Mutagenetix > Incidental Mutation

Incidental Mutation 'R9090:Dnah17'

690935

Institutional Source

Beutler Lab

Gene Symbol

Dnah17

Ensembl Gene

ENSMUSG00000033987

Gene Name

dynein, axonemal, heavy chain 17

Synonyms

LOC382552, Dnahcl1, 2810003K23Rik, Dnahc17

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9090 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

118021723-118130634 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 118041044 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 3701 (Y3701N)

Ref Sequence

ENSEMBL: ENSMUSP00000101915 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084803] [ENSMUST00000106308] [ENSMUST00000132685]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000084803
AA Change: Y3701N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000081864
Gene: ENSMUSG00000033987
AA Change: Y3701N

Domain	Start	End	E-Value	Type
Pfam:DHC_N1	183	766	8.5e-142	PFAM
low complexity region	1015	1028	N/A	INTRINSIC
Pfam:DHC_N2	1260	1673	5.8e-135	PFAM
Pfam:AAA_6	1793	2023	6e-161	PFAM
low complexity region	2092	2104	N/A	INTRINSIC
Pfam:AAA_5	2107	2243	7.8e-13	PFAM
Pfam:AAA_7	2400	2671	1.1e-171	PFAM
Pfam:AAA_8	2748	3015	4.9e-166	PFAM
Pfam:MT	3027	3370	3.4e-214	PFAM
Pfam:AAA_9	3388	3615	2.4e-144	PFAM
Pfam:Dynein_heavy	3742	4452	N/A	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000106308
AA Change: Y3701N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000101915
Gene: ENSMUSG00000033987
AA Change: Y3701N

Domain	Start	End	E-Value	Type
Pfam:DHC_N1	184	764	1.7e-152	PFAM
low complexity region	1015	1028	N/A	INTRINSIC
Pfam:DHC_N2	1262	1671	4.1e-132	PFAM
Pfam:AAA_6	1793	2023	7e-149	PFAM
low complexity region	2092	2104	N/A	INTRINSIC
Pfam:AAA_5	2107	2243	2.5e-11	PFAM
Pfam:AAA_7	2400	2671	4.4e-169	PFAM
Pfam:AAA_8	2748	3015	7.1e-163	PFAM
Pfam:MT	3027	3370	1.1e-210	PFAM
Pfam:AAA_9	3392	3614	1e-84	PFAM
Pfam:Dynein_heavy	3748	4479	3.5e-230	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000132685
AA Change: Y3714N

