Incidental Mutation 'R9090:Smg1'
ID 690899
Institutional Source Beutler Lab
Gene Symbol Smg1
Ensembl Gene ENSMUSG00000030655
Gene Name SMG1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)
Synonyms 2610207I05Rik, 5430435M13Rik, C130002K18Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9090 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 118131308-118243670 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 118212563 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 88 (V88G)
Ref Sequence ENSEMBL: ENSMUSP00000032891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032891] [ENSMUST00000179047]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000032891
AA Change: V88G
SMART Domains Protein: ENSMUSP00000032891
Gene: ENSMUSG00000030655
AA Change: V88G

DomainStartEndE-ValueType
low complexity region 42 55 N/A INTRINSIC
SCOP:d1gw5a_ 147 621 7e-7 SMART
Pfam:SMG1 629 1240 9.8e-249 PFAM
low complexity region 1540 1551 N/A INTRINSIC
SCOP:d1gw5a_ 1680 1942 8e-3 SMART
low complexity region 2125 2141 N/A INTRINSIC
PI3Kc 2149 2493 7.93e-50 SMART
low complexity region 2759 2770 N/A INTRINSIC
low complexity region 3425 3442 N/A INTRINSIC
FATC 3626 3658 8.66e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179047
AA Change: V64G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000137172
Gene: ENSMUSG00000030655
AA Change: V64G

DomainStartEndE-ValueType
low complexity region 18 31 N/A INTRINSIC
SCOP:d1gw5a_ 123 282 7e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179331
SMART Domains Protein: ENSMUSP00000137592
Gene: ENSMUSG00000030655

DomainStartEndE-ValueType
low complexity region 18 31 N/A INTRINSIC
SCOP:d1gw5a_ 71 545 1e-6 SMART
low complexity region 602 612 N/A INTRINSIC
low complexity region 631 646 N/A INTRINSIC
low complexity region 698 718 N/A INTRINSIC
low complexity region 898 915 N/A INTRINSIC
low complexity region 1135 1147 N/A INTRINSIC
low complexity region 1464 1475 N/A INTRINSIC
low complexity region 2049 2065 N/A INTRINSIC
PI3Kc 2073 2417 7.93e-50 SMART
low complexity region 2683 2694 N/A INTRINSIC
low complexity region 3349 3366 N/A INTRINSIC
FATC 3550 3582 8.66e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in nonsense-mediated mRNA decay (NMD) as part of the mRNA surveillance complex. The protein has kinase activity and is thought to function in NMD by phosphorylating the regulator of nonsense transcripts 1 protein. Alternatively spliced transcript variants have been described, but their full-length nature has yet to be determined. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit early embryonic lethality. Mice heteroygous for a gene trap allele exhibit abnormal tooth development, chronic inflammation, increased body weight, increased incidence of tumor formation and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A T 11: 120,011,114 S819T probably damaging Het
Abca13 A T 11: 9,291,698 D1187V probably damaging Het
