Incidental Mutation 'R9090:Piezo2'
ID 690958
Institutional Source Beutler Lab
Gene Symbol Piezo2
Ensembl Gene ENSMUSG00000041482
Gene Name piezo-type mechanosensitive ion channel component 2
Synonyms Piezo2, 9030411M15Rik, Fam38b2, Fam38b, 9430028L06Rik
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9090 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 63143284-63520254 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 63163450 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Proline at position 2156 (H2156P)
Ref Sequence ENSEMBL: ENSMUSP00000040019 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047480]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000047480
AA Change: H2156P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000040019
Gene: ENSMUSG00000041482
AA Change: H2156P

DomainStartEndE-ValueType
transmembrane domain 13 44 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 179 194 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
transmembrane domain 241 260 N/A INTRINSIC
transmembrane domain 267 289 N/A INTRINSIC
coiled coil region 455 482 N/A INTRINSIC
transmembrane domain 504 526 N/A INTRINSIC
transmembrane domain 539 561 N/A INTRINSIC
SCOP:d1eq1a_ 597 666 4e-3 SMART
transmembrane domain 682 704 N/A INTRINSIC
transmembrane domain 708 730 N/A INTRINSIC
internal_repeat_1 740 764 6.01e-5 PROSPERO
low complexity region 772 784 N/A INTRINSIC
transmembrane domain 791 813 N/A INTRINSIC
low complexity region 900 921 N/A INTRINSIC
transmembrane domain 949 971 N/A INTRINSIC
transmembrane domain 976 993 N/A INTRINSIC
transmembrane domain 1000 1022 N/A INTRINSIC
transmembrane domain 1069 1091 N/A INTRINSIC
transmembrane domain 1130 1152 N/A INTRINSIC
transmembrane domain 1156 1173 N/A INTRINSIC
transmembrane domain 1186 1208 N/A INTRINSIC
transmembrane domain 1234 1256 N/A INTRINSIC
transmembrane domain 1308 1327 N/A INTRINSIC
transmembrane domain 1331 1353 N/A INTRINSIC
Pfam:PIEZO 1383 1617 1.1e-105 PFAM
low complexity region 1807 1823 N/A INTRINSIC
low complexity region 1836 1860 N/A INTRINSIC
low complexity region 1863 1878 N/A INTRINSIC
transmembrane domain 1981 2003 N/A INTRINSIC
transmembrane domain 2010 2027 N/A INTRINSIC
internal_repeat_1 2036 2060 6.01e-5 PROSPERO
low complexity region 2167 2199 N/A INTRINSIC
transmembrane domain 2261 2283 N/A INTRINSIC
transmembrane domain 2303 2325 N/A INTRINSIC
transmembrane domain 2332 2354 N/A INTRINSIC
transmembrane domain 2364 2386 N/A INTRINSIC
Pfam:Piezo_RRas_bdg 2412 2821 2.8e-161 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137141
SMART Domains Protein: ENSMUSP00000117107
Gene: ENSMUSG00000041482

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
transmembrane domain 84 106 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
transmembrane domain 155 177 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
