Incidental Mutation 'R9091:Syne2'
ID 691015
Institutional Source Beutler Lab
Gene Symbol Syne2
Ensembl Gene ENSMUSG00000063450
Gene Name spectrin repeat containing, nuclear envelope 2
Synonyms Nesp2g, diminished cone electroretinogram, Cpfl8, dice, 6820443O06Rik, nesprin-2, syne-2, D12Ertd777e
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.268) question?
Stock # R9091 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 75865092-76157702 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 75977834 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 1426 (N1426K)
Ref Sequence ENSEMBL: ENSMUSP00000047697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044217] [ENSMUST00000143031]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000044217
AA Change: N1426K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047697
Gene: ENSMUSG00000063450
AA Change: N1426K

DomainStartEndE-ValueType
CH 33 134 7.97e-19 SMART
low complexity region 151 175 N/A INTRINSIC
CH 185 283 1.34e-20 SMART
low complexity region 494 505 N/A INTRINSIC
coiled coil region 541 572 N/A INTRINSIC
low complexity region 665 674 N/A INTRINSIC
coiled coil region 844 869 N/A INTRINSIC
coiled coil region 936 969 N/A INTRINSIC
coiled coil region 1006 1032 N/A INTRINSIC
SPEC 1427 1525 4.96e0 SMART
SPEC 1528 1632 2.48e-1 SMART
coiled coil region 1660 1699 N/A INTRINSIC
SPEC 2034 2131 1.83e0 SMART
coiled coil region 2173 2194 N/A INTRINSIC
low complexity region 2295 2307 N/A INTRINSIC
coiled coil region 2316 2348 N/A INTRINSIC
SPEC 2720 2820 1.44e-5 SMART
coiled coil region 2905 2934 N/A INTRINSIC
coiled coil region 2962 2989 N/A INTRINSIC
coiled coil region 3108 3136 N/A INTRINSIC
low complexity region 3333 3350 N/A INTRINSIC
low complexity region 3514 3523 N/A INTRINSIC
low complexity region 3666 3676 N/A INTRINSIC
coiled coil region 3678 3708 N/A INTRINSIC
coiled coil region 3761 3788 N/A INTRINSIC
coiled coil region 3846 3903 N/A INTRINSIC
coiled coil region 4015 4067 N/A INTRINSIC
low complexity region 4102 4115 N/A INTRINSIC
coiled coil region 4483 4511 N/A INTRINSIC
low complexity region 4557 4569 N/A INTRINSIC
coiled coil region 4655 4688 N/A INTRINSIC
low complexity region 4749 4763 N/A INTRINSIC
SPEC 4827 4926 5.25e-1 SMART
SPEC 4933 5038 2.64e-4 SMART
SPEC 5048 5152 1.47e-2 SMART
SPEC 5159 5259 4.29e0 SMART
SPEC 5263 5371 4.47e0 SMART
low complexity region 5373 5393 N/A INTRINSIC
SPEC 5583 5681 5.7e-1 SMART
Blast:SPEC 5690 5793 2e-53 BLAST
SPEC 5800 5900 2.11e0 SMART
SPEC 5907 6005 6.91e-8 SMART
SPEC 6012 6119 4.45e-11 SMART
SPEC 6126 6228 6.39e-12 SMART
SPEC 6235 6335 7.75e-11 SMART
SPEC 6539 6642 5.53e-7 SMART
SPEC 6649 6753 5.12e-2 SMART
KASH 6817 6874 8.17e-34 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000143031
AA Change: N1427K

PolyPhen 2 Score 0.849 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000119120
Gene: ENSMUSG00000063450
AA Change: N1427K

DomainStartEndE-ValueType
CH 33 134 7.97e-19 SMART
low complexity region 151 175 N/A INTRINSIC
