Incidental Mutation 'R9090:Fam171a1'
ID 690868
Institutional Source Beutler Lab
Gene Symbol Fam171a1
Ensembl Gene ENSMUSG00000050530
Gene Name family with sequence similarity 171, member A1
Synonyms 9630050M13Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.126) question?
Stock # R9090 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 3115261-3228843 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 3224543 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 303 (T303M)
Ref Sequence ENSEMBL: ENSMUSP00000110751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062934] [ENSMUST00000072955] [ENSMUST00000091505] [ENSMUST00000115099]
AlphaFold A2ATK9
Predicted Effect probably damaging
Transcript: ENSMUST00000062934
AA Change: T298M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053619
Gene: ENSMUSG00000050530
AA Change: T298M

DomainStartEndE-ValueType
Pfam:UPF0560 29 885 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000072955
AA Change: T178M

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000072724
Gene: ENSMUSG00000050530
AA Change: T178M

DomainStartEndE-ValueType
Pfam:UPF0560 1 765 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091505
SMART Domains Protein: ENSMUSP00000089086
Gene: ENSMUSG00000050530

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:UPF0560 34 294 3.1e-146 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115099
AA Change: T303M

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000110751
Gene: ENSMUSG00000050530
AA Change: T303M

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:UPF0560 34 890 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A T 11: 119,901,940 (GRCm39) S819T probably damaging Het
Abca13 A T 11: 9,241,698 (GRCm39) D1187V probably damaging Het
Ak9 C A 10: 41,300,623 (GRCm39) T1611K unknown Het
Als2 G T 1: 59,242,189 (GRCm39) T622K probably benign Het
Ankrd40 G A 11: 94,225,262 (GRCm39) A98T probably benign Het
Ap1b1 T C 11: 4,973,174 (GRCm39) L339P probably damaging Het
Appl1 A C 14: 26,669,084 (GRCm39) H363Q probably benign Het
Atf6 T C 1: 170,622,245 (GRCm39) N459D probably damaging Het
Ccdc6 A T 10: 70,024,993 (GRCm39) Q432L unknown Het
Ccl21a T A 4: 42,773,486 (GRCm39) Q84L probably damaging Het
Cct4 A G 11: 22,951,389 (GRCm39) I348V probably benign Het
Cd300ld2 A G 11: 114,904,550 (GRCm39) Y106H probably damaging Het
Cdh19 C T 1: 110,876,947 (GRCm39) E131K probably damaging Het
Cdon A G 9: 35,403,175 (GRCm39) D1095G probably damaging Het
Cep85l T A 10: 53,157,670 (GRCm39) R678* probably null Het
Chst3 T A 10: 60,021,465 (GRCm39) S461C probably damaging Het
Clk1 A G 1: 58,459,312 (GRCm39) I149T possibly damaging Het
Clvs2 T A 10: 33,389,301 (GRCm39) D313V possibly damaging Het
Dap3 T C 3: 88,840,913 (GRCm39) T75A probably benign Het
Dnaaf1 T A 8: 120,324,392 (GRCm39) F631L probably benign Het
Dnah14 A T 1: 181,597,325 (GRCm39) N3549I probably benign Het
Dnah17 A T 11: 117,931,870 (GRCm39) Y3701N probably damaging Het
Dock6 A G 9: 21,752,796 (GRCm39) V339A possibly damaging Het
Dpp6 T A 5: 27,803,832 (GRCm39) C259* probably null Het
Dqx1 A G 6: 83,036,024 (GRCm39) T119A probably benign Het