SMART Domains

Protein: ENSMUSP00000120542
Gene: ENSMUSG00000033987
AA Change: Y3714N

Domain	Start	End	E-Value	Type
Pfam:DHC_N2	279	688	3.1e-132	PFAM
Pfam:AAA_6	811	1041	5.3e-149	PFAM
low complexity region	1110	1122	N/A	INTRINSIC
Blast:AAA	1123	1354	1e-104	BLAST
Pfam:AAA_7	1452	1671	8.9e-134	PFAM
Pfam:AAA_8	1763	2030	5.4e-163	PFAM
Pfam:MT	2042	2168	6.8e-52	PFAM
Pfam:MT	2163	2412	8.2e-149	PFAM
Pfam:AAA_9	2434	2656	7.9e-85	PFAM
Pfam:Dynein_heavy	2790	3457	2.6e-209	PFAM
Pfam:Dynein_heavy	3460	3569	4.6e-17	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. DNAH17 is a heavy chain associated with axonemal dynein (Milisav and Affara, 1998 [PubMed 9545504]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 106 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aatk	A	T	11: 120,011,114	S819T	probably damaging	Het
Abca13	A	T	11: 9,291,698	D1187V	probably damaging	Het
AF366264	T	C	8: 13,836,697	T465A	possibly damaging	Het
Ak9	C	A	10: 41,424,627	T1611K	unknown	Het
Als2	G	T	1: 59,203,030	T622K	probably benign	Het
Ankrd40	G	A	11: 94,334,436	A98T	probably benign	Het
Ap1b1	T	C	11: 5,023,174	L339P	probably damaging	Het
Appl1	A	C	14: 26,947,127	H363Q	probably benign	Het
Atf6	T	C	1: 170,794,676	N459D	probably damaging	Het
Ccdc129	G	T	6: 55,967,066	R417L	probably benign	Het
Ccdc6	A	T	10: 70,189,163	Q432L	unknown	Het
Ccl21a	T	A	4: 42,773,486	Q84L	probably damaging	Het
Cct4	A	G	11: 23,001,389	I348V	probably benign	Het
Cd300ld2	A	G	11: 115,013,724	Y106H	probably damaging	Het
Cdh19	C	T	1: 110,949,217	E131K	probably damaging	Het
Cdon	A	G	9: 35,491,879	D1095G	probably damaging	Het
Cep85l	T	A	10: 53,281,574	R678*	probably null	Het
Chst3	T	A	10: 60,185,643	S461C	probably damaging	Het
Clk1	A	G	1: 58,420,153	I149T	possibly damaging	Het
Clvs2	T	A	10: 33,513,305	D313V	possibly damaging	Het
Dap3	T	C	3: 88,933,606	T75A	probably benign	Het
Dnaaf1	T	A	8: 119,597,653	F631L	probably benign	Het
Dnah14	A	T	1: 181,769,760	N3549I	probably benign	Het
Dock6	A	G	9: 21,841,500	V339A	possibly damaging	Het
Dpp6	T	A	5: 27,598,834	C259*	probably null	Het
Dqx1	A	G	6: 83,059,043	T119A	probably benign	Het
Dync1h1	G	T	12: 110,616,876	R469L	probably benign	Het
Eno4	C	T	19: 58,962,828	A424V	probably benign	Het
Fads1	T	A	19: 10,185,798	D146E	probably damaging	Het
Fam171a1	C	T	2: 3,223,506	T303M	probably damaging	Het
Fam189a2	A	T	19: 23,994,857	I161N	possibly damaging	Het
Fam71a	A	G	1: 191,162,956	S497P	probably damaging	Het
Fbxw20	C	T	9: 109,221,355	D401N	probably benign	Het
Fcho1	T	A	8: 71,710,424	T654S	possibly damaging	Het
Flad1	C	A	3: 89,408,551	E235*	probably null	Het
Flrt2	G	T	12: 95,779,133	A82S	probably benign	Het
Gabrg3	A	T	7: 57,179,638	S124T	probably benign	Het
Galt	C	T	4: 41,756,777	T139I	probably benign	Het
Gfod1	T	C	13: 43,303,385	E38G	possibly damaging	Het
Gm10330	A	G	12: 23,779,991	I63T	possibly damaging	Het
Gm15448	T	A	7: 3,816,998	E640V	unknown	Het
Gm49359	A	G	13: 62,455,053	V111A	probably benign	Het
Gpank1	C	T	17: 35,121,758		probably benign	Het
Hck	T	C	2: 153,131,265	L156P	probably damaging	Het
Hcn3	G	T	3: 89,149,960	R444S	probably damaging	Het
Hephl1	T	C	9: 15,076,940	N624S	probably damaging	Het
Hmcn1	A	G	1: 150,756,558	I876T	probably damaging	Het