Pfam:Piezo_RRas_bdg 235 409 4.6e-78 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains more than thirty transmembrane domains and likely functions as part of mechanically-activated (MA) cation channels. These channels serve to connect mechanical forces to biological signals. The encoded protein quickly adapts MA currents in somatosensory neurons. Defects in this gene are a cause of type 5 distal arthrogryposis. Several alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A T 11: 119,901,940 (GRCm39) S819T probably damaging Het
Abca13 A T 11: 9,241,698 (GRCm39) D1187V probably damaging Het
Ak9 C A 10: 41,300,623 (GRCm39) T1611K unknown Het
Als2 G T 1: 59,242,189 (GRCm39) T622K probably benign Het
Ankrd40 G A 11: 94,225,262 (GRCm39) A98T probably benign Het
Ap1b1 T C 11: 4,973,174 (GRCm39) L339P probably damaging Het
Appl1 A C 14: 26,669,084 (GRCm39) H363Q probably benign Het
Atf6 T C 1: 170,622,245 (GRCm39) N459D probably damaging Het
Ccdc6 A T 10: 70,024,993 (GRCm39) Q432L unknown Het
Ccl21a T A 4: 42,773,486 (GRCm39) Q84L probably damaging Het
Cct4 A G 11: 22,951,389 (GRCm39) I348V probably benign Het
Cd300ld2 A G 11: 114,904,550 (GRCm39) Y106H probably damaging Het
Cdh19 C T 1: 110,876,947 (GRCm39) E131K probably damaging Het
Cdon A G 9: 35,403,175 (GRCm39) D1095G probably damaging Het
Cep85l T A 10: 53,157,670 (GRCm39) R678* probably null Het
Chst3 T A 10: 60,021,465 (GRCm39) S461C probably damaging Het
Clk1 A G 1: 58,459,312 (GRCm39) I149T possibly damaging Het
Clvs2 T A 10: 33,389,301 (GRCm39) D313V possibly damaging Het
Dap3 T C 3: 88,840,913 (GRCm39) T75A probably benign Het
Dnaaf1 T A 8: 120,324,392 (GRCm39) F631L probably benign Het
Dnah14 A T 1: 181,597,325 (GRCm39) N3549I probably benign Het
Dnah17 A T 11: 117,931,870 (GRCm39) Y3701N probably damaging Het
Dock6 A G 9: 21,752,796 (GRCm39) V339A possibly damaging Het
Dpp6 T A 5: 27,803,832 (GRCm39) C259* probably null Het
Dqx1 A G 6: 83,036,024 (GRCm39) T119A probably benign Het
Dync1h1 G T 12: 110,583,310 (GRCm39) R469L probably benign Het
Eno4 C T 19: 58,951,260 (GRCm39) A424V probably benign Het
Entrep1 A T 19: 23,972,221 (GRCm39) I161N possibly damaging Het
Fads1 T A 19: 10,163,162 (GRCm39) D146E probably damaging Het
Fam171a1 C T 2: 3,224,543 (GRCm39) T303M probably damaging Het
Fbxw20 C T 9: 109,050,423 (GRCm39) D401N probably benign Het
Fcho1 T A 8: 72,163,068 (GRCm39) T654S possibly damaging Het
Flad1 C A 3: 89,315,858 (GRCm39) E235* probably null Het
Flrt2 G T 12: 95,745,907 (GRCm39) A82S probably benign Het
Gabrg3 A T 7: 56,829,386 (GRCm39) S124T probably benign Het
Galt C T 4: 41,756,777 (GRCm39) T139I probably benign Het
Garin4 A G 1: 190,895,153 (GRCm39) S497P probably damaging Het
Gfod1 T C 13: 43,456,861 (GRCm39) E38G possibly damaging Het
Gm10330 A G 12: 23,829,992 (GRCm39) I63T possibly damaging Het
Gm49359 A G 13: 62,602,867 (GRCm39) V111A probably benign Het
Gpank1 C T 17: 35,340,734 (GRCm39) probably benign Het
Hck T C 2: 152,973,185 (GRCm39) L156P probably damaging Het
Hcn3 G T 3: 89,057,267 (GRCm39) R444S probably damaging Het
Hephl1 T C 9: 14,988,236 (GRCm39) N624S probably damaging Het