AF366264 T C 8: 13,836,697 T465A possibly damaging Het
Ak9 C A 10: 41,424,627 T1611K unknown Het
Als2 G T 1: 59,203,030 T622K probably benign Het
Ankrd40 G A 11: 94,334,436 A98T probably benign Het
Ap1b1 T C 11: 5,023,174 L339P probably damaging Het
Appl1 A C 14: 26,947,127 H363Q probably benign Het
Atf6 T C 1: 170,794,676 N459D probably damaging Het
Ccdc129 G T 6: 55,967,066 R417L probably benign Het
Ccdc6 A T 10: 70,189,163 Q432L unknown Het
Ccl21a T A 4: 42,773,486 Q84L probably damaging Het
Cct4 A G 11: 23,001,389 I348V probably benign Het
Cd300ld2 A G 11: 115,013,724 Y106H probably damaging Het
Cdh19 C T 1: 110,949,217 E131K probably damaging Het
Cdon A G 9: 35,491,879 D1095G probably damaging Het
Cep85l T A 10: 53,281,574 R678* probably null Het
Chst3 T A 10: 60,185,643 S461C probably damaging Het
Clk1 A G 1: 58,420,153 I149T possibly damaging Het
Clvs2 T A 10: 33,513,305 D313V possibly damaging Het
Dap3 T C 3: 88,933,606 T75A probably benign Het
Dnaaf1 T A 8: 119,597,653 F631L probably benign Het
Dnah14 A T 1: 181,769,760 N3549I probably benign Het
Dnah17 A T 11: 118,041,044 Y3701N probably damaging Het
Dock6 A G 9: 21,841,500 V339A possibly damaging Het
Dpp6 T A 5: 27,598,834 C259* probably null Het
Dqx1 A G 6: 83,059,043 T119A probably benign Het
Dync1h1 G T 12: 110,616,876 R469L probably benign Het
Eno4 C T 19: 58,962,828 A424V probably benign Het
Fads1 T A 19: 10,185,798 D146E probably damaging Het
Fam171a1 C T 2: 3,223,506 T303M probably damaging Het
Fam189a2 A T 19: 23,994,857 I161N possibly damaging Het
Fam71a A G 1: 191,162,956 S497P probably damaging Het
Fbxw20 C T 9: 109,221,355 D401N probably benign Het
Fcho1 T A 8: 71,710,424 T654S possibly damaging Het
Flad1 C A 3: 89,408,551 E235* probably null Het
Flrt2 G T 12: 95,779,133 A82S probably benign Het
Gabrg3 A T 7: 57,179,638 S124T probably benign Het
Galt C T 4: 41,756,777 T139I probably benign Het
Gfod1 T C 13: 43,303,385 E38G possibly damaging Het
Gm10330 A G 12: 23,779,991 I63T possibly damaging Het
Gm15448 T A 7: 3,816,998 E640V unknown Het
Gm49359 A G 13: 62,455,053 V111A probably benign Het
Gpank1 C T 17: 35,121,758 probably benign Het
Hck T C 2: 153,131,265 L156P probably damaging Het
Hcn3 G T 3: 89,149,960 R444S probably damaging Het
Hephl1 T C 9: 15,076,940 N624S probably damaging Het
Hmcn1 A G 1: 150,756,558 I876T probably damaging Het
Ifi207 CTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATAGAGTTGCATATGGAGCCAGGAGGATGCTATATGTTGTTGATGAAGTTGCATGTGGAGCCAGGAG CTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATAGAGTTGCATATGGAGCCAGGAGGATGCTATATGTTGTTGATGAAGTTGCATGTGGAGCCAGGAG 1: 173,729,196 probably benign Het
Itga9 T A 9: 118,671,791 D377E possibly damaging Het
Itpr3 G A 17: 27,118,677 probably benign Het
Klk11 C T 7: 43,776,530 L32F probably benign Het
Lta4h A G 10: 93,474,550 S427G probably benign Het
Lxn T A 3: 67,461,318 I122F probably damaging Het
Lyz1 A G 10: 117,288,587 V148A possibly damaging Het
