Incidental Mutation 'R9091:Pkd1l2'
ID 691000
Institutional Source Beutler Lab
Gene Symbol Pkd1l2
Ensembl Gene ENSMUSG00000034416
Gene Name polycystic kidney disease 1 like 2
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9091 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 116995679-117082449 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 117032694 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 1516 (K1516E)
Ref Sequence ENSEMBL: ENSMUSP00000104721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098375] [ENSMUST00000109093]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000098375
AA Change: K1515E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095977
Gene: ENSMUSG00000034416
AA Change: K1515E

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CLECT 26 152 1.56e-21 SMART
Pfam:Gal_Lectin 168 250 1.8e-18 PFAM
PKD 260 341 3.84e-1 SMART
low complexity region 496 507 N/A INTRINSIC
Pfam:REJ 510 886 1.8e-13 PFAM
low complexity region 1050 1060 N/A INTRINSIC
GPS 1278 1327 1.61e-11 SMART
transmembrane domain 1346 1365 N/A INTRINSIC
LH2 1390 1509 6.05e-13 SMART
transmembrane domain 1552 1574 N/A INTRINSIC
transmembrane domain 1589 1611 N/A INTRINSIC
transmembrane domain 1815 1837 N/A INTRINSIC
transmembrane domain 1852 1874 N/A INTRINSIC
transmembrane domain 1940 1962 N/A INTRINSIC
Pfam:PKD_channel 1980 2403 6.4e-107 PFAM
Pfam:Ion_trans 2187 2396 2.5e-12 PFAM
low complexity region 2441 2458 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109093
AA Change: K1516E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104721
Gene: ENSMUSG00000034416
AA Change: K1516E

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CLECT 26 152 1.56e-21 SMART
Pfam:Gal_Lectin 168 250 6.9e-19 PFAM
PKD 260 341 3.84e-1 SMART
low complexity region 496 507 N/A INTRINSIC
Pfam:REJ 519 883 7e-11 PFAM
low complexity region 1051 1061 N/A INTRINSIC
GPS 1279 1328 1.61e-11 SMART
transmembrane domain 1347 1366 N/A INTRINSIC
LH2 1391 1510 6.05e-13 SMART
transmembrane domain 1553 1575 N/A INTRINSIC
transmembrane domain 1590 1612 N/A INTRINSIC
transmembrane domain 1816 1838 N/A INTRINSIC
transmembrane domain 1853 1875 N/A INTRINSIC
transmembrane domain 1941 1963 N/A INTRINSIC
Pfam:PKD_channel 1981 2403 5.9e-106 PFAM
Pfam:Ion_trans 2138 2409 3.4e-12 PFAM
low complexity region 2442 2459 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family. The encoded protein contains 11 transmembrane domains, a latrophilin/CL-1-like GPCR proteolytic site (GPS) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. This protein may function as a component of cation channel pores. This gene appears to be a polymorphic pseudogene in humans, where some individuals contain a non-functional allele. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A C 17: 33,067,727 C34G probably damaging Het
Actrt3 T A 3: 30,598,632 E104D probably damaging Het
Arih2 A T 9: 108,616,691 D174E probably damaging Het
Armc4 T A 18: 7,217,846 K623* probably null Het
Asprv1 T C 6: 86,629,095 F308L probably damaging Het
Baiap2l2 A G 15: 79,284,005 probably null Het
Btla T C 16: 45,244,293 F203L possibly damaging Het
C1rb A T 6: 124,574,988 D283V probably damaging Het
C87436 C G 6: 86,465,831 Q462E probably benign Het