Hmcn1 A G 1: 150,632,309 (GRCm39) I876T probably damaging Het
Ifi207 CTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATAGAGTTGCATATGGAGCCAGGAGGATGCTATATGTTGTTGATGAAGTTGCATGTGGAGCCAGGAG CTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATAGAGTTGCATATGGAGCCAGGAGGATGCTATATGTTGTTGATGAAGTTGCATGTGGAGCCAGGAG 1: 173,556,762 (GRCm39) probably benign Het
Itga9 T A 9: 118,500,859 (GRCm39) D377E possibly damaging Het
Itpr3 G A 17: 27,337,651 (GRCm39) probably benign Het
Itprid1 G T 6: 55,944,051 (GRCm39) R417L probably benign Het
Klk1b11 C T 7: 43,425,954 (GRCm39) L32F probably benign Het
Lta4h A G 10: 93,310,412 (GRCm39) S427G probably benign Het
Lxn T A 3: 67,368,651 (GRCm39) I122F probably damaging Het
Lyz1 A G 10: 117,124,492 (GRCm39) V148A possibly damaging Het
Mael G T 1: 166,032,424 (GRCm39) Q326K probably benign Het
Magi3 T C 3: 103,923,264 (GRCm39) D1151G possibly damaging Het
Map3k9 C A 12: 81,769,261 (GRCm39) G929V probably benign Het
Mcoln1 A G 8: 3,555,771 (GRCm39) Y22C probably damaging Het
Mier3 G T 13: 111,827,870 (GRCm39) M45I probably benign Het
Mrpl1 T C 5: 96,371,746 (GRCm39) V91A probably damaging Het
Myo7a T C 7: 97,740,281 (GRCm39) H571R probably benign Het
Myom1 T A 17: 71,374,325 (GRCm39) W601R probably damaging Het
Myom3 C T 4: 135,505,479 (GRCm39) T456I probably benign Het
Nags A T 11: 102,037,584 (GRCm39) H225L probably benign Het
Ncaph C A 2: 126,958,554 (GRCm39) K488N probably damaging Het
Nkain3 C T 4: 20,484,897 (GRCm39) R60H probably damaging Het
Nlrp9a A T 7: 26,261,944 (GRCm39) M698L probably benign Het
Nmur2 A C 11: 55,931,308 (GRCm39) I134M probably benign Het
Nrp2 A C 1: 62,784,670 (GRCm39) E273A probably benign Het
Nup85 A G 11: 115,468,787 (GRCm39) D210G possibly damaging Het
Obscn A G 11: 59,006,643 (GRCm39) F1173S probably damaging Het
Or5ac24 A T 16: 59,165,145 (GRCm39) C306* probably null Het
Otogl T A 10: 107,652,974 (GRCm39) E1126V probably null Het
Pfkl T C 10: 77,833,426 (GRCm39) I259V probably benign Het
Phkg1 A T 5: 129,893,863 (GRCm39) Y291N probably benign Het
Pira13 T A 7: 3,819,997 (GRCm39) E640V unknown Het
Plekhg3 A G 12: 76,622,694 (GRCm39) T646A probably benign Het
Plk5 C G 10: 80,193,830 (GRCm39) R40G probably damaging Het
Ppp1r12a T C 10: 108,098,224 (GRCm39) S838P probably damaging Het
Rarb A T 14: 16,435,235 (GRCm38) Y270* probably null Het
Rbm15 T C 3: 107,239,312 (GRCm39) E362G possibly damaging Het
Rcan1 A G 16: 92,262,741 (GRCm39) F76L Het
Rdh19 T C 10: 127,696,142 (GRCm39) L298P probably damaging Het
Rims1 T A 1: 22,498,773 (GRCm39) H57L Het
Rlf T C 4: 121,004,751 (GRCm39) T1520A probably benign Het
Rnase1 T A 14: 51,382,964 (GRCm39) H130L possibly damaging Het
Samd8 T A 14: 21,842,569 (GRCm39) M360K probably damaging Het
Samhd1 A G 2: 156,956,205 (GRCm39) L329P probably damaging Het
Scube1 C T 15: 83,494,394 (GRCm39) E878K probably damaging Het
Sema3b T C 9: 107,476,154 (GRCm39) Y689C probably damaging Het
Semp2l2a T C 8: 13,886,697 (GRCm39) T465A possibly damaging Het