Mael G T 1: 166,204,855 Q326K probably benign Het
Magi3 T C 3: 104,015,948 D1151G possibly damaging Het
Map3k9 C A 12: 81,722,487 G929V probably benign Het
Mcoln1 A G 8: 3,505,771 Y22C probably damaging Het
Mier3 G T 13: 111,691,336 M45I probably benign Het
Mrpl1 T C 5: 96,223,887 V91A probably damaging Het
Myo7a T C 7: 98,091,074 H571R probably benign Het
Myom1 T A 17: 71,067,330 W601R probably damaging Het
Myom3 C T 4: 135,778,168 T456I probably benign Het
Nags A T 11: 102,146,758 H225L probably benign Het
Ncaph C A 2: 127,116,634 K488N probably damaging Het
Nkain3 C T 4: 20,484,897 R60H probably damaging Het
Nlrp9a A T 7: 26,562,519 M698L probably benign Het
Nmur2 A C 11: 56,040,482 I134M probably benign Het
Nrp2 A C 1: 62,745,511 E273A probably benign Het
Nup85 A G 11: 115,577,961 D210G possibly damaging Het
Obscn A G 11: 59,115,817 F1173S probably damaging Het
Olfr206 A T 16: 59,344,782 C306* probably null Het
Otogl T A 10: 107,817,113 E1126V probably null Het
Pfkl T C 10: 77,997,592 I259V probably benign Het
Phkg1 A T 5: 129,865,022 Y291N probably benign Het
Piezo2 T G 18: 63,030,379 H2156P probably damaging Het
Piezo2 C A 18: 63,075,719 V1408L probably damaging Het
Plekhg3 A G 12: 76,575,920 T646A probably benign Het
Plk5 C G 10: 80,357,996 R40G probably damaging Het
Ppp1r12a T C 10: 108,262,363 S838P probably damaging Het
Rarb A T 14: 16,435,235 Y270* probably null Het
Rbm15 T C 3: 107,331,996 E362G possibly damaging Het
Rcan1 A G 16: 92,465,853 F76L Het
Rdh19 T C 10: 127,860,273 L298P probably damaging Het
Rims1 T A 1: 22,428,522 H57L Het
Rlf T C 4: 121,147,554 T1520A probably benign Het
Rnase1 T A 14: 51,145,507 H130L possibly damaging Het
Samd8 T A 14: 21,792,501 M360K probably damaging Het
Samhd1 A G 2: 157,114,285 L329P probably damaging Het
Scube1 C T 15: 83,610,193 E878K probably damaging Het
Sema3b T C 9: 107,598,955 Y689C probably damaging Het
Sh3pxd2b A T 11: 32,423,361 N843Y possibly damaging Het
Slco1a6 C T 6: 142,089,849 C583Y probably damaging Het
Spata24 T A 18: 35,657,001 N146Y probably damaging Het
Tcf3 C A 10: 80,417,357 V258L probably benign Het
Tiam2 T C 17: 3,414,736 Y247H probably damaging Het
Ticrr T C 7: 79,660,856 F173L possibly damaging Het
Tpp2 A G 1: 43,954,651 E232G probably damaging Het
Trank1 T A 9: 111,345,479 V138E probably damaging Het
Ttll3 T C 6: 113,392,635 S47P probably benign Het
Utp4 C T 8: 106,906,225 T280M probably damaging Het
Vmn1r123 A T 7: 21,162,869 N229Y probably benign Het
Vmn1r85 A T 7: 13,085,015 Y67* probably null Het
Zbtb12 T A 17: 34,895,344 V35E possibly damaging Het
Zmym6 T A 4: 127,124,061 F1212I probably damaging Het
Other mutations in Smg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Smg1 APN 7 118198271 utr 3 prime probably benign
IGL00481:Smg1 APN 7 118210794 missense possibly damaging 0.67
IGL00503:Smg1 APN 7 118185483 utr 3 prime probably benign
IGL00927:Smg1 APN 7 118140632 missense probably damaging 1.00