Ccdc149 T C 5: 52,406,010 D147G possibly damaging Het
Chd6 A T 2: 161,029,873 L214* probably null Het
Chrna4 C A 2: 181,028,850 R371L possibly damaging Het
Cit C A 5: 115,846,102 probably benign Het
Cpne5 A G 17: 29,225,189 probably null Het
Cr1l T C 1: 195,106,896 E400G possibly damaging Het
Creb3l2 T C 6: 37,355,648 N304D probably damaging Het
Cyp17a1 T C 19: 46,667,591 T420A probably benign Het
Cyp24a1 A G 2: 170,485,933 I463T probably damaging Het
Cyp3a41b A T 5: 145,578,163 I84N probably damaging Het
Dnajc6 G A 4: 101,639,362 V909M possibly damaging Het
Dtl A G 1: 191,556,811 Y264H probably damaging Het
Dysf C T 6: 84,100,234 R660* probably null Het
Egf A G 3: 129,735,800 probably null Het
Eva1c T C 16: 90,904,343 S402P probably benign Het
Fcho2 A T 13: 98,789,361 probably null Het
Fhdc1 G A 3: 84,444,983 R197C unknown Het
Foxa2 T A 2: 148,044,506 M136L probably benign Het
Gm10226 T C 17: 21,691,959 C34R possibly damaging Het
Gm29735 ACAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAACAGCAGGATTCGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAAGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCA ACAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAACAGCAGGATTCGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAAGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCA 7: 142,156,529 probably benign Het
Gm8947 T C 1: 151,193,102 S229P probably benign Het
Ighv9-2 A T 12: 114,109,276 S26T probably damaging Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kat6a T G 8: 22,930,174 I745M probably damaging Het
Klhdc1 T C 12: 69,263,194 L290P probably damaging Het
Lcp2 C T 11: 34,089,688 T496I Het
Map4k4 T C 1: 40,003,763 W593R probably benign Het
Mefv T G 16: 3,717,977 Q29P probably damaging Het
Mgat5b T C 11: 116,968,443 Y34H Het
Mlip C T 9: 77,229,798 R609Q probably benign Het
Muc2 A G 7: 141,704,267 D34G Het
Nbeal1 C T 1: 60,268,389 P1687S possibly damaging Het
Notch1 T A 2: 26,479,883 I477L probably damaging Het
Olfr1239 A T 2: 89,418,368 L15Q probably damaging Het
Olfr1496 T C 19: 13,780,969 V117A probably benign Het
Olfr364-ps1 G A 2: 37,147,035 M274I probably benign Het
Olfr624 T A 7: 103,670,917 N38I probably damaging Het
Olfr807 A G 10: 129,755,279 M57T probably damaging Het
Pak7 A T 2: 136,116,768 S133R probably damaging Het
Pcyt1a C A 16: 32,466,514 D187E probably benign Het
Pdlim7 G T 13: 55,507,541 T161K probably damaging Het
Pik3r4 A G 9: 105,669,909 K962R probably benign Het
Plk5 C G 10: 80,357,996 R40G probably damaging Het
Ptchd3 A T 11: 121,842,354 Y690F probably benign Het
Ptpn13 A T 5: 103,501,869 R379S possibly damaging Het
Rbm27 C T 18: 42,305,764 A410V probably benign Het
Rnase4 A G 14: 51,105,205 T129A probably benign Het
Serpinb11 C T 1: 107,376,803 T166I probably benign Het
Shank2 A G 7: 144,409,968 T438A possibly damaging Het
Slc13a2 T C 11: 78,404,432 N172D probably damaging Het
Slc2a8 A G 2: 32,974,852 F428L probably damaging Het
Slc38a6 T C 12: 73,351,770 M358T probably benign Het
Snx29 A G 16: 11,395,291 H107R probably benign Het
Sorbs2 T G 8: 45,795,737 V675G probably benign Het
Spint3 G A 2: 164,573,234 A21V probably benign Het
Susd1 A T 4: 59,412,226 V162E probably benign Het
Syne2 T G 12: 75,931,060 N1426K probably damaging Het
Synj2 T C 17: 6,017,600 V638A possibly damaging Het