Sh3pxd2b A T 11: 32,373,361 (GRCm39) N843Y possibly damaging Het
Slco1a6 C T 6: 142,035,575 (GRCm39) C583Y probably damaging Het
Smg1 A C 7: 117,811,786 (GRCm39) V88G unknown Het
Spata24 T A 18: 35,790,054 (GRCm39) N146Y probably damaging Het
Tcf3 C A 10: 80,253,191 (GRCm39) V258L probably benign Het
Tiam2 T C 17: 3,465,011 (GRCm39) Y247H probably damaging Het
Ticrr T C 7: 79,310,604 (GRCm39) F173L possibly damaging Het
Tpp2 A G 1: 43,993,811 (GRCm39) E232G probably damaging Het
Trank1 T A 9: 111,174,547 (GRCm39) V138E probably damaging Het
Ttll3 T C 6: 113,369,596 (GRCm39) S47P probably benign Het
Utp4 C T 8: 107,632,857 (GRCm39) T280M probably damaging Het
Vmn1r123 A T 7: 20,896,794 (GRCm39) N229Y probably benign Het
Vmn1r85 A T 7: 12,818,942 (GRCm39) Y67* probably null Het
Zbtb12 T A 17: 35,114,320 (GRCm39) V35E possibly damaging Het
Zmym6 T A 4: 127,017,854 (GRCm39) F1212I probably damaging Het
Other mutations in Piezo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01360:Piezo2 APN 18 63,250,770 (GRCm39) missense probably damaging 1.00
IGL01370:Piezo2 APN 18 63,155,531 (GRCm39) missense probably damaging 1.00
IGL01543:Piezo2 APN 18 63,203,101 (GRCm39) missense probably damaging 1.00
IGL01561:Piezo2 APN 18 63,257,685 (GRCm39) missense probably benign 0.03
IGL01568:Piezo2 APN 18 63,163,463 (GRCm39) missense probably benign 0.28
IGL01653:Piezo2 APN 18 63,315,904 (GRCm39) splice site probably benign
IGL01674:Piezo2 APN 18 63,160,630 (GRCm39) missense probably damaging 1.00
IGL01684:Piezo2 APN 18 63,216,241 (GRCm39) missense probably damaging 1.00
IGL01744:Piezo2 APN 18 63,175,859 (GRCm39) missense probably damaging 1.00
IGL01859:Piezo2 APN 18 63,225,915 (GRCm39) missense probably benign 0.10
IGL02183:Piezo2 APN 18 63,153,705 (GRCm39) missense probably benign 0.00
IGL02407:Piezo2 APN 18 63,279,915 (GRCm39) missense probably damaging 1.00
IGL02441:Piezo2 APN 18 63,205,933 (GRCm39) missense probably damaging 1.00
IGL02542:Piezo2 APN 18 63,165,995 (GRCm39) missense probably damaging 0.96
IGL02652:Piezo2 APN 18 63,157,546 (GRCm39) missense probably damaging 1.00
IGL02710:Piezo2 APN 18 63,207,730 (GRCm39) missense probably damaging 1.00
IGL02850:Piezo2 APN 18 63,153,704 (GRCm39) missense probably benign 0.18
IGL02851:Piezo2 APN 18 63,153,704 (GRCm39) missense probably benign 0.18
IGL02972:Piezo2 APN 18 63,197,856 (GRCm39) splice site probably benign
IGL03011:Piezo2 APN 18 63,257,731 (GRCm39) missense probably benign 0.03
IGL03078:Piezo2 APN 18 63,203,146 (GRCm39) missense probably damaging 1.00
IGL03114:Piezo2 APN 18 63,163,343 (GRCm39) splice site probably null
IGL03129:Piezo2 APN 18 63,248,043 (GRCm39) missense probably benign
IGL03143:Piezo2 APN 18 63,241,147 (GRCm39) missense probably damaging 0.99
IGL03202:Piezo2 APN 18 63,144,669 (GRCm39) missense probably damaging 1.00
IGL03227:Piezo2 APN 18 63,257,677 (GRCm39) missense probably damaging 1.00
IGL03228:Piezo2 APN 18 63,186,133 (GRCm39) missense probably damaging 1.00
