1h1 G T 12: 110,616,876 R469L probably benign Het
Eno4 C T 19: 58,962,828 A424V probably benign Het
Fads1 T A 19: 10,185,798 D146E probably damaging Het
Fam171a1 C T 2: 3,223,506 T303M probably damaging Het
Fam189a2 A T 19: 23,994,857 I161N possibly damaging Het
Fam71a A G 1: 191,162,956 S497P probably damaging Het
Fbxw20 C T 9: 109,221,355 D401N probably benign Het
Fcho1 T A 8: 71,710,424 T654S possibly damaging Het
Flad1 C A 3: 89,408,551 E235* probably null Het
Flrt2 G T 12: 95,779,133 A82S probably benign Het
Gabrg3 A T 7: 57,179,638 S124T probably benign Het
Galt C T 4: 41,756,777 T139I probably benign Het
Gfod1 T C 13: 43,303,385 E38G possibly damaging Het
Gm10330 A G 12: 23,779,991 I63T possibly damaging Het
Gm15448 T A 7: 3,816,998 E640V unknown Het
Gm49359 A G 13: 62,455,053 V111A probably benign Het
Gpank1 C T 17: 35,121,758 probably benign Het
Hck T C 2: 153,131,265 L156P probably damaging Het
Hcn3 G T 3: 89,149,960 R444S probably damaging Het
Hephl1 T C 9: 15,076,940 N624S probably damaging Het
Hmcn1 A G 1: 150,756,558 I876T probably damaging Het
Ifi207 CTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATAGAGTTGCATATGGAGCCAGGAGGATGCTATATGTTGTTGATGAAGTTGCATGTGGAGCCAGGAG CTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATAGAGTTGCATATGGAGCCAGGAGGATGCTATATGTTGTTGATGAAGTTGCATGTGGAGCCAGGAG 1: 173,729,196 probably benign Het
Itga9 T A 9: 118,671,791 D377E possibly damaging Het
Itpr3 G A 17: 27,118,677 probably benign Het
Klk11 C T 7: 43,776,530 L32F probably benign Het
Lta4h A G 10: 93,474,550 S427G probably benign Het
Lxn T A 3: 67,461,318 I122F probably damaging Het
Lyz1 A G 10: 117,288,587 V148A possibly damaging Het
Mael G T 1: 166,204,855 Q326K probably benign Het
Magi3 T C 3: 104,015,948 D1151G possibly damaging Het
Map3k9 C A 12: 81,722,487 G929V probably benign Het
Mcoln1 A G 8: 3,505,771 Y22C probably damaging Het
Mier3 G T 13: 111,691,336 M45I probably benign Het
Mrpl1 T C 5: 96,223,887 V91A probably damaging Het
Myo7a T C 7: 98,091,074 H571R probably benign Het
Myom1 T A 17: 71,067,330 W601R probably damaging Het
Myom3 C T 4: 135,778,168 T456I probably benign Het
Nags A T 11: 102,146,758 H225L probably benign Het
Ncaph C A 2: 127,116,634 K488N probably damaging Het
Nkain3 C T 4: 20,484,897 R60H probably damaging Het
Nlrp9a A T 7: 26,562,519 M698L probably benign Het
Nmur2 A C 11: 56,040,482 I134M probably benign Het
Nrp2 A C 1: 62,745,511 E273A probably benign Het
Nup85 A G 11: 115,577,961 D210G possibly damaging Het
Obscn A G 11: 59,115,817 F1173S probably damaging Het
Olfr206 A T 16: 59,344,782 C306* probably null Het
Otogl T A 10: 107,817,113 E1126V probably null Het
Pfkl T C 10: 77,997,592 I259V probably benign Het
Phkg1 A T 5: 129,865,022 Y291N probably benign Het
Piezo2 T G 18: 63,030,379 H2156P probably damaging Het
Piezo2 C A 18: 63,075,719 V1408L probably damaging Het
Plekhg3 A G 12: 76,575,920 T646A probably benign Het
Plk5 C G 10: 80,357,996 R40G probably damaging Het
Ppp1r12a T C 10: 108,262,363 S838P probably damaging Het
Rarb A T 14: 16,435,235 Y270* probably null Het
Rbm15 T C 3: 107,331,996 E362G possibly damaging Het
Rcan1 A G 16: 92,465,853 F76L Het
Rdh19 T C 10: 127,860,273 L298P probably damaging Het
Rims1 T A 1: 22,428,522 H57L Het