CH 185 283 1.34e-20 SMART
low complexity region 494 505 N/A INTRINSIC
coiled coil region 541 572 N/A INTRINSIC
coiled coil region 845 870 N/A INTRINSIC
coiled coil region 937 970 N/A INTRINSIC
coiled coil region 1007 1033 N/A INTRINSIC
SPEC 1428 1526 4.96e0 SMART
SPEC 1529 1633 2.48e-1 SMART
coiled coil region 1661 1700 N/A INTRINSIC
SPEC 2035 2132 1.83e0 SMART
coiled coil region 2174 2195 N/A INTRINSIC
low complexity region 2296 2308 N/A INTRINSIC
coiled coil region 2317 2349 N/A INTRINSIC
SPEC 2721 2821 1.44e-5 SMART
coiled coil region 2906 2935 N/A INTRINSIC
coiled coil region 2963 2990 N/A INTRINSIC
coiled coil region 3109 3137 N/A INTRINSIC
low complexity region 3334 3351 N/A INTRINSIC
low complexity region 3515 3524 N/A INTRINSIC
low complexity region 3667 3677 N/A INTRINSIC
coiled coil region 3679 3709 N/A INTRINSIC
coiled coil region 3762 3789 N/A INTRINSIC
coiled coil region 3847 3904 N/A INTRINSIC
coiled coil region 4016 4068 N/A INTRINSIC
low complexity region 4103 4116 N/A INTRINSIC
coiled coil region 4484 4512 N/A INTRINSIC
low complexity region 4558 4570 N/A INTRINSIC
coiled coil region 4656 4689 N/A INTRINSIC
low complexity region 4750 4764 N/A INTRINSIC
SPEC 4828 4927 5.25e-1 SMART
SPEC 4934 5039 2.64e-4 SMART
SPEC 5049 5153 1.47e-2 SMART
SPEC 5160 5260 4.29e0 SMART
SPEC 5264 5372 4.47e0 SMART
low complexity region 5374 5394 N/A INTRINSIC
SPEC 5584 5682 5.7e-1 SMART
Blast:SPEC 5691 5794 2e-53 BLAST
SPEC 5801 5901 2.11e0 SMART
SPEC 5908 6006 6.91e-8 SMART
SPEC 6013 6120 4.45e-11 SMART
SPEC 6127 6229 6.39e-12 SMART
SPEC 6236 6336 7.75e-11 SMART
SPEC 6540 6643 5.53e-7 SMART
SPEC 6650 6754 5.12e-2 SMART
KASH 6813 6870 8.17e-34 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear outer membrane protein that binds cytoplasmic F-actin. This binding tethers the nucleus to the cytoskeleton and aids in the maintenance of the structural integrity of the nucleus. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygotes for one knock-out allele show normal myonuclear positioning of both synaptic and non-synaptic nuclei in skeletal muscle cells. Homozygotes for another knock-out allele exhibit a thickened epidermis and altered nuclear envelope architecture inprimary dermal fibroblasts and keratinocytes. Mice homozygous for a spontaneous mutation exhibit early retinal defects in photoreceptors, secondary Neurons, and muller glia. [provided by MGI curators]
Allele List at MGI

 All alleles(5) : Targeted, knock-out(2) Gene trapped(3)

Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actrt3 T A 3: 30,652,781 (GRCm39) E104D probably damaging Het
Arih2 A T 9: 108,493,890 (GRCm39) D174E probably damaging Het
Asprv1 T C 6: 86,606,077 (GRCm39) F308L probably damaging Het
Baiap2l2 A G 15: 79,168,205 (GRCm39) probably null Het
Btla T C 16: 45,064,656 (GRCm39) F203L possibly damaging Het
C1rb A T 6: 124,551,947 (GRCm39) D283V probably damaging Het
C87436 C G 6: 86,442,813 (GRCm39) Q462E probably benign Het
Ccdc149 T C 5: 52,563,352 (GRCm39) D147G possibly damaging Het