Thada A T 17: 84,231,161 L1473Q probably damaging Het
Trim36 G A 18: 46,167,513 S697L possibly damaging Het
Ttbk1 A T 17: 46,470,591 I412N possibly damaging Het
Tubb2a T C 13: 34,074,595 D404G probably damaging Het
Tyk2 T A 9: 21,124,545 N114Y probably damaging Het
Umodl1 A G 17: 30,966,704 D139G probably damaging Het
Vmn2r101 T A 17: 19,589,982 N343K probably benign Het
Vnn1 A G 10: 23,904,566 D484G probably damaging Het
Vps13b A G 15: 35,770,773 T2121A probably benign Het
Wdr81 T C 11: 75,454,390 E17G probably benign Het
Wnk2 T G 13: 49,071,029 K1117Q probably benign Het
Zbtb46 C T 2: 181,424,345 R4Q probably benign Het
Zfp608 T A 18: 54,899,118 K583N probably damaging Het
Zfp729b A T 13: 67,592,361 L595H probably damaging Het
Other mutations in Pkd1l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01338:Pkd1l2 APN 8 117059520 nonsense probably null
IGL01353:Pkd1l2 APN 8 117057443 missense probably benign 0.24
IGL01362:Pkd1l2 APN 8 117021856 missense probably damaging 1.00
IGL01486:Pkd1l2 APN 8 117059592 missense probably benign
IGL01672:Pkd1l2 APN 8 117080732 missense possibly damaging 0.94
IGL01696:Pkd1l2 APN 8 117056387 missense probably benign 0.12
IGL01819:Pkd1l2 APN 8 116998174 missense probably damaging 1.00
IGL01833:Pkd1l2 APN 8 117060525 missense probably benign 0.00
IGL01981:Pkd1l2 APN 8 117016916 missense probably benign 0.04
IGL02066:Pkd1l2 APN 8 117009564 splice site probably benign
IGL02381:Pkd1l2 APN 8 117035800 splice site probably benign
IGL02416:Pkd1l2 APN 8 117040835 missense possibly damaging 0.82
IGL02736:Pkd1l2 APN 8 117040666 missense probably benign 0.00
IGL02828:Pkd1l2 APN 8 117029559 missense probably benign
IGL02861:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02862:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02883:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02884:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02894:Pkd1l2 APN 8 117013891 missense probably damaging 0.97
IGL02900:Pkd1l2 APN 8 117024091 missense probably benign 0.03
IGL02901:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02929:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02941:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02957:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02969:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03028:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03059:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03065:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03066:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03083:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03084:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03124:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03162:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03165:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03335:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03357:Pkd1l2 APN 8 116995809 missense probably damaging 1.00
IGL02835:Pkd1l2 UTSW 8 117065745 missense probably benign 0.07
PIT4453001:Pkd1l2 UTSW 8 117022022 missense probably benign 0.00
R0127:Pkd1l2 UTSW 8 117050048 splice site probably benign
R0309:Pkd1l2 UTSW 8 116997576 missense probably damaging 0.99