Ifi207	CTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATAGAGTTGCATATGGAGCCAGGAGGATGCTATATGTTGTTGATGAAGTTGCATGTGGAGCCAGGAG	CTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATAGAGTTGCATATGGAGCCAGGAGGATGCTATATGTTGTTGATGAAGTTGCATGTGGAGCCAGGAG	1: 173,729,196		probably benign	Het
Itga9	T	A	9: 118,671,791	D377E	possibly damaging	Het
Itpr3	G	A	17: 27,118,677		probably benign	Het
Klk11	C	T	7: 43,776,530	L32F	probably benign	Het
Lta4h	A	G	10: 93,474,550	S427G	probably benign	Het
Lxn	T	A	3: 67,461,318	I122F	probably damaging	Het
Lyz1	A	G	10: 117,288,587	V148A	possibly damaging	Het
Mael	G	T	1: 166,204,855	Q326K	probably benign	Het
Magi3	T	C	3: 104,015,948	D1151G	possibly damaging	Het
Map3k9	C	A	12: 81,722,487	G929V	probably benign	Het
Mcoln1	A	G	8: 3,505,771	Y22C	probably damaging	Het
Mier3	G	T	13: 111,691,336	M45I	probably benign	Het
Mrpl1	T	C	5: 96,223,887	V91A	probably damaging	Het
Myo7a	T	C	7: 98,091,074	H571R	probably benign	Het
Myom1	T	A	17: 71,067,330	W601R	probably damaging	Het
Myom3	C	T	4: 135,778,168	T456I	probably benign	Het
Nags	A	T	11: 102,146,758	H225L	probably benign	Het
Ncaph	C	A	2: 127,116,634	K488N	probably damaging	Het
Nkain3	C	T	4: 20,484,897	R60H	probably damaging	Het
Nlrp9a	A	T	7: 26,562,519	M698L	probably benign	Het
Nmur2	A	C	11: 56,040,482	I134M	probably benign	Het
Nrp2	A	C	1: 62,745,511	E273A	probably benign	Het
Nup85	A	G	11: 115,577,961	D210G	possibly damaging	Het
Obscn	A	G	11: 59,115,817	F1173S	probably damaging	Het
Olfr206	A	T	16: 59,344,782	C306*	probably null	Het
Otogl	T	A	10: 107,817,113	E1126V	probably null	Het
Pfkl	T	C	10: 77,997,592	I259V	probably benign	Het
Phkg1	A	T	5: 129,865,022	Y291N	probably benign	Het
Piezo2	T	G	18: 63,030,379	H2156P	probably damaging	Het
Piezo2	C	A	18: 63,075,719	V1408L	probably damaging	Het
Plekhg3	A	G	12: 76,575,920	T646A	probably benign	Het
Plk5	C	G	10: 80,357,996	R40G	probably damaging	Het
Ppp1r12a	T	C	10: 108,262,363	S838P	probably damaging	Het
Rarb	A	T	14: 16,435,235	Y270*	probably null	Het
Rbm15	T	C	3: 107,331,996	E362G	possibly damaging	Het
Rcan1	A	G	16: 92,465,853	F76L		Het
Rdh19	T	C	10: 127,860,273	L298P	probably damaging	Het
Rims1	T	A	1: 22,428,522	H57L		Het
Rlf	T	C	4: 121,147,554	T1520A	probably benign	Het
Rnase1	T	A	14: 51,145,507	H130L	possibly damaging	Het
Samd8	T	A	14: 21,792,501	M360K	probably damaging	Het
Samhd1	A	G	2: 157,114,285	L329P	probably damaging	Het
Scube1	C	T	15: 83,610,193	E878K	probably damaging	Het
Sema3b	T	C	9: 107,598,955	Y689C	probably damaging	Het
Sh3pxd2b	A	T	11: 32,423,361	N843Y	possibly damaging	Het
Slco1a6	C	T	6: 142,089,849	C583Y	probably damaging	Het
Smg1	A	C	7: 118,212,563	V88G	unknown	Het
Spata24	T	A	18: 35,657,001	N146Y	probably damaging	Het
Tcf3	C	A	10: 80,417,357	V258L	probably benign	Het
Tiam2	T	C	17: 3,414,736	Y247H	probably damaging	Het
Ticrr	T	C	7: 79,660,856	F173L	possibly damaging	Het
Tpp2	A	G	1: 43,954,651	E232G	probably damaging	Het
Trank1	T	A	9: 111,345,479	V138E	probably damaging	Het
Ttll3	T	C	6: 113,392,635	S47P	probably benign	Het
Utp4	C	T	8: 106,906,225	T280M	probably damaging	Het
Vmn1r123	A	T	7: 21,162,869	N229Y	probably benign	Het
Vmn1r85	A	T	7: 13,085,015	Y67*	probably null	Het
Zbtb12	T	A	17: 34,895,344	V35E	possibly damaging	Het
Zmym6	T	A	4: 127,124,061	F1212I	probably damaging	Het