Chd6 A T 2: 160,871,793 (GRCm39) L214* probably null Het
Chrna4 C A 2: 180,670,643 (GRCm39) R371L possibly damaging Het
Cit C A 5: 115,984,161 (GRCm39) probably benign Het
Cpne5 A G 17: 29,444,163 (GRCm39) probably null Het
Cr1l T C 1: 194,789,204 (GRCm39) E400G possibly damaging Het
Creb3l2 T C 6: 37,332,583 (GRCm39) N304D probably damaging Het
Cyp17a1 T C 19: 46,656,030 (GRCm39) T420A probably benign Het
Cyp24a1 A G 2: 170,327,853 (GRCm39) I463T probably damaging Het
Cyp3a41b A T 5: 145,514,973 (GRCm39) I84N probably damaging Het
Dnajc6 G A 4: 101,496,559 (GRCm39) V909M possibly damaging Het
Dtl A G 1: 191,288,923 (GRCm39) Y264H probably damaging Het
Dysf C T 6: 84,077,216 (GRCm39) R660* probably null Het
Egf A G 3: 129,529,449 (GRCm39) probably null Het
Eva1c T C 16: 90,701,231 (GRCm39) S402P probably benign Het
Fcho2 A T 13: 98,925,869 (GRCm39) probably null Het
Fhdc1 G A 3: 84,352,290 (GRCm39) R197C unknown Het
Foxa2 T A 2: 147,886,426 (GRCm39) M136L probably benign Het
Gm10226 T C 17: 21,910,866 (GRCm39) C34R possibly damaging Het
Gm29735 ACAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAACAGCAGGATTCGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAAGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCA ACAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAACAGCAGGATTCGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAAGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCA 7: 141,710,266 (GRCm39) probably benign Het
Gm8947 T C 1: 151,068,853 (GRCm39) S229P probably benign Het
Ighv9-2 A T 12: 114,072,896 (GRCm39) S26T probably damaging Het
Itpr3 G A 17: 27,337,651 (GRCm39) probably benign Het
Kat6a T G 8: 23,420,190 (GRCm39) I745M probably damaging Het
Klhdc1 T C 12: 69,309,968 (GRCm39) L290P probably damaging Het
Lcp2 C T 11: 34,039,688 (GRCm39) T496I Het
Map4k4 T C 1: 40,042,923 (GRCm39) W593R probably benign Het
Mefv T G 16: 3,535,841 (GRCm39) Q29P probably damaging Het
Mgat5b T C 11: 116,859,269 (GRCm39) Y34H Het
Mlip C T 9: 77,137,080 (GRCm39) R609Q probably benign Het
Muc2 A G 7: 141,290,816 (GRCm39) D34G Het
Nbeal1 C T 1: 60,307,548 (GRCm39) P1687S possibly damaging Het
Notch1 T A 2: 26,369,895 (GRCm39) I477L probably damaging Het
Odad2 T A 18: 7,217,846 (GRCm39) K623* probably null Het
Or1l4b G A 2: 37,037,047 (GRCm39) M274I probably benign Het
Or1s2 T C 19: 13,758,333 (GRCm39) V117A probably benign Het
Or4a2 A T 2: 89,248,712 (GRCm39) L15Q probably damaging Het
Or51v8 T A 7: 103,320,124 (GRCm39) N38I probably damaging Het
Or6c214 A G 10: 129,591,148 (GRCm39) M57T probably damaging Het
Pak5 A T 2: 135,958,688 (GRCm39) S133R probably damaging Het
Pcyt1a C A 16: 32,285,332 (GRCm39) D187E probably benign Het
Pdlim7 G T 13: 55,655,354 (GRCm39) T161K probably damaging Het
Phf8-ps A C 17: 33,286,701 (GRCm39) C34G probably damaging Het
Pik3r4 A G 9: 105,547,108 (GRCm39) K962R probably benign Het
Pkd1l2 T C 8: 117,759,433 (GRCm39) K1516E probably damaging Het
Plk5 C G 10: 80,193,830 (GRCm39) R40G probably damaging Het