IGL01333:Smg1 APN 7 118163378 splice site probably benign
IGL01344:Smg1 APN 7 118190836 utr 3 prime probably benign
IGL01397:Smg1 APN 7 118163221 utr 3 prime probably benign
IGL01403:Smg1 APN 7 118158132 utr 3 prime probably benign
IGL01573:Smg1 APN 7 118167962 utr 3 prime probably benign
IGL01872:Smg1 APN 7 118148944 utr 3 prime probably benign
IGL02010:Smg1 APN 7 118186146 utr 3 prime probably benign
IGL02158:Smg1 APN 7 118212946 missense possibly damaging 0.77
IGL02268:Smg1 APN 7 118182541 missense probably benign 0.19
IGL02314:Smg1 APN 7 118154709 utr 3 prime probably benign
IGL02552:Smg1 APN 7 118195894 utr 3 prime probably benign
IGL02577:Smg1 APN 7 118203122 missense probably damaging 0.99
IGL02859:Smg1 APN 7 118148933 utr 3 prime probably benign
IGL02890:Smg1 APN 7 118185501 utr 3 prime probably benign
IGL02892:Smg1 APN 7 118167955 utr 3 prime probably benign
IGL03119:Smg1 APN 7 118195113 utr 3 prime probably benign
IGL03123:Smg1 APN 7 118157181 utr 3 prime probably benign
IGL03128:Smg1 APN 7 118203059 missense probably benign 0.03
IGL03184:Smg1 APN 7 118180380 missense possibly damaging 0.86
PIT4508001:Smg1 UTSW 7 118185541 missense unknown
R0010:Smg1 UTSW 7 118171859 utr 3 prime probably benign
R0010:Smg1 UTSW 7 118171859 utr 3 prime probably benign
R0025:Smg1 UTSW 7 118212443 missense possibly damaging 0.92
R0025:Smg1 UTSW 7 118212443 missense possibly damaging 0.92
R0098:Smg1 UTSW 7 118145467 missense probably benign 0.02
R0139:Smg1 UTSW 7 118152675 critical splice donor site probably null
R0371:Smg1 UTSW 7 118168300 utr 3 prime probably benign
R0415:Smg1 UTSW 7 118182468 missense probably benign 0.34
R0416:Smg1 UTSW 7 118184461 splice site probably benign
R0423:Smg1 UTSW 7 118176880 missense possibly damaging 0.53
R0600:Smg1 UTSW 7 118160383 utr 3 prime probably benign
R0626:Smg1 UTSW 7 118182383 missense possibly damaging 0.82
R0627:Smg1 UTSW 7 118167861 utr 3 prime probably benign
R0727:Smg1 UTSW 7 118166422 utr 3 prime probably benign
R0729:Smg1 UTSW 7 118146289 utr 3 prime probably benign
R0841:Smg1 UTSW 7 118143301 missense possibly damaging 0.96
R1114:Smg1 UTSW 7 118159790 utr 3 prime probably benign
R1256:Smg1 UTSW 7 118203087 missense probably damaging 1.00
R1298:Smg1 UTSW 7 118168211 utr 3 prime probably benign
R1370:Smg1 UTSW 7 118159752 utr 3 prime probably benign
R1591:Smg1 UTSW 7 118156919 utr 3 prime probably benign
R1736:Smg1 UTSW 7 118165967 splice site probably null
R1755:Smg1 UTSW 7 118203064 nonsense probably null
R1765:Smg1 UTSW 7 118139715 missense probably benign 0.03
R1789:Smg1 UTSW 7 118145798 missense possibly damaging 0.73
R1845:Smg1 UTSW 7 118154622 utr 3 prime probably benign
R1908:Smg1 UTSW 7 118154199 utr 3 prime probably benign
R1909:Smg1 UTSW 7 118154199 utr 3 prime probably benign
R1942:Smg1 UTSW 7 118158103 utr 3 prime probably benign
R2064:Smg1 UTSW 7 118156867 utr 3 prime probably benign
R2072:Smg1 UTSW 7 118163166 utr 3 prime probably benign