Other mutations in Dnah17

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00231:Dnah17	APN	11	118088214	missense	possibly damaging	0.81
IGL00531:Dnah17	APN	11	118043173	missense	probably damaging	0.97
IGL00764:Dnah17	APN	11	118096485	missense	probably damaging	0.99
IGL00795:Dnah17	APN	11	118093634	missense	probably benign	0.35
IGL00823:Dnah17	APN	11	118047161	missense	probably benign	0.22
IGL01145:Dnah17	APN	11	118047173	missense	possibly damaging	0.63
IGL01433:Dnah17	APN	11	118049934	missense	probably damaging	1.00
IGL01454:Dnah17	APN	11	118058397	missense	probably damaging	1.00
IGL01545:Dnah17	APN	11	118119568	missense	probably damaging	1.00
IGL01548:Dnah17	APN	11	118098612	missense	probably benign	0.21
IGL01557:Dnah17	APN	11	118073686	missense	probably damaging	0.98
IGL01632:Dnah17	APN	11	118033881	missense	probably damaging	1.00
IGL01636:Dnah17	APN	11	118041056	missense	probably benign	0.03
IGL01672:Dnah17	APN	11	118042160	missense	probably damaging	0.97
IGL01822:Dnah17	APN	11	118081993	missense	probably damaging	1.00
IGL01869:Dnah17	APN	11	118052676	missense	probably benign	0.09
IGL01916:Dnah17	APN	11	118125288	missense	probably benign	0.00
IGL02131:Dnah17	APN	11	118072908	missense	probably damaging	1.00
IGL02154:Dnah17	APN	11	118124261	missense	probably benign	0.01
IGL02220:Dnah17	APN	11	118072967	nonsense	probably null
IGL02454:Dnah17	APN	11	118080767	missense	probably damaging	0.98
IGL02458:Dnah17	APN	11	118036350	missense	probably damaging	1.00
IGL02588:Dnah17	APN	11	118025653	missense	possibly damaging	0.95
IGL02865:Dnah17	APN	11	118073548	missense	probably damaging	1.00
IGL02881:Dnah17	APN	11	118042118	missense	probably damaging	1.00
IGL02952:Dnah17	APN	11	118088268	missense	probably benign	0.03
IGL03382:Dnah17	APN	11	118081943	missense	probably damaging	1.00
IGL03389:Dnah17	APN	11	118094979	missense	probably damaging	1.00
ergos	UTSW	11	118041158	splice site	probably benign
watt	UTSW	11	118080766	missense	probably damaging	0.96
PIT4280001:Dnah17	UTSW	11	118098582	missense	possibly damaging	0.85
R0004:Dnah17	UTSW	11	118060092	missense	possibly damaging	0.90
R0112:Dnah17	UTSW	11	118074434	missense	possibly damaging	0.82
R0116:Dnah17	UTSW	11	118058306	missense	probably benign	0.01
R0157:Dnah17	UTSW	11	118127171	missense	probably benign
R0320:Dnah17	UTSW	11	118052674	missense	possibly damaging	0.56
R0362:Dnah17	UTSW	11	118098539	missense	probably benign	0.10
R0382:Dnah17	UTSW	11	118128996	missense	probably damaging	1.00
R0383:Dnah17	UTSW	11	118067547	missense	probably benign
R0400:Dnah17	UTSW	11	118082078	missense	probably damaging	1.00
R0420:Dnah17	UTSW	11	118039939	missense	probably damaging	1.00
R0483:Dnah17	UTSW	11	118047124	missense	probably benign
R0533:Dnah17	UTSW	11	118110537	missense	possibly damaging	0.50
R0562:Dnah17	UTSW	11	118072900	missense	probably damaging	1.00
R0564:Dnah17	UTSW	11	118082981	missense	probably damaging	1.00
R0604:Dnah17	UTSW	11	118121471	missense	probably benign	0.00
R0608:Dnah17	UTSW	11	118090749	nonsense	probably null
R0614:Dnah17	UTSW	11	118070568	splice site	probably benign
R0632:Dnah17	UTSW	11	118067682	splice site	probably benign