IGL03230:Piezo2 APN 18 63,174,791 (GRCm39) missense probably damaging 1.00
IGL03242:Piezo2 APN 18 63,144,609 (GRCm39) utr 3 prime probably benign
IGL03291:Piezo2 APN 18 63,154,379 (GRCm39) missense probably damaging 1.00
IGL03301:Piezo2 APN 18 63,160,775 (GRCm39) missense probably damaging 1.00
Piccolo UTSW 18 63,144,767 (GRCm39) missense probably damaging 1.00
sopranino UTSW 18 63,157,537 (GRCm39) missense probably damaging 1.00
woodwind UTSW 18 63,257,713 (GRCm39) missense possibly damaging 0.50
P0023:Piezo2 UTSW 18 63,519,271 (GRCm39) splice site probably benign
PIT4802001:Piezo2 UTSW 18 63,157,540 (GRCm39) missense probably damaging 1.00
R0070:Piezo2 UTSW 18 63,235,155 (GRCm39) missense probably damaging 1.00
R0416:Piezo2 UTSW 18 63,157,562 (GRCm39) missense probably damaging 1.00
R0486:Piezo2 UTSW 18 63,162,132 (GRCm39) missense probably damaging 1.00
R0498:Piezo2 UTSW 18 63,235,245 (GRCm39) missense possibly damaging 0.87
R0504:Piezo2 UTSW 18 63,157,522 (GRCm39) missense probably damaging 1.00
R0506:Piezo2 UTSW 18 63,160,615 (GRCm39) missense probably damaging 1.00
R0523:Piezo2 UTSW 18 63,155,552 (GRCm39) missense probably damaging 1.00
R0587:Piezo2 UTSW 18 63,155,497 (GRCm39) missense possibly damaging 0.82
R0626:Piezo2 UTSW 18 63,152,329 (GRCm39) missense probably damaging 0.97
R0734:Piezo2 UTSW 18 63,174,794 (GRCm39) missense probably damaging 1.00
R0784:Piezo2 UTSW 18 63,216,306 (GRCm39) missense probably damaging 1.00
R0973:Piezo2 UTSW 18 63,148,873 (GRCm39) missense probably damaging 1.00
R1183:Piezo2 UTSW 18 63,219,824 (GRCm39) missense probably damaging 1.00
R1344:Piezo2 UTSW 18 63,154,325 (GRCm39) missense probably damaging 1.00
R1474:Piezo2 UTSW 18 63,216,202 (GRCm39) missense probably damaging 1.00
R1571:Piezo2 UTSW 18 63,277,990 (GRCm39) missense possibly damaging 0.67
R1643:Piezo2 UTSW 18 63,215,986 (GRCm39) missense probably benign 0.03
R1649:Piezo2 UTSW 18 63,250,743 (GRCm39) missense probably benign 0.34
R1741:Piezo2 UTSW 18 63,154,244 (GRCm39) missense probably damaging 1.00
R1764:Piezo2 UTSW 18 63,257,713 (GRCm39) missense possibly damaging 0.50
R1793:Piezo2 UTSW 18 63,239,355 (GRCm39) missense possibly damaging 0.78
R1799:Piezo2 UTSW 18 63,241,158 (GRCm39) missense probably damaging 1.00
R1799:Piezo2 UTSW 18 63,165,911 (GRCm39) critical splice donor site probably null
R1868:Piezo2 UTSW 18 63,152,415 (GRCm39) missense probably damaging 1.00
R1879:Piezo2 UTSW 18 63,247,031 (GRCm39) missense probably damaging 1.00
R1962:Piezo2 UTSW 18 63,211,911 (GRCm39) missense probably damaging 0.98
R1990:Piezo2 UTSW 18 63,207,733 (GRCm39) missense probably null 1.00
R1991:Piezo2 UTSW 18 63,207,733 (GRCm39) missense probably null 1.00
R1992:Piezo2 UTSW 18 63,207,733 (GRCm39) missense probably null 1.00
R1995:Piezo2 UTSW 18 63,211,852 (GRCm39) missense probably damaging 1.00
R2004:Piezo2 UTSW 18 63,277,997 (GRCm39) missense probably damaging 1.00
R2011:Piezo2 UTSW 18 63,192,815 (GRCm39) missense probably damaging 1.00