R2154:Smg1 UTSW 7 118158076 utr 3 prime probably benign
R2895:Smg1 UTSW 7 118189143 utr 3 prime probably benign
R2915:Smg1 UTSW 7 118210879 splice site probably benign
R3416:Smg1 UTSW 7 118148853 utr 3 prime probably benign
R3417:Smg1 UTSW 7 118148853 utr 3 prime probably benign
R3873:Smg1 UTSW 7 118154662 utr 3 prime probably benign
R4082:Smg1 UTSW 7 118160246 utr 3 prime probably benign
R4230:Smg1 UTSW 7 118148733 critical splice donor site probably null
R4304:Smg1 UTSW 7 118139518 missense probably benign 0.03
R4549:Smg1 UTSW 7 118159683 utr 3 prime probably benign
R4571:Smg1 UTSW 7 118139465 missense possibly damaging 0.72
R4638:Smg1 UTSW 7 118195926 utr 3 prime probably benign
R4642:Smg1 UTSW 7 118154264 utr 3 prime probably benign
R4656:Smg1 UTSW 7 118212951 missense probably benign 0.00
R4754:Smg1 UTSW 7 118156731 utr 3 prime probably benign
R4798:Smg1 UTSW 7 118180474 missense probably benign 0.32
R4906:Smg1 UTSW 7 118152408 utr 3 prime probably benign
R4978:Smg1 UTSW 7 118154247 utr 3 prime probably benign
R4989:Smg1 UTSW 7 118158100 utr 3 prime probably benign
R4989:Smg1 UTSW 7 118208051 missense probably benign
R5026:Smg1 UTSW 7 118193545 utr 3 prime probably benign
R5124:Smg1 UTSW 7 118213012 missense probably benign 0.00
R5318:Smg1 UTSW 7 118160204 utr 3 prime probably benign
R5356:Smg1 UTSW 7 118195133 utr 3 prime probably benign
R5404:Smg1 UTSW 7 118206908 missense probably damaging 1.00
R5423:Smg1 UTSW 7 118146071 missense possibly damaging 0.70
R5441:Smg1 UTSW 7 118195081 utr 3 prime probably benign
R5490:Smg1 UTSW 7 118139436 missense possibly damaging 0.86
R5541:Smg1 UTSW 7 118157163 utr 3 prime probably benign
R5564:Smg1 UTSW 7 118189819 utr 3 prime probably benign
R5580:Smg1 UTSW 7 118148902 utr 3 prime probably benign
R5600:Smg1 UTSW 7 118167884 utr 3 prime probably benign
R5628:Smg1 UTSW 7 118154701 utr 3 prime probably benign
R5646:Smg1 UTSW 7 118212559 missense probably benign 0.42
R5656:Smg1 UTSW 7 118154664 utr 3 prime probably benign
R5660:Smg1 UTSW 7 118143347 missense probably benign 0.33
R5706:Smg1 UTSW 7 118145590 missense possibly damaging 0.86
R5786:Smg1 UTSW 7 118212897 missense probably benign 0.12
R5890:Smg1 UTSW 7 118190586 utr 3 prime probably benign
R5912:Smg1 UTSW 7 118154586 utr 3 prime probably benign
R5977:Smg1 UTSW 7 118141357 utr 3 prime probably benign
R5993:Smg1 UTSW 7 118140509 missense probably benign 0.33
R6161:Smg1 UTSW 7 118163330 utr 3 prime probably benign
R6187:Smg1 UTSW 7 118189163 utr 3 prime probably benign
R6264:Smg1 UTSW 7 118166087 utr 3 prime probably benign
R6331:Smg1 UTSW 7 118154277 utr 3 prime probably benign
R6561:Smg1 UTSW 7 118166077 utr 3 prime probably benign
R6571:Smg1 UTSW 7 118184514 utr 3 prime probably benign
R6736:Smg1 UTSW 7 118157166 utr 3 prime probably benign
R6752:Smg1 UTSW 7 118163316 utr 3 prime probably benign
R6777:Smg1 UTSW 7 118189117 utr 3 prime probably benign
R6788:Smg1 UTSW 7 118184571 utr 3 prime probably benign