R0831:Dnah17	UTSW	11	118060271	missense	probably damaging	0.99
R0838:Dnah17	UTSW	11	118060104	missense	probably damaging	1.00
R0879:Dnah17	UTSW	11	118056835	splice site	probably benign
R1061:Dnah17	UTSW	11	118052688	missense	possibly damaging	0.51
R1190:Dnah17	UTSW	11	118042175	missense	probably damaging	1.00
R1293:Dnah17	UTSW	11	118127137	critical splice donor site	probably null
R1297:Dnah17	UTSW	11	118121366	splice site	probably benign
R1332:Dnah17	UTSW	11	118043215	missense	possibly damaging	0.70
R1336:Dnah17	UTSW	11	118043215	missense	possibly damaging	0.70
R1364:Dnah17	UTSW	11	118125606	splice site	probably benign
R1418:Dnah17	UTSW	11	118074023	missense	probably damaging	0.98
R1432:Dnah17	UTSW	11	118023327	missense	probably damaging	1.00
R1497:Dnah17	UTSW	11	118114233	missense	probably damaging	1.00
R1500:Dnah17	UTSW	11	118101053	missense	probably benign
R1506:Dnah17	UTSW	11	118125387	missense	possibly damaging	0.53
R1512:Dnah17	UTSW	11	118095015	missense	probably benign
R1567:Dnah17	UTSW	11	118125985	missense	probably damaging	1.00
R1597:Dnah17	UTSW	11	118103498	splice site	probably benign
R1665:Dnah17	UTSW	11	118121495	splice site	probably benign
R1703:Dnah17	UTSW	11	118026749	missense	probably damaging	1.00
R1716:Dnah17	UTSW	11	118032598	missense	probably benign	0.00
R1727:Dnah17	UTSW	11	118070489	missense	probably damaging	0.98
R1727:Dnah17	UTSW	11	118096536	nonsense	probably null
R1728:Dnah17	UTSW	11	118069519	missense	possibly damaging	0.76
R1784:Dnah17	UTSW	11	118069519	missense	possibly damaging	0.76
R1852:Dnah17	UTSW	11	118121916	missense	probably damaging	0.97
R1869:Dnah17	UTSW	11	118047189	nonsense	probably null
R1886:Dnah17	UTSW	11	118108161	missense	possibly damaging	0.62
R1893:Dnah17	UTSW	11	118066968	missense	probably benign	0.00
R1954:Dnah17	UTSW	11	118024731	missense	probably damaging	1.00
R1969:Dnah17	UTSW	11	118104535	missense	probably benign	0.00
R1971:Dnah17	UTSW	11	118104535	missense	probably benign	0.00
R1975:Dnah17	UTSW	11	118096536	nonsense	probably null
R1977:Dnah17	UTSW	11	118112591	missense	possibly damaging	0.52
R2055:Dnah17	UTSW	11	118067531	missense	probably benign	0.00
R2115:Dnah17	UTSW	11	118119802	missense	probably benign	0.00
R2132:Dnah17	UTSW	11	118033747	missense	probably damaging	0.98
R2200:Dnah17	UTSW	11	118102409	splice site	probably benign
R2277:Dnah17	UTSW	11	118096561	missense	possibly damaging	0.81
R2279:Dnah17	UTSW	11	118096561	missense	possibly damaging	0.81
R2400:Dnah17	UTSW	11	118126384	critical splice acceptor site	probably null
R2402:Dnah17	UTSW	11	118125974	missense	probably benign	0.10
R2497:Dnah17	UTSW	11	118087024	splice site	probably null
R2923:Dnah17	UTSW	11	118093547	missense	probably damaging	1.00
R3121:Dnah17	UTSW	11	118041086	missense	probably damaging	1.00
R3236:Dnah17	UTSW	11	118094854	missense	probably benign	0.08
R3237:Dnah17	UTSW	11	118094854	missense	probably benign	0.08
R3498:Dnah17	UTSW	11	118080849	splice site	probably benign
R3499:Dnah17	UTSW	11	118080849	splice site	probably benign
R3746:Dnah17	UTSW	11	118082916	missense	probably benign	0.00
R3749:Dnah17	UTSW	11	118082916	missense	probably benign	0.00
R3762:Dnah17	UTSW	11	118104526	missense	probably benign	0.00