Rlf T C 4: 121,147,554 T1520A probably benign Het
Rnase1 T A 14: 51,145,507 H130L possibly damaging Het
Samd8 T A 14: 21,792,501 M360K probably damaging Het
Samhd1 A G 2: 157,114,285 L329P probably damaging Het
Scube1 C T 15: 83,610,193 E878K probably damaging Het
Sema3b T C 9: 107,598,955 Y689C probably damaging Het
Sh3pxd2b A T 11: 32,423,361 N843Y possibly damaging Het
Slco1a6 C T 6: 142,089,849 C583Y probably damaging Het
Smg1 A C 7: 118,212,563 V88G unknown Het
Spata24 T A 18: 35,657,001 N146Y probably damaging Het
Tcf3 C A 10: 80,417,357 V258L probably benign Het
Tiam2 T C 17: 3,414,736 Y247H probably damaging Het
Ticrr T C 7: 79,660,856 F173L possibly damaging Het
Tpp2 A G 1: 43,954,651 E232G probably damaging Het
Trank1 T A 9: 111,345,479 V138E probably damaging Het
Ttll3 T C 6: 113,392,635 S47P probably benign Het
Utp4 C T 8: 106,906,225 T280M probably damaging Het
Vmn1r123 A T 7: 21,162,869 N229Y probably benign Het
Vmn1r85 A T 7: 13,085,015 Y67* probably null Het
Zbtb12 T A 17: 34,895,344 V35E possibly damaging Het
Zmym6 T A 4: 127,124,061 F1212I probably damaging Het
Other mutations in Als2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Als2 APN 1 59169896 nonsense probably null
IGL00924:Als2 APN 1 59215862 missense probably benign 0.03
IGL00949:Als2 APN 1 59215572 missense probably damaging 1.00
IGL00950:Als2 APN 1 59215382 missense probably benign 0.01
IGL01090:Als2 APN 1 59215616 missense possibly damaging 0.81
IGL01116:Als2 APN 1 59186004 splice site probably benign
IGL02001:Als2 APN 1 59180188 splice site probably benign
IGL02075:Als2 APN 1 59207786 missense probably damaging 1.00
IGL02441:Als2 APN 1 59215472 missense probably damaging 0.98
IGL02728:Als2 APN 1 59196347 missense probably benign 0.00
IGL02740:Als2 APN 1 59169919 missense probably benign 0.01
IGL02885:Als2 APN 1 59167491 missense probably benign 0.30
IGL02896:Als2 APN 1 59183787 missense probably benign 0.17
IGL02978:Als2 APN 1 59215165 missense probably benign 0.32
IGL03032:Als2 APN 1 59216030 splice site probably benign
IGL03065:Als2 APN 1 59215872 missense probably benign
IGL03212:Als2 APN 1 59202926 missense probably benign 0.00
IGL03226:Als2 APN 1 59186520 missense probably benign 0.43
R0014:Als2 UTSW 1 59211388 missense possibly damaging 0.53
R0243:Als2 UTSW 1 59215387 missense probably benign
R0326:Als2 UTSW 1 59180583 missense probably damaging 1.00
R0376:Als2 UTSW 1 59215565 missense probably benign 0.00
R0605:Als2 UTSW 1 59168414 missense probably benign 0.02
R1607:Als2 UTSW 1 59180147 missense probably damaging 1.00
R1631:Als2 UTSW 1 59218067 missense probably benign 0.00
R1657:Als2 UTSW 1 59180601 missense probably damaging 1.00
R1763:Als2 UTSW 1 59174991 missense probably benign
R1950:Als2 UTSW 1 59185601 critical splice acceptor site probably null
R1970:Als2 UTSW 1 59215169 missense probably benign 0.34
R2151:Als2 UTSW 1 59207789 missense probably damaging 1.00
R2292:Als2 UTSW 1 59187385 missense probably damaging 1.00
R2513:Als2 UTSW 1 59215117 missense probably benign 0.00
R2849:Als2 UTSW 1 59206538 missense probably damaging 0.97
R2869:Als2 UTSW 1 59211137 missense probably damaging 1.00
R2869:Als2 UTSW 1 59211137 missense probably damaging 1.00