R6883:Smg1 UTSW 7 118168180 utr 3 prime probably benign
R6991:Smg1 UTSW 7 118167868 utr 3 prime probably benign
R7056:Smg1 UTSW 7 118146400 splice site probably benign
R7058:Smg1 UTSW 7 118198279 utr 3 prime probably benign
R7100:Smg1 UTSW 7 118184520 missense unknown
R7133:Smg1 UTSW 7 118152908 missense unknown
R7221:Smg1 UTSW 7 118182797 missense possibly damaging 0.86
R7229:Smg1 UTSW 7 118176955 missense probably benign 0.03
R7293:Smg1 UTSW 7 118166099 missense unknown
R7361:Smg1 UTSW 7 118184977 missense unknown
R7438:Smg1 UTSW 7 118195893 missense unknown
R7686:Smg1 UTSW 7 118167858 missense unknown
R7798:Smg1 UTSW 7 118171939 missense possibly damaging 0.73
R7908:Smg1 UTSW 7 118186134 missense unknown
R7923:Smg1 UTSW 7 118143322 missense possibly damaging 0.96
R7978:Smg1 UTSW 7 118193655 missense unknown
R7997:Smg1 UTSW 7 118173141 missense unknown
R7997:Smg1 UTSW 7 118173142 missense unknown
R8025:Smg1 UTSW 7 118206989 nonsense probably null
R8056:Smg1 UTSW 7 118160366 missense unknown
R8061:Smg1 UTSW 7 118152387 missense unknown
R8095:Smg1 UTSW 7 118173062 missense unknown
R8198:Smg1 UTSW 7 118145606 missense probably benign 0.03
R8399:Smg1 UTSW 7 118190571 missense unknown
R8445:Smg1 UTSW 7 118136977 missense possibly damaging 0.72
R8519:Smg1 UTSW 7 118171759 utr 3 prime probably benign
R8817:Smg1 UTSW 7 118159664 missense unknown
R8832:Smg1 UTSW 7 118139783 missense probably benign 0.33
R8855:Smg1 UTSW 7 118206899 missense unknown
R8866:Smg1 UTSW 7 118206899 missense unknown
R8946:Smg1 UTSW 7 118152677 missense probably null
R8954:Smg1 UTSW 7 118206992 missense probably damaging 1.00
R8967:Smg1 UTSW 7 118166516 missense unknown
R9072:Smg1 UTSW 7 118183809 missense unknown
R9156:Smg1 UTSW 7 118154661 missense unknown
R9198:Smg1 UTSW 7 118195956 missense unknown
R9240:Smg1 UTSW 7 118139808 missense probably benign 0.18
R9271:Smg1 UTSW 7 118212563 missense unknown
R9289:Smg1 UTSW 7 118145416 missense possibly damaging 0.53
R9378:Smg1 UTSW 7 118178775 nonsense probably null
R9396:Smg1 UTSW 7 118208080 missense unknown
R9469:Smg1 UTSW 7 118140551 missense possibly damaging 0.72
R9539:Smg1 UTSW 7 118145753 missense probably benign 0.03
R9549:Smg1 UTSW 7 118196031 missense unknown
R9563:Smg1 UTSW 7 118212985 missense unknown
R9564:Smg1 UTSW 7 118212985 missense unknown
R9597:Smg1 UTSW 7 118213047 missense unknown
Z1088:Smg1 UTSW 7 118154635 utr 3 prime probably benign
Z1088:Smg1 UTSW 7 118168661 nonsense probably null
Z1088:Smg1 UTSW 7 118178399 missense possibly damaging 0.96
Z1176:Smg1 UTSW 7 118206887 missense unknown
Z1176:Smg1 UTSW 7 118206907 missense unknown
Z1177:Smg1 UTSW 7 118168608 missense probably null
Z1177:Smg1 UTSW 7 118213033 missense unknown
Predicted Primers PCR Primer
(F):5'- TCAACCCTGGTCTCCAAGTC -3'
(R):5'- GAGGTTCTTCCAGGCTACTGTC -3'

Sequencing Primer
(F):5'- GGTCTCCAAGTCTTACCCTGTG -3'
(R):5'- GCTTAAAGCATCTGTCTGAATTGAAC -3'
Posted On 2021-12-30