Dync1h1 G T 12: 110,583,310 (GRCm39) R469L probably benign Het
Eno4 C T 19: 58,951,260 (GRCm39) A424V probably benign Het
Entrep1 A T 19: 23,972,221 (GRCm39) I161N possibly damaging Het
Fads1 T A 19: 10,163,162 (GRCm39) D146E probably damaging Het
Fbxw20 C T 9: 109,050,423 (GRCm39) D401N probably benign Het
Fcho1 T A 8: 72,163,068 (GRCm39) T654S possibly damaging Het
Flad1 C A 3: 89,315,858 (GRCm39) E235* probably null Het
Flrt2 G T 12: 95,745,907 (GRCm39) A82S probably benign Het
Gabrg3 A T 7: 56,829,386 (GRCm39) S124T probably benign Het
Galt C T 4: 41,756,777 (GRCm39) T139I probably benign Het
Garin4 A G 1: 190,895,153 (GRCm39) S497P probably damaging Het
Gfod1 T C 13: 43,456,861 (GRCm39) E38G possibly damaging Het
Gm10330 A G 12: 23,829,992 (GRCm39) I63T possibly damaging Het
Gm49359 A G 13: 62,602,867 (GRCm39) V111A probably benign Het
Gpank1 C T 17: 35,340,734 (GRCm39) probably benign Het
Hck T C 2: 152,973,185 (GRCm39) L156P probably damaging Het
Hcn3 G T 3: 89,057,267 (GRCm39) R444S probably damaging Het
Hephl1 T C 9: 14,988,236 (GRCm39) N624S probably damaging Het
Hmcn1 A G 1: 150,632,309 (GRCm39) I876T probably damaging Het
Ifi207 CTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATAGAGTTGCATATGGAGCCAGGAGGATGCTATATGTTGTTGATGAAGTTGCATGTGGAGCCAGGAG CTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATAGAGTTGCATATGGAGCCAGGAGGATGCTATATGTTGTTGATGAAGTTGCATGTGGAGCCAGGAG 1: 173,556,762 (GRCm39) probably benign Het
Itga9 T A 9: 118,500,859 (GRCm39) D377E possibly damaging Het
Itpr3 G A 17: 27,337,651 (GRCm39) probably benign Het
Itprid1 G T 6: 55,944,051 (GRCm39) R417L probably benign Het
Klk1b11 C T 7: 43,425,954 (GRCm39) L32F probably benign Het
Lta4h A G 10: 93,310,412 (GRCm39) S427G probably benign Het
Lxn T A 3: 67,368,651 (GRCm39) I122F probably damaging Het
Lyz1 A G 10: 117,124,492 (GRCm39) V148A possibly damaging Het
Mael G T 1: 166,032,424 (GRCm39) Q326K probably benign Het
Magi3 T C 3: 103,923,264 (GRCm39) D1151G possibly damaging Het
Map3k9 C A 12: 81,769,261 (GRCm39) G929V probably benign Het
Mcoln1 A G 8: 3,555,771 (GRCm39) Y22C probably damaging Het
Mier3 G T 13: 111,827,870 (GRCm39) M45I probably benign Het
Mrpl1 T C 5: 96,371,746 (GRCm39) V91A probably damaging Het
Myo7a T C 7: 97,740,281 (GRCm39) H571R probably benign Het
Myom1 T A 17: 71,374,325 (GRCm39) W601R probably damaging Het
Myom3 C T 4: 135,505,479 (GRCm39) T456I probably benign Het
Nags A T 11: 102,037,584 (GRCm39) H225L probably benign Het
Ncaph C A 2: 126,958,554 (GRCm39) K488N probably damaging Het
Nkain3 C T 4: 20,484,897 (GRCm39) R60H probably damaging Het
Nlrp9a A T 7: 26,261,944 (GRCm39) M698L probably benign Het
Nmur2 A C 11: 55,931,308 (GRCm39) I134M probably benign Het
Nrp2 A C 1: 62,784,670 (GRCm39) E273A probably benign Het
Nup85 A G 11: 115,468,787 (GRCm39) D210G possibly damaging Het
Obscn A G 11: 59,006,643 (GRCm39) F1173S probably damaging Het
Or5ac24 A T 16: 59,165,145 (GRCm39) C306* probably null Het
Otogl T A 10: 107,652,974 (GRCm39) E1126V probably null Het
Pfkl T C 10: 77,833,426 (GRCm39) I259V probably benign Het
Phkg1 A T 5: 129,893,863 (GRCm39) Y291N probably benign Het
Piezo2 T G 18: 63,163,450 (GRCm39) H2156P probably damaging Het