R2029:Piezo2 UTSW 18 63,252,006 (GRCm39) missense possibly damaging 0.62
R2075:Piezo2 UTSW 18 63,214,805 (GRCm39) missense probably damaging 1.00
R2078:Piezo2 UTSW 18 63,250,791 (GRCm39) missense probably damaging 0.99
R2152:Piezo2 UTSW 18 63,247,112 (GRCm39) missense probably damaging 1.00
R2162:Piezo2 UTSW 18 63,214,733 (GRCm39) critical splice donor site probably null
R2183:Piezo2 UTSW 18 63,239,345 (GRCm39) missense probably damaging 1.00
R2230:Piezo2 UTSW 18 63,278,143 (GRCm39) missense probably damaging 1.00
R2231:Piezo2 UTSW 18 63,278,143 (GRCm39) missense probably damaging 1.00
R2406:Piezo2 UTSW 18 63,155,596 (GRCm39) missense probably damaging 1.00
R2431:Piezo2 UTSW 18 63,378,695 (GRCm39) missense possibly damaging 0.95
R2876:Piezo2 UTSW 18 63,186,106 (GRCm39) missense probably damaging 1.00
R2935:Piezo2 UTSW 18 63,279,914 (GRCm39) missense probably damaging 1.00
R3004:Piezo2 UTSW 18 63,157,506 (GRCm39) nonsense probably null
R3016:Piezo2 UTSW 18 63,175,903 (GRCm39) missense probably damaging 1.00
R3794:Piezo2 UTSW 18 63,214,864 (GRCm39) missense probably damaging 0.99
R3832:Piezo2 UTSW 18 63,214,733 (GRCm39) critical splice donor site probably null
R3833:Piezo2 UTSW 18 63,214,733 (GRCm39) critical splice donor site probably null
R3968:Piezo2 UTSW 18 63,144,767 (GRCm39) missense probably damaging 1.00
R3969:Piezo2 UTSW 18 63,144,767 (GRCm39) missense probably damaging 1.00
R3970:Piezo2 UTSW 18 63,144,767 (GRCm39) missense probably damaging 1.00
R4169:Piezo2 UTSW 18 63,183,675 (GRCm39) missense probably benign
R4181:Piezo2 UTSW 18 63,257,801 (GRCm39) critical splice acceptor site probably null
R4301:Piezo2 UTSW 18 63,217,911 (GRCm39) missense probably damaging 1.00
R4302:Piezo2 UTSW 18 63,257,801 (GRCm39) critical splice acceptor site probably null
R4475:Piezo2 UTSW 18 63,235,170 (GRCm39) missense probably damaging 1.00
R4493:Piezo2 UTSW 18 63,247,134 (GRCm39) missense probably damaging 0.98
R4519:Piezo2 UTSW 18 63,205,951 (GRCm39) missense probably damaging 1.00
R4539:Piezo2 UTSW 18 63,219,699 (GRCm39) missense probably damaging 1.00
R4687:Piezo2 UTSW 18 63,203,034 (GRCm39) missense probably damaging 1.00
R4732:Piezo2 UTSW 18 63,163,472 (GRCm39) missense probably damaging 1.00
R4733:Piezo2 UTSW 18 63,163,472 (GRCm39) missense probably damaging 1.00
R4825:Piezo2 UTSW 18 63,278,025 (GRCm39) missense probably damaging 0.98
R4899:Piezo2 UTSW 18 63,211,862 (GRCm39) missense possibly damaging 0.84
R4946:Piezo2 UTSW 18 63,290,333 (GRCm39) missense probably benign
R4961:Piezo2 UTSW 18 63,186,032 (GRCm39) splice site probably null
R4968:Piezo2 UTSW 18 63,278,042 (GRCm39) nonsense probably null
R4973:Piezo2 UTSW 18 63,207,751 (GRCm39) missense probably damaging 1.00
R4997:Piezo2 UTSW 18 63,216,184 (GRCm39) missense probably damaging 1.00
R5078:Piezo2 UTSW 18 63,157,607 (GRCm39) missense probably damaging 1.00
R5134:Piezo2 UTSW 18 63,207,691 (GRCm39) missense probably damaging 1.00
R5151:Piezo2 UTSW 18 63,163,480 (GRCm39) missense possibly damaging 0.72