Ptchd3 A T 11: 121,733,180 (GRCm39) Y690F probably benign Het
Ptpn13 A T 5: 103,649,735 (GRCm39) R379S possibly damaging Het
Rbm27 C T 18: 42,438,829 (GRCm39) A410V probably benign Het
Rnase4 A G 14: 51,342,662 (GRCm39) T129A probably benign Het
Serpinb11 C T 1: 107,304,533 (GRCm39) T166I probably benign Het
Shank2 A G 7: 143,963,705 (GRCm39) T438A possibly damaging Het
Slc13a2 T C 11: 78,295,258 (GRCm39) N172D probably damaging Het
Slc2a8 A G 2: 32,864,864 (GRCm39) F428L probably damaging Het
Slc38a6 T C 12: 73,398,544 (GRCm39) M358T probably benign Het
Snx29 A G 16: 11,213,155 (GRCm39) H107R probably benign Het
Sorbs2 T G 8: 46,248,774 (GRCm39) V675G probably benign Het
Spint3 G A 2: 164,415,154 (GRCm39) A21V probably benign Het
Susd1 A T 4: 59,412,226 (GRCm39) V162E probably benign Het
Synj2 T C 17: 6,067,875 (GRCm39) V638A possibly damaging Het
Thada A T 17: 84,538,589 (GRCm39) L1473Q probably damaging Het
Trim36 G A 18: 46,300,580 (GRCm39) S697L possibly damaging Het
Ttbk1 A T 17: 46,781,517 (GRCm39) I412N possibly damaging Het
Tubb2a T C 13: 34,258,578 (GRCm39) D404G probably damaging Het
Tyk2 T A 9: 21,035,841 (GRCm39) N114Y probably damaging Het
Umodl1 A G 17: 31,185,678 (GRCm39) D139G probably damaging Het
Vmn2r101 T A 17: 19,810,244 (GRCm39) N343K probably benign Het
Vnn1 A G 10: 23,780,464 (GRCm39) D484G probably damaging Het
Vps13b A G 15: 35,770,919 (GRCm39) T2121A probably benign Het
Wdr81 T C 11: 75,345,216 (GRCm39) E17G probably benign Het
Wnk2 T G 13: 49,224,505 (GRCm39) K1117Q probably benign Het
Zbtb46 C T 2: 181,066,138 (GRCm39) R4Q probably benign Het
Zfp608 T A 18: 55,032,190 (GRCm39) K583N probably damaging Het
Zfp729b A T 13: 67,740,480 (GRCm39) L595H probably damaging Het
Other mutations in Syne2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Syne2 APN 12 76,078,474 (GRCm39) unclassified probably benign
IGL00595:Syne2 APN 12 75,972,420 (GRCm39) missense possibly damaging 0.76
IGL00672:Syne2 APN 12 76,110,958 (GRCm39) missense probably damaging 1.00
IGL00781:Syne2 APN 12 76,070,836 (GRCm39) missense probably benign 0.00
IGL00823:Syne2 APN 12 76,036,016 (GRCm39) missense probably damaging 0.98
IGL01014:Syne2 APN 12 75,952,051 (GRCm39) missense probably damaging 0.99
IGL01074:Syne2 APN 12 76,078,361 (GRCm39) nonsense probably null
IGL01074:Syne2 APN 12 76,033,785 (GRCm39) missense probably benign 0.00
IGL01324:Syne2 APN 12 76,090,526 (GRCm39) missense probably damaging 1.00
IGL01325:Syne2 APN 12 75,973,288 (GRCm39) missense probably benign 0.01
IGL01331:Syne2 APN 12 75,976,027 (GRCm39) splice site probably benign
IGL01338:Syne2 APN 12 76,107,000 (GRCm39) missense possibly damaging 0.55
IGL01373:Syne2 APN 12 76,033,881 (GRCm39) missense probably damaging 1.00
IGL01446:Syne2 APN 12 76,088,149 (GRCm39) missense probably damaging 1.00
IGL01556:Syne2 APN 12 76,134,589 (GRCm39) missense probably damaging 1.00
IGL01585:Syne2 APN 12 75,995,834 (GRCm39) critical splice acceptor site probably null