R3826:Dnah17	UTSW	11	118041158	splice site	probably benign
R3828:Dnah17	UTSW	11	118041158	splice site	probably benign
R3829:Dnah17	UTSW	11	118041158	splice site	probably benign
R3877:Dnah17	UTSW	11	118024707	missense	probably damaging	1.00
R3899:Dnah17	UTSW	11	118094808	missense	possibly damaging	0.78
R3900:Dnah17	UTSW	11	118094808	missense	possibly damaging	0.78
R3911:Dnah17	UTSW	11	118080849	splice site	probably benign
R3913:Dnah17	UTSW	11	118080849	splice site	probably benign
R3930:Dnah17	UTSW	11	118080849	splice site	probably benign
R3931:Dnah17	UTSW	11	118080849	splice site	probably benign
R3969:Dnah17	UTSW	11	118041158	splice site	probably benign
R3970:Dnah17	UTSW	11	118041158	splice site	probably benign
R4056:Dnah17	UTSW	11	118070538	missense	probably benign	0.05
R4113:Dnah17	UTSW	11	118112594	missense	possibly damaging	0.50
R4295:Dnah17	UTSW	11	118118772	missense	probably damaging	1.00
R4324:Dnah17	UTSW	11	118094213	missense	probably benign	0.01
R4412:Dnah17	UTSW	11	118073683	missense	probably damaging	1.00
R4413:Dnah17	UTSW	11	118025168	missense	probably benign	0.00
R4422:Dnah17	UTSW	11	118081973	missense	possibly damaging	0.91
R4552:Dnah17	UTSW	11	118052943	missense	possibly damaging	0.79
R4669:Dnah17	UTSW	11	118074293	missense	probably benign	0.02
R4677:Dnah17	UTSW	11	118119814	missense	probably damaging	1.00
R4716:Dnah17	UTSW	11	118073648	missense	probably benign	0.02
R4832:Dnah17	UTSW	11	118026780	missense	probably damaging	1.00
R4868:Dnah17	UTSW	11	118108212	missense	probably benign	0.03
R4897:Dnah17	UTSW	11	118078593	missense	probably damaging	1.00
R4928:Dnah17	UTSW	11	118027433	missense	probably damaging	1.00
R4937:Dnah17	UTSW	11	118042154	missense	probably damaging	1.00
R4957:Dnah17	UTSW	11	118074298	missense	probably benign	0.44
R5008:Dnah17	UTSW	11	118110577	missense	probably benign	0.01
R5016:Dnah17	UTSW	11	118080766	missense	probably damaging	0.96
R5027:Dnah17	UTSW	11	118102539	missense	probably benign	0.01
R5133:Dnah17	UTSW	11	118117113	missense	probably benign	0.00
R5140:Dnah17	UTSW	11	118086945	missense	probably damaging	1.00
R5146:Dnah17	UTSW	11	118114179	missense	probably damaging	0.99
R5151:Dnah17	UTSW	11	118027467	missense	probably damaging	1.00
R5153:Dnah17	UTSW	11	118082974	nonsense	probably null
R5192:Dnah17	UTSW	11	118034359	missense	possibly damaging	0.96
R5315:Dnah17	UTSW	11	118127283	missense	possibly damaging	0.79
R5317:Dnah17	UTSW	11	118127283	missense	possibly damaging	0.79
R5335:Dnah17	UTSW	11	118112514	missense	probably damaging	1.00
R5379:Dnah17	UTSW	11	118117203	intron	probably benign
R5396:Dnah17	UTSW	11	118127282	missense	probably benign
R5418:Dnah17	UTSW	11	118094984	missense	probably benign	0.04
R5534:Dnah17	UTSW	11	118052770	missense	possibly damaging	0.83
R5539:Dnah17	UTSW	11	118073660	missense	probably benign	0.03
R5594:Dnah17	UTSW	11	118043229	splice site	probably null
R5634:Dnah17	UTSW	11	118052926	splice site	probably null
R5696:Dnah17	UTSW	11	118101056	missense	probably benign	0.44
R5802:Dnah17	UTSW	11	118036446	missense	possibly damaging	0.79
R5826:Dnah17	UTSW	11	118034367	missense	probably damaging	1.00
R5873:Dnah17	UTSW	11	118056897	missense	probably benign	0.01