R5209:Piezo2 UTSW 18 63,166,000 (GRCm39) missense probably damaging 1.00
R5367:Piezo2 UTSW 18 63,197,802 (GRCm39) missense probably damaging 1.00
R5401:Piezo2 UTSW 18 63,217,811 (GRCm39) missense possibly damaging 0.81
R5464:Piezo2 UTSW 18 63,278,176 (GRCm39) missense probably damaging 1.00
R5469:Piezo2 UTSW 18 63,160,935 (GRCm39) missense probably damaging 1.00
R5650:Piezo2 UTSW 18 63,144,792 (GRCm39) missense probably damaging 1.00
R5654:Piezo2 UTSW 18 63,278,162 (GRCm39) missense possibly damaging 0.94
R5677:Piezo2 UTSW 18 63,250,768 (GRCm39) missense probably benign 0.25
R5677:Piezo2 UTSW 18 63,250,767 (GRCm39) missense possibly damaging 0.94
R5792:Piezo2 UTSW 18 63,279,927 (GRCm39) missense probably damaging 1.00
R5874:Piezo2 UTSW 18 63,160,972 (GRCm39) missense probably damaging 1.00
R5877:Piezo2 UTSW 18 63,247,005 (GRCm39) missense probably benign 0.22
R6036:Piezo2 UTSW 18 63,248,019 (GRCm39) nonsense probably null
R6036:Piezo2 UTSW 18 63,248,019 (GRCm39) nonsense probably null
R6073:Piezo2 UTSW 18 63,145,716 (GRCm39) missense probably damaging 1.00
R6198:Piezo2 UTSW 18 63,290,281 (GRCm39) nonsense probably null
R6255:Piezo2 UTSW 18 63,254,341 (GRCm39) missense possibly damaging 0.75
R6259:Piezo2 UTSW 18 63,250,749 (GRCm39) missense possibly damaging 0.69
R6391:Piezo2 UTSW 18 63,239,364 (GRCm39) missense possibly damaging 0.79
R6446:Piezo2 UTSW 18 63,219,678 (GRCm39) missense probably damaging 1.00
R6465:Piezo2 UTSW 18 63,174,734 (GRCm39) missense possibly damaging 0.82
R6518:Piezo2 UTSW 18 63,239,342 (GRCm39) missense probably damaging 0.99
R6521:Piezo2 UTSW 18 63,154,399 (GRCm39) missense probably damaging 1.00
R6625:Piezo2 UTSW 18 63,154,333 (GRCm39) missense probably damaging 1.00
R6744:Piezo2 UTSW 18 63,165,960 (GRCm39) nonsense probably null
R6855:Piezo2 UTSW 18 63,223,950 (GRCm39) critical splice donor site probably null
R6927:Piezo2 UTSW 18 63,166,057 (GRCm39) missense probably damaging 1.00
R6980:Piezo2 UTSW 18 63,216,032 (GRCm39) critical splice acceptor site probably null
R7141:Piezo2 UTSW 18 63,278,181 (GRCm39) nonsense probably null
R7162:Piezo2 UTSW 18 63,257,780 (GRCm39) missense possibly damaging 0.50
R7331:Piezo2 UTSW 18 63,241,101 (GRCm39) missense probably damaging 0.99
R7382:Piezo2 UTSW 18 63,150,590 (GRCm39) splice site probably null
R7395:Piezo2 UTSW 18 63,160,634 (GRCm39) missense probably damaging 1.00
R7448:Piezo2 UTSW 18 63,157,543 (GRCm39) missense probably damaging 1.00
R7465:Piezo2 UTSW 18 63,145,794 (GRCm39) missense probably benign
R7517:Piezo2 UTSW 18 63,215,996 (GRCm39) missense possibly damaging 0.52
R7577:Piezo2 UTSW 18 63,186,081 (GRCm39) missense probably benign 0.01
R7612:Piezo2 UTSW 18 63,175,610 (GRCm39) missense probably benign 0.12
R7829:Piezo2 UTSW 18 63,246,947 (GRCm39) critical splice donor site probably null
R7835:Piezo2 UTSW 18 63,216,016 (GRCm39) missense probably benign 0.12
R8014:Piezo2 UTSW 18 63,216,271 (GRCm39) missense probably benign 0.02
R8055:Piezo2 UTSW 18 63,175,882 (GRCm39) missense probably damaging 0.99