IGL01629:Syne2 APN 12 76,051,377 (GRCm39) missense possibly damaging 0.49
IGL01686:Syne2 APN 12 75,956,110 (GRCm39) missense probably benign
IGL01935:Syne2 APN 12 75,972,087 (GRCm39) missense probably damaging 1.00
IGL01941:Syne2 APN 12 76,013,994 (GRCm39) missense probably benign 0.01
IGL01956:Syne2 APN 12 76,144,748 (GRCm39) missense probably damaging 1.00
IGL01967:Syne2 APN 12 75,988,077 (GRCm39) missense probably damaging 1.00
IGL01990:Syne2 APN 12 76,101,707 (GRCm39) missense probably damaging 1.00
IGL02000:Syne2 APN 12 76,062,419 (GRCm39) missense probably damaging 0.99
IGL02063:Syne2 APN 12 76,098,874 (GRCm39) missense probably damaging 0.96
IGL02069:Syne2 APN 12 75,974,186 (GRCm39) missense probably benign 0.13
IGL02120:Syne2 APN 12 75,993,480 (GRCm39) missense probably damaging 1.00
IGL02222:Syne2 APN 12 75,999,617 (GRCm39) missense probably damaging 0.96
IGL02223:Syne2 APN 12 76,155,079 (GRCm39) missense probably benign 0.00
IGL02321:Syne2 APN 12 75,965,773 (GRCm39) missense possibly damaging 0.58
IGL02488:Syne2 APN 12 76,012,512 (GRCm39) missense probably benign 0.24
IGL02491:Syne2 APN 12 76,118,953 (GRCm39) missense probably benign 0.10
IGL02525:Syne2 APN 12 76,147,777 (GRCm39) missense probably damaging 0.99
IGL02578:Syne2 APN 12 76,069,053 (GRCm39) missense possibly damaging 0.76
IGL02615:Syne2 APN 12 76,143,768 (GRCm39) missense probably damaging 1.00
IGL02702:Syne2 APN 12 76,144,698 (GRCm39) missense probably damaging 1.00
IGL02726:Syne2 APN 12 76,062,356 (GRCm39) missense probably damaging 0.99
IGL02795:Syne2 APN 12 76,013,323 (GRCm39) missense probably damaging 0.99
IGL02803:Syne2 APN 12 76,078,320 (GRCm39) missense probably damaging 1.00
IGL02814:Syne2 APN 12 75,992,150 (GRCm39) missense possibly damaging 0.64
IGL03013:Syne2 APN 12 75,976,111 (GRCm39) missense probably benign 0.00
IGL03131:Syne2 APN 12 76,104,264 (GRCm39) missense probably damaging 1.00
IGL03152:Syne2 APN 12 76,012,486 (GRCm39) missense probably benign 0.12
IGL03216:Syne2 APN 12 75,989,735 (GRCm39) splice site probably benign
IGL03228:Syne2 APN 12 76,026,686 (GRCm39) missense probably benign 0.01
IGL03259:Syne2 APN 12 76,035,853 (GRCm39) missense probably benign 0.05
IGL03374:Syne2 APN 12 76,121,360 (GRCm39) missense possibly damaging 0.66
IGL03375:Syne2 APN 12 75,972,209 (GRCm39) missense possibly damaging 0.57
3-1:Syne2 UTSW 12 75,977,406 (GRCm39) missense probably benign 0.02
B5639:Syne2 UTSW 12 75,976,564 (GRCm39) missense probably benign
K3955:Syne2 UTSW 12 75,977,439 (GRCm39) missense probably damaging 1.00
P0026:Syne2 UTSW 12 75,926,994 (GRCm39) splice site probably benign
PIT4514001:Syne2 UTSW 12 76,151,789 (GRCm39) missense probably damaging 0.99
R0089:Syne2 UTSW 12 76,010,650 (GRCm39) missense probably damaging 1.00
R0110:Syne2 UTSW 12 76,144,734 (GRCm39) nonsense probably null
R0113:Syne2 UTSW 12 76,080,496 (GRCm39) missense probably damaging 1.00
R0113:Syne2 UTSW 12 75,977,352 (GRCm39) missense probably damaging 1.00
R0141:Syne2 UTSW 12 75,988,072 (GRCm39) missense probably damaging 1.00