Piezo2 C A 18: 63,208,790 (GRCm39) V1408L probably damaging Het
Pira13 T A 7: 3,819,997 (GRCm39) E640V unknown Het
Plekhg3 A G 12: 76,622,694 (GRCm39) T646A probably benign Het
Plk5 C G 10: 80,193,830 (GRCm39) R40G probably damaging Het
Ppp1r12a T C 10: 108,098,224 (GRCm39) S838P probably damaging Het
Rarb A T 14: 16,435,235 (GRCm38) Y270* probably null Het
Rbm15 T C 3: 107,239,312 (GRCm39) E362G possibly damaging Het
Rcan1 A G 16: 92,262,741 (GRCm39) F76L Het
Rdh19 T C 10: 127,696,142 (GRCm39) L298P probably damaging Het
Rims1 T A 1: 22,498,773 (GRCm39) H57L Het
Rlf T C 4: 121,004,751 (GRCm39) T1520A probably benign Het
Rnase1 T A 14: 51,382,964 (GRCm39) H130L possibly damaging Het
Samd8 T A 14: 21,842,569 (GRCm39) M360K probably damaging Het
Samhd1 A G 2: 156,956,205 (GRCm39) L329P probably damaging Het
Scube1 C T 15: 83,494,394 (GRCm39) E878K probably damaging Het
Sema3b T C 9: 107,476,154 (GRCm39) Y689C probably damaging Het
Semp2l2a T C 8: 13,886,697 (GRCm39) T465A possibly damaging Het
Sh3pxd2b A T 11: 32,373,361 (GRCm39) N843Y possibly damaging Het
Slco1a6 C T 6: 142,035,575 (GRCm39) C583Y probably damaging Het
Smg1 A C 7: 117,811,786 (GRCm39) V88G unknown Het
Spata24 T A 18: 35,790,054 (GRCm39) N146Y probably damaging Het
Tcf3 C A 10: 80,253,191 (GRCm39) V258L probably benign Het
Tiam2 T C 17: 3,465,011 (GRCm39) Y247H probably damaging Het
Ticrr T C 7: 79,310,604 (GRCm39) F173L possibly damaging Het
Tpp2 A G 1: 43,993,811 (GRCm39) E232G probably damaging Het
Trank1 T A 9: 111,174,547 (GRCm39) V138E probably damaging Het
Ttll3 T C 6: 113,369,596 (GRCm39) S47P probably benign Het
Utp4 C T 8: 107,632,857 (GRCm39) T280M probably damaging Het
Vmn1r123 A T 7: 20,896,794 (GRCm39) N229Y probably benign Het
Vmn1r85 A T 7: 12,818,942 (GRCm39) Y67* probably null Het
Zbtb12 T A 17: 35,114,320 (GRCm39) V35E possibly damaging Het
Zmym6 T A 4: 127,017,854 (GRCm39) F1212I probably damaging Het
Other mutations in Fam171a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Fam171a1 APN 2 3,179,327 (GRCm39) missense possibly damaging 0.90
IGL01138:Fam171a1 APN 2 3,203,657 (GRCm39) missense possibly damaging 0.80
IGL01317:Fam171a1 APN 2 3,203,663 (GRCm39) missense probably damaging 1.00
IGL02377:Fam171a1 APN 2 3,224,623 (GRCm39) critical splice donor site probably null
IGL02475:Fam171a1 APN 2 3,224,527 (GRCm39) missense possibly damaging 0.53
IGL02477:Fam171a1 APN 2 3,203,612 (GRCm39) missense possibly damaging 0.83
ghosted UTSW 2 3,226,189 (GRCm39) nonsense probably null
R0167:Fam171a1 UTSW 2 3,187,469 (GRCm39) missense probably damaging 1.00
R0426:Fam171a1 UTSW 2 3,226,433 (GRCm39) missense probably benign
R0468:Fam171a1 UTSW 2 3,226,433 (GRCm39) missense probably benign
R0811:Fam171a1 UTSW 2 3,198,464 (GRCm39) missense probably damaging 1.00
R0812:Fam171a1 UTSW 2 3,198,464 (GRCm39) missense probably damaging 1.00
R1099:Fam171a1 UTSW 2 3,226,354 (GRCm39) missense probably benign 0.24
R1694:Fam171a1 UTSW 2 3,226,660 (GRCm39) missense probably benign 0.00
R1817:Fam171a1 UTSW 2 3,179,410 (GRCm39) missense probably benign 0.04
R1869:Fam171a1 UTSW 2 3,227,189 (GRCm39) missense possibly damaging 0.53