R8062:Piezo2 UTSW 18 63,163,537 (GRCm39) missense possibly damaging 0.87
R8306:Piezo2 UTSW 18 63,208,801 (GRCm39) missense probably damaging 1.00
R8332:Piezo2 UTSW 18 63,145,857 (GRCm39) missense possibly damaging 0.67
R8355:Piezo2 UTSW 18 63,224,069 (GRCm39) missense probably damaging 1.00
R8383:Piezo2 UTSW 18 63,217,759 (GRCm39) missense probably damaging 0.97
R8455:Piezo2 UTSW 18 63,224,069 (GRCm39) missense probably damaging 1.00
R8501:Piezo2 UTSW 18 63,178,611 (GRCm39) missense probably damaging 0.99
R8523:Piezo2 UTSW 18 63,279,873 (GRCm39) missense probably damaging 0.99
R8692:Piezo2 UTSW 18 63,225,971 (GRCm39) nonsense probably null
R8708:Piezo2 UTSW 18 63,226,086 (GRCm39) missense probably damaging 1.00
R8726:Piezo2 UTSW 18 63,242,956 (GRCm39) missense probably benign
R8727:Piezo2 UTSW 18 63,242,956 (GRCm39) missense probably benign
R8810:Piezo2 UTSW 18 63,248,034 (GRCm39) missense probably benign 0.41
R8900:Piezo2 UTSW 18 63,248,096 (GRCm39) missense probably benign 0.04
R9037:Piezo2 UTSW 18 63,225,902 (GRCm39) missense probably benign 0.31
R9079:Piezo2 UTSW 18 63,157,537 (GRCm39) missense probably damaging 1.00
R9090:Piezo2 UTSW 18 63,208,790 (GRCm39) missense probably damaging 0.99
R9123:Piezo2 UTSW 18 63,178,589 (GRCm39) missense probably benign 0.00
R9125:Piezo2 UTSW 18 63,178,589 (GRCm39) missense probably benign 0.00
R9171:Piezo2 UTSW 18 63,178,550 (GRCm39) missense probably benign 0.04
R9194:Piezo2 UTSW 18 63,250,815 (GRCm39) missense probably benign 0.03
R9203:Piezo2 UTSW 18 63,290,302 (GRCm39) missense probably benign 0.00
R9209:Piezo2 UTSW 18 63,154,372 (GRCm39) missense probably damaging 1.00
R9261:Piezo2 UTSW 18 63,208,868 (GRCm39) missense possibly damaging 0.84
R9271:Piezo2 UTSW 18 63,163,450 (GRCm39) missense probably damaging 0.99
R9271:Piezo2 UTSW 18 63,208,790 (GRCm39) missense probably damaging 0.99
R9283:Piezo2 UTSW 18 63,157,637 (GRCm39) missense probably damaging 1.00
R9377:Piezo2 UTSW 18 63,162,156 (GRCm39) missense possibly damaging 0.48
R9499:Piezo2 UTSW 18 63,166,033 (GRCm39) missense possibly damaging 0.67
R9531:Piezo2 UTSW 18 63,235,236 (GRCm39) missense possibly damaging 0.95
R9551:Piezo2 UTSW 18 63,166,033 (GRCm39) missense possibly damaging 0.67
R9607:Piezo2 UTSW 18 63,519,347 (GRCm39) start gained probably benign
R9608:Piezo2 UTSW 18 63,280,016 (GRCm39) missense probably benign 0.09
R9617:Piezo2 UTSW 18 63,248,108 (GRCm39) missense probably benign 0.43
R9624:Piezo2 UTSW 18 63,197,767 (GRCm39) missense possibly damaging 0.88
X0017:Piezo2 UTSW 18 63,160,657 (GRCm39) missense probably damaging 0.99
X0022:Piezo2 UTSW 18 63,183,681 (GRCm39) missense probably benign 0.43
X0060:Piezo2 UTSW 18 63,150,648 (GRCm39) missense probably benign 0.09
Z1088:Piezo2 UTSW 18 63,203,065 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGATAGCACCGAACCACTTC -3'
(R):5'- CCACCCAAGATGCTAGCTAG -3'

Sequencing Primer
(F):5'- TTCCCTCCCCAGATGCAGAG -3'
(R):5'- GCCTCAGCTGTCATCTTCTC -3'
Posted On 2021-12-30