R5898:Dnah17	UTSW	11	118114213	missense	probably benign	0.00
R5934:Dnah17	UTSW	11	118041102	missense	probably benign
R6030:Dnah17	UTSW	11	118025549	missense	probably benign	0.32
R6030:Dnah17	UTSW	11	118025549	missense	probably benign	0.32
R6038:Dnah17	UTSW	11	118055889	missense	probably benign	0.00
R6038:Dnah17	UTSW	11	118055889	missense	probably benign	0.00
R6113:Dnah17	UTSW	11	118126275	missense	probably damaging	1.00
R6117:Dnah17	UTSW	11	118119571	missense	probably benign	0.00
R6137:Dnah17	UTSW	11	118025654	missense	probably damaging	1.00
R6173:Dnah17	UTSW	11	118039946	missense	probably damaging	1.00
R6258:Dnah17	UTSW	11	118126322	missense	probably damaging	1.00
R6258:Dnah17	UTSW	11	118126323	nonsense	probably null
R6258:Dnah17	UTSW	11	118126324	missense	probably damaging	1.00
R6260:Dnah17	UTSW	11	118126322	missense	probably damaging	1.00
R6260:Dnah17	UTSW	11	118126323	nonsense	probably null
R6260:Dnah17	UTSW	11	118126324	missense	probably damaging	1.00
R6278:Dnah17	UTSW	11	118126290	missense	probably damaging	0.99
R6298:Dnah17	UTSW	11	118108161	missense	probably benign	0.00
R6300:Dnah17	UTSW	11	118034310	missense	probably damaging	1.00
R6302:Dnah17	UTSW	11	118129155	missense	probably benign	0.09
R6363:Dnah17	UTSW	11	118110505	missense	probably benign
R6381:Dnah17	UTSW	11	118129185	missense	probably benign	0.08
R6418:Dnah17	UTSW	11	118129197	missense	probably damaging	0.99
R6660:Dnah17	UTSW	11	118100188	missense	probably benign
R6803:Dnah17	UTSW	11	118125372	missense	probably benign	0.00
R6820:Dnah17	UTSW	11	118069000	missense	probably damaging	0.99
R6885:Dnah17	UTSW	11	118090772	missense	possibly damaging	0.47
R6921:Dnah17	UTSW	11	118041484	missense	probably damaging	0.98
R6932:Dnah17	UTSW	11	118060079	missense	possibly damaging	0.95
R6954:Dnah17	UTSW	11	118066432	missense	probably damaging	1.00
R7000:Dnah17	UTSW	11	118025702	critical splice acceptor site	probably null
R7007:Dnah17	UTSW	11	118118871	missense	possibly damaging	0.92
R7048:Dnah17	UTSW	11	118046118	missense	possibly damaging	0.80
R7056:Dnah17	UTSW	11	118125386	missense	probably benign
R7131:Dnah17	UTSW	11	118079658	missense	probably benign	0.14
R7143:Dnah17	UTSW	11	118086130	missense	probably damaging	1.00
R7146:Dnah17	UTSW	11	118082110	missense	probably damaging	0.98
R7147:Dnah17	UTSW	11	118094929	missense	probably benign	0.31
R7172:Dnah17	UTSW	11	118041131	nonsense	probably null
R7183:Dnah17	UTSW	11	118129188	missense	probably benign
R7297:Dnah17	UTSW	11	118055730	critical splice donor site	probably null
R7297:Dnah17	UTSW	11	118103356	missense	probably damaging	0.98
R7367:Dnah17	UTSW	11	118115196	missense	probably benign
R7398:Dnah17	UTSW	11	118080724	missense	probably damaging	0.96
R7426:Dnah17	UTSW	11	118090717	missense	probably null	0.79
R7524:Dnah17	UTSW	11	118121481	missense	probably benign	0.03
R7529:Dnah17	UTSW	11	118049866	critical splice donor site	probably null
R7615:Dnah17	UTSW	11	118110547	nonsense	probably null
R7681:Dnah17	UTSW	11	118025186	missense	probably damaging	1.00
R7702:Dnah17	UTSW	11	118025640	missense	probably benign	0.00
R7702:Dnah17	UTSW	11	118121478	missense	possibly damaging	0.64