R1887:Fam171a1 UTSW 2 3,221,380 (GRCm39) missense probably damaging 1.00
R2173:Fam171a1 UTSW 2 3,226,656 (GRCm39) nonsense probably null
R2355:Fam171a1 UTSW 2 3,226,570 (GRCm39) nonsense probably null
R3690:Fam171a1 UTSW 2 3,227,393 (GRCm39) missense probably benign
R3723:Fam171a1 UTSW 2 3,221,412 (GRCm39) splice site probably benign
R3978:Fam171a1 UTSW 2 3,226,072 (GRCm39) missense probably benign
R4087:Fam171a1 UTSW 2 3,227,333 (GRCm39) missense probably damaging 0.97
R4647:Fam171a1 UTSW 2 3,221,328 (GRCm39) missense probably damaging 0.98
R4744:Fam171a1 UTSW 2 3,225,946 (GRCm39) missense probably damaging 1.00
R4777:Fam171a1 UTSW 2 3,224,550 (GRCm39) missense probably benign 0.03
R4786:Fam171a1 UTSW 2 3,226,615 (GRCm39) missense probably damaging 1.00
R4888:Fam171a1 UTSW 2 3,224,546 (GRCm39) missense probably damaging 0.98
R4982:Fam171a1 UTSW 2 3,179,505 (GRCm39) splice site probably null
R5137:Fam171a1 UTSW 2 3,226,426 (GRCm39) missense probably benign 0.01
R5203:Fam171a1 UTSW 2 3,224,582 (GRCm39) missense probably damaging 0.99
R5233:Fam171a1 UTSW 2 3,179,390 (GRCm39) missense probably damaging 1.00
R5304:Fam171a1 UTSW 2 3,226,654 (GRCm39) missense probably damaging 1.00
R5475:Fam171a1 UTSW 2 3,226,334 (GRCm39) missense possibly damaging 0.91
R5682:Fam171a1 UTSW 2 3,227,126 (GRCm39) missense probably damaging 1.00
R5865:Fam171a1 UTSW 2 3,226,374 (GRCm39) missense probably benign 0.01
R6322:Fam171a1 UTSW 2 3,227,392 (GRCm39) missense probably benign 0.24
R7082:Fam171a1 UTSW 2 3,224,512 (GRCm39) missense probably benign 0.00
R7141:Fam171a1 UTSW 2 3,226,189 (GRCm39) nonsense probably null
R7155:Fam171a1 UTSW 2 3,226,766 (GRCm39) missense probably benign 0.10
R7243:Fam171a1 UTSW 2 3,119,653 (GRCm39) missense probably benign 0.07
R7326:Fam171a1 UTSW 2 3,227,509 (GRCm39) nonsense probably null
R7477:Fam171a1 UTSW 2 3,226,676 (GRCm39) missense probably benign 0.03
R7574:Fam171a1 UTSW 2 3,221,391 (GRCm39) missense probably damaging 1.00
R7745:Fam171a1 UTSW 2 3,226,483 (GRCm39) missense possibly damaging 0.53
R7753:Fam171a1 UTSW 2 3,179,354 (GRCm39) missense probably damaging 0.98
R7871:Fam171a1 UTSW 2 3,226,421 (GRCm39) missense probably benign 0.12
R7958:Fam171a1 UTSW 2 3,179,298 (GRCm39) missense probably damaging 1.00
R8677:Fam171a1 UTSW 2 3,221,352 (GRCm39) missense probably damaging 0.98
R8793:Fam171a1 UTSW 2 3,187,535 (GRCm39) missense probably damaging 1.00
R8850:Fam171a1 UTSW 2 3,221,344 (GRCm39) missense probably damaging 1.00
R8865:Fam171a1 UTSW 2 3,226,940 (GRCm39) missense probably damaging 1.00
R9016:Fam171a1 UTSW 2 3,227,434 (GRCm39) missense probably benign 0.43
R9251:Fam171a1 UTSW 2 3,226,525 (GRCm39) missense probably benign 0.06
R9271:Fam171a1 UTSW 2 3,224,543 (GRCm39) missense probably damaging 1.00
R9350:Fam171a1 UTSW 2 3,226,037 (GRCm39) missense probably benign 0.12
X0019:Fam171a1 UTSW 2 3,226,630 (GRCm39) missense probably benign 0.19
Z1177:Fam171a1 UTSW 2 3,225,971 (GRCm39) missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- AAACAGCCATCGTGTCTCTGAC -3'
(R):5'- GTGGGGTCATTTGCAACTTAC -3'

Sequencing Primer
(F):5'- GTGTCTCTGACCAGCCAC -3'
(R):5'- GTGGGGTCATTTGCAACTTACATTAC -3'
Posted On 2021-12-30