R2870:Als2 UTSW 1 59211137 missense probably damaging 1.00
R2870:Als2 UTSW 1 59211137 missense probably damaging 1.00
R2872:Als2 UTSW 1 59211137 missense probably damaging 1.00
R2872:Als2 UTSW 1 59211137 missense probably damaging 1.00
R2873:Als2 UTSW 1 59211137 missense probably damaging 1.00
R3054:Als2 UTSW 1 59215494 missense probably damaging 1.00
R3081:Als2 UTSW 1 59187349 missense probably damaging 1.00
R3176:Als2 UTSW 1 59170008 missense possibly damaging 0.88
R3276:Als2 UTSW 1 59170008 missense possibly damaging 0.88
R3801:Als2 UTSW 1 59167199 missense probably damaging 1.00
R3803:Als2 UTSW 1 59167199 missense probably damaging 1.00
R3808:Als2 UTSW 1 59170450 missense probably benign 0.08
R3884:Als2 UTSW 1 59185568 missense probably damaging 0.99
R4012:Als2 UTSW 1 59187416 missense probably benign 0.09
R4033:Als2 UTSW 1 59196241 missense probably benign
R4201:Als2 UTSW 1 59180154 missense possibly damaging 0.77
R4321:Als2 UTSW 1 59167454 splice site probably benign
R4707:Als2 UTSW 1 59215313 missense probably benign
R4784:Als2 UTSW 1 59215313 missense probably benign
R4785:Als2 UTSW 1 59215313 missense probably benign
R4991:Als2 UTSW 1 59207768 missense probably benign 0.10
R5068:Als2 UTSW 1 59211274 missense probably benign 0.13
R5110:Als2 UTSW 1 59185441 missense probably damaging 0.98
R5141:Als2 UTSW 1 59170452 missense possibly damaging 0.80
R5394:Als2 UTSW 1 59174946 missense probably benign 0.06
R5621:Als2 UTSW 1 59191890 missense probably benign 0.33
R5685:Als2 UTSW 1 59179091 missense possibly damaging 0.73
R5987:Als2 UTSW 1 59206587 missense probably damaging 1.00
R6012:Als2 UTSW 1 59185215 missense probably damaging 1.00
R6118:Als2 UTSW 1 59203069 missense possibly damaging 0.62
R6222:Als2 UTSW 1 59180125 missense probably benign 0.04
R6367:Als2 UTSW 1 59199140 missense probably benign 0.04
R6394:Als2 UTSW 1 59167197 missense probably damaging 0.99
R6866:Als2 UTSW 1 59211133 missense probably damaging 1.00
R6965:Als2 UTSW 1 59170557 missense possibly damaging 0.70
R7038:Als2 UTSW 1 59167514 missense possibly damaging 0.94
R7178:Als2 UTSW 1 59207812 missense probably damaging 0.96
R7494:Als2 UTSW 1 59183166 splice site probably null
R7541:Als2 UTSW 1 59167616 splice site probably null
R7601:Als2 UTSW 1 59170002 missense probably benign 0.17
R8380:Als2 UTSW 1 59211308 missense probably benign
R8478:Als2 UTSW 1 59186016 missense probably damaging 0.96
R8492:Als2 UTSW 1 59211344 missense probably damaging 0.98
R9048:Als2 UTSW 1 59186511 missense possibly damaging 0.81
R9128:Als2 UTSW 1 59180550 missense probably benign 0.00
R9206:Als2 UTSW 1 59185247 missense probably damaging 1.00
R9271:Als2 UTSW 1 59203030 missense probably benign 0.01
R9430:Als2 UTSW 1 59192039 missense probably benign 0.00
R9455:Als2 UTSW 1 59180137 missense probably damaging 1.00
R9482:Als2 UTSW 1 59191950 missense probably damaging 1.00
R9494:Als2 UTSW 1 59167505 missense probably damaging 1.00
R9544:Als2 UTSW 1 59211309 missense probably benign 0.00
R9796:Als2 UTSW 1 59170442 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGCAGGGACACTACAGTCAG -3'
(R):5'- TGGGTACATTGCTGGAAGAG -3'

Sequencing Primer
(F):5'- GCAATGTTCAAAGACTCCTCGGTG -3'
(R):5'- ACTCTCACCGGCATGGCTAAC -3'
Posted On 2021-12-30