R0365:Pkd1l2 UTSW 8 117021850 missense probably benign 0.02
R0526:Pkd1l2 UTSW 8 117082260 missense probably damaging 1.00
R0571:Pkd1l2 UTSW 8 117082218 missense probably benign 0.01
R0716:Pkd1l2 UTSW 8 117051100 missense probably damaging 1.00
R0787:Pkd1l2 UTSW 8 117076177 missense possibly damaging 0.90
R0893:Pkd1l2 UTSW 8 117044492 missense probably damaging 0.99
R1256:Pkd1l2 UTSW 8 117019543 critical splice acceptor site probably null
R1391:Pkd1l2 UTSW 8 117054934 missense possibly damaging 0.87
R1474:Pkd1l2 UTSW 8 117065497 splice site probably benign
R1491:Pkd1l2 UTSW 8 117028408 missense probably damaging 1.00
R1520:Pkd1l2 UTSW 8 117046159 missense probably benign 0.00
R1521:Pkd1l2 UTSW 8 117065500 splice site probably null
R1544:Pkd1l2 UTSW 8 117038235 frame shift probably null
R1558:Pkd1l2 UTSW 8 117082252 missense possibly damaging 0.94
R1673:Pkd1l2 UTSW 8 117040775 missense probably benign 0.00
R1691:Pkd1l2 UTSW 8 117056419 missense possibly damaging 0.60
R1754:Pkd1l2 UTSW 8 117030719 missense possibly damaging 0.81
R1857:Pkd1l2 UTSW 8 117040669 missense possibly damaging 0.70
R1939:Pkd1l2 UTSW 8 117046182 nonsense probably null
R1955:Pkd1l2 UTSW 8 117043361 missense probably benign
R1957:Pkd1l2 UTSW 8 117030682 missense probably damaging 1.00
R1959:Pkd1l2 UTSW 8 117043231 critical splice donor site probably null
R2024:Pkd1l2 UTSW 8 117019533 missense probably benign
R2046:Pkd1l2 UTSW 8 116999955 missense probably damaging 1.00
R2102:Pkd1l2 UTSW 8 117081469 missense probably damaging 0.98
R2116:Pkd1l2 UTSW 8 117030722 missense possibly damaging 0.93
R2148:Pkd1l2 UTSW 8 117056325 missense probably damaging 0.98
R2251:Pkd1l2 UTSW 8 117057438 missense probably damaging 1.00
R2252:Pkd1l2 UTSW 8 117057438 missense probably damaging 1.00
R2366:Pkd1l2 UTSW 8 117043317 missense probably benign 0.01
R2566:Pkd1l2 UTSW 8 117019494 missense probably damaging 1.00
R2872:Pkd1l2 UTSW 8 117038164 missense probably benign 0.10
R2872:Pkd1l2 UTSW 8 117038164 missense probably benign 0.10
R2985:Pkd1l2 UTSW 8 117065551 missense probably benign 0.00
R3055:Pkd1l2 UTSW 8 117068315 critical splice acceptor site probably null
R3436:Pkd1l2 UTSW 8 117040739 missense probably benign 0.01
R4732:Pkd1l2 UTSW 8 116995842 critical splice acceptor site probably null
R4733:Pkd1l2 UTSW 8 116995842 critical splice acceptor site probably null
R4763:Pkd1l2 UTSW 8 117019429 missense probably damaging 0.96
R4789:Pkd1l2 UTSW 8 117011575 missense probably damaging 0.99
R4921:Pkd1l2 UTSW 8 117054885 missense probably benign 0.03
R4921:Pkd1l2 UTSW 8 117072549 missense probably damaging 0.97
R4999:Pkd1l2 UTSW 8 117047374 splice site probably null
R5057:Pkd1l2 UTSW 8 117055008 missense probably benign 0.21
R5209:Pkd1l2 UTSW 8 117056442 missense probably benign 0.23
R5241:Pkd1l2 UTSW 8 117035118 missense probably damaging 1.00
R5480:Pkd1l2 UTSW 8 117030649 missense probably damaging 0.99
R5501:Pkd1l2 UTSW 8 117065830 missense probably damaging 0.98
R5533:Pkd1l2 UTSW 8 117068116 missense probably benign 0.03
R5582:Pkd1l2 UTSW 8 117040783 nonsense probably null
R5610:Pkd1l2 UTSW 8 117042320 missense probably benign 0.04
R5770:Pkd1l2 UTSW 8 117055018 missense probably damaging 1.00
R5854:Pkd1l2 UTSW 8 117065746 missense possibly damaging 0.48