R7713:Dnah17	UTSW	11	118025171	missense	probably benign	0.02
R7809:Dnah17	UTSW	11	118104636	missense	probably benign	0.09
R7842:Dnah17	UTSW	11	118079682	critical splice acceptor site	probably null
R7935:Dnah17	UTSW	11	118127222	missense	probably benign	0.20
R7951:Dnah17	UTSW	11	118118766	missense	possibly damaging	0.64
R8070:Dnah17	UTSW	11	118024671	missense	probably damaging	0.97
R8098:Dnah17	UTSW	11	118050367	missense	probably damaging	1.00
R8101:Dnah17	UTSW	11	118125918	missense	probably benign
R8177:Dnah17	UTSW	11	118128927	missense	possibly damaging	0.60
R8343:Dnah17	UTSW	11	118114195	missense	probably benign
R8350:Dnah17	UTSW	11	118087047	missense	probably damaging	0.98
R8393:Dnah17	UTSW	11	118057029	missense	probably damaging	1.00
R8401:Dnah17	UTSW	11	118024659	missense	probably damaging	0.96
R8418:Dnah17	UTSW	11	118103458	missense	probably benign	0.01
R8450:Dnah17	UTSW	11	118087047	missense	probably damaging	0.98
R8546:Dnah17	UTSW	11	118124275	missense	probably benign	0.00
R8697:Dnah17	UTSW	11	118086159	missense	possibly damaging	0.96
R8710:Dnah17	UTSW	11	118042147	missense	probably damaging	1.00
R8713:Dnah17	UTSW	11	118088202	missense	probably damaging	1.00
R8722:Dnah17	UTSW	11	118070457	nonsense	probably null
R8797:Dnah17	UTSW	11	118101375	missense	probably benign	0.00
R8953:Dnah17	UTSW	11	118125412	splice site	probably benign
R8965:Dnah17	UTSW	11	118024666	missense	probably damaging	1.00
R8976:Dnah17	UTSW	11	118026840	missense	probably damaging	1.00
R9128:Dnah17	UTSW	11	118046178	missense	possibly damaging	0.76
R9134:Dnah17	UTSW	11	118088146	missense	probably damaging	1.00
R9245:Dnah17	UTSW	11	118125677	missense	probably benign	0.02
R9251:Dnah17	UTSW	11	118121792	missense	probably benign	0.03
R9271:Dnah17	UTSW	11	118041044	missense	probably damaging	1.00
R9367:Dnah17	UTSW	11	118096638	missense	possibly damaging	0.95
R9367:Dnah17	UTSW	11	118121386	missense	possibly damaging	0.93
R9381:Dnah17	UTSW	11	118023393	missense	probably benign
R9405:Dnah17	UTSW	11	118118911	missense	probably benign
R9449:Dnah17	UTSW	11	118096626	missense	probably benign	0.07
R9517:Dnah17	UTSW	11	118024614	missense	possibly damaging	0.76
R9588:Dnah17	UTSW	11	118121957	missense	probably benign	0.00
R9629:Dnah17	UTSW	11	118088978	missense	probably damaging	1.00
R9654:Dnah17	UTSW	11	118036330	critical splice donor site	probably null
R9655:Dnah17	UTSW	11	118080823	missense	possibly damaging	0.94
R9662:Dnah17	UTSW	11	118034340	missense	probably damaging	0.97
R9686:Dnah17	UTSW	11	118088222	missense	possibly damaging	0.46
R9689:Dnah17	UTSW	11	118072905	missense	probably damaging	1.00
R9706:Dnah17	UTSW	11	118126200	missense	probably damaging	1.00
X0058:Dnah17	UTSW	11	118082925	missense	probably damaging	1.00
Z1176:Dnah17	UTSW	11	118127166	missense	probably benign	0.01
Z1177:Dnah17	UTSW	11	118078563	missense	possibly damaging	0.91
Z1177:Dnah17	UTSW	11	118086960	missense	probably damaging	1.00
Z1177:Dnah17	UTSW	11	118127142	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TTCCAGTACTTCAGCCGGAG -3'
(R):5'- TCAGAATTAACCAGAGGCTACTG -3'

Sequencing Primer
(F):5'- AGTACTTCAGCCGGAGTGTCG -3'
(R):5'- CAGAGGCTACTGGGGATGG -3'

Posted On

2021-12-30