R5867:Pkd1l2 UTSW 8 117055011 missense probably damaging 0.96
R5881:Pkd1l2 UTSW 8 116997582 missense probably damaging 0.99
R5906:Pkd1l2 UTSW 8 117029648 missense probably damaging 1.00
R5909:Pkd1l2 UTSW 8 117024056 missense probably benign 0.00
R6030:Pkd1l2 UTSW 8 117043237 missense probably damaging 1.00
R6030:Pkd1l2 UTSW 8 117043237 missense probably damaging 1.00
R6084:Pkd1l2 UTSW 8 117013987 missense probably damaging 1.00
R6122:Pkd1l2 UTSW 8 117082368 missense probably benign 0.02
R6216:Pkd1l2 UTSW 8 117081470 missense probably damaging 1.00
R6406:Pkd1l2 UTSW 8 117035847 missense probably damaging 0.99
R6417:Pkd1l2 UTSW 8 117013899 missense probably damaging 1.00
R6420:Pkd1l2 UTSW 8 117013899 missense probably damaging 1.00
R6601:Pkd1l2 UTSW 8 117040666 missense probably benign 0.00
R6743:Pkd1l2 UTSW 8 117030631 missense probably damaging 1.00
R7053:Pkd1l2 UTSW 8 117013942 missense probably damaging 1.00
R7144:Pkd1l2 UTSW 8 117076131 nonsense probably null
R7148:Pkd1l2 UTSW 8 117080786 missense probably benign 0.00
R7169:Pkd1l2 UTSW 8 117040835 missense possibly damaging 0.82
R7217:Pkd1l2 UTSW 8 116995797 missense probably benign 0.24
R7310:Pkd1l2 UTSW 8 117024034 missense probably benign
R7382:Pkd1l2 UTSW 8 117054871 missense possibly damaging 0.95
R7397:Pkd1l2 UTSW 8 117035902 missense possibly damaging 0.94
R7408:Pkd1l2 UTSW 8 117028479 missense possibly damaging 0.77
R7437:Pkd1l2 UTSW 8 117030682 missense probably damaging 0.96
R7492:Pkd1l2 UTSW 8 117068110 missense probably damaging 1.00
R7496:Pkd1l2 UTSW 8 117060594 missense possibly damaging 0.89
R7519:Pkd1l2 UTSW 8 117065529 missense probably benign
R7590:Pkd1l2 UTSW 8 117080786 missense probably benign 0.00
R7623:Pkd1l2 UTSW 8 117029645 missense probably damaging 1.00
R7768:Pkd1l2 UTSW 8 117054860 critical splice donor site probably null
R7897:Pkd1l2 UTSW 8 116998088 missense possibly damaging 0.69
R7982:Pkd1l2 UTSW 8 117051187 missense possibly damaging 0.70
R8024:Pkd1l2 UTSW 8 117076182 missense possibly damaging 0.85
R8140:Pkd1l2 UTSW 8 117047497 missense probably benign
R8145:Pkd1l2 UTSW 8 117055003 missense probably benign
R8228:Pkd1l2 UTSW 8 117065775 missense probably damaging 0.97
R8252:Pkd1l2 UTSW 8 117040733 missense probably benign 0.29
R8500:Pkd1l2 UTSW 8 117047563 critical splice acceptor site probably null
R8732:Pkd1l2 UTSW 8 117065572 missense probably benign 0.28
R8809:Pkd1l2 UTSW 8 116999921 missense probably damaging 1.00
R8896:Pkd1l2 UTSW 8 117013876 missense possibly damaging 0.91
R8961:Pkd1l2 UTSW 8 116999978 missense possibly damaging 0.52
R8985:Pkd1l2 UTSW 8 117038110 missense probably benign 0.01
R9008:Pkd1l2 UTSW 8 117042298 missense probably benign 0.32
R9138:Pkd1l2 UTSW 8 117055009 missense probably benign 0.43
R9160:Pkd1l2 UTSW 8 117040669 missense possibly damaging 0.70
R9249:Pkd1l2 UTSW 8 117019420 missense probably damaging 0.99
R9270:Pkd1l2 UTSW 8 117032694 missense probably damaging 1.00
Z1176:Pkd1l2 UTSW 8 117054914 missense probably damaging 1.00
Z1177:Pkd1l2 UTSW 8 117030691 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGAACATTTGGACCAGCAG -3'
(R):5'- GGGGTTCCTTTTCTGAAGATCC -3'

Sequencing Primer
(F):5'- ATTTGGACCAGCAGTGTCAC -3'
(R):5'- GAAGATCCTACCTCTGTGATGTC -3'
Posted On 2021-12-30