R0211:Syne2 UTSW 12 76,144,731 (GRCm39) missense probably damaging 1.00
R0219:Syne2 UTSW 12 76,088,778 (GRCm39) missense probably damaging 1.00
R0242:Syne2 UTSW 12 76,144,808 (GRCm39) missense probably damaging 1.00
R0242:Syne2 UTSW 12 76,144,808 (GRCm39) missense probably damaging 1.00
R0279:Syne2 UTSW 12 76,142,387 (GRCm39) missense probably damaging 1.00
R0319:Syne2 UTSW 12 76,110,936 (GRCm39) missense probably damaging 0.99
R0325:Syne2 UTSW 12 76,009,415 (GRCm39) missense probably benign 0.00
R0329:Syne2 UTSW 12 76,013,727 (GRCm39) missense probably benign
R0330:Syne2 UTSW 12 76,013,727 (GRCm39) missense probably benign
R0361:Syne2 UTSW 12 75,965,384 (GRCm39) missense probably benign 0.22
R0363:Syne2 UTSW 12 76,118,981 (GRCm39) missense probably damaging 0.98
R0367:Syne2 UTSW 12 75,926,951 (GRCm39) missense probably damaging 1.00
R0371:Syne2 UTSW 12 75,980,619 (GRCm39) missense probably damaging 1.00
R0374:Syne2 UTSW 12 75,968,000 (GRCm39) nonsense probably null
R0388:Syne2 UTSW 12 76,033,749 (GRCm39) missense probably benign 0.41
R0411:Syne2 UTSW 12 76,106,358 (GRCm39) splice site probably null
R0432:Syne2 UTSW 12 75,995,838 (GRCm39) missense probably damaging 0.99
R0469:Syne2 UTSW 12 75,900,923 (GRCm39) critical splice donor site probably null
R0492:Syne2 UTSW 12 76,028,837 (GRCm39) critical splice donor site probably null
R0496:Syne2 UTSW 12 76,085,714 (GRCm39) missense possibly damaging 0.80
R0504:Syne2 UTSW 12 76,080,365 (GRCm39) splice site probably benign
R0505:Syne2 UTSW 12 76,146,238 (GRCm39) missense probably damaging 1.00
R0510:Syne2 UTSW 12 75,900,923 (GRCm39) critical splice donor site probably null
R0518:Syne2 UTSW 12 76,155,636 (GRCm39) critical splice acceptor site probably null
R0539:Syne2 UTSW 12 76,070,895 (GRCm39) missense possibly damaging 0.69
R0552:Syne2 UTSW 12 75,977,778 (GRCm39) missense probably benign 0.00
R0557:Syne2 UTSW 12 75,976,075 (GRCm39) missense probably benign 0.04
R0567:Syne2 UTSW 12 75,937,004 (GRCm39) missense probably damaging 0.98
R0599:Syne2 UTSW 12 76,144,734 (GRCm39) nonsense probably null
R0602:Syne2 UTSW 12 76,144,734 (GRCm39) nonsense probably null
R0608:Syne2 UTSW 12 76,010,587 (GRCm39) missense probably damaging 1.00
R0614:Syne2 UTSW 12 75,959,127 (GRCm39) splice site probably null
R0636:Syne2 UTSW 12 75,977,757 (GRCm39) missense possibly damaging 0.75
R0647:Syne2 UTSW 12 75,934,977 (GRCm39) missense probably benign
R0654:Syne2 UTSW 12 76,144,734 (GRCm39) nonsense probably null
R0658:Syne2 UTSW 12 76,141,110 (GRCm39) missense probably damaging 1.00
R0666:Syne2 UTSW 12 75,969,787 (GRCm39) missense probably damaging 0.99
R0707:Syne2 UTSW 12 76,028,837 (GRCm39) critical splice donor site probably null
R0714:Syne2 UTSW 12 76,144,734 (GRCm39) nonsense probably null
R0841:Syne2 UTSW 12 76,121,209 (GRCm39) splice site probably benign
R0848:Syne2 UTSW 12 76,144,734 (GRCm39) nonsense probably null
R0848:Syne2 UTSW 12 76,144,733 (GRCm39) frame shift probably null
R1077:Syne2 UTSW 12 76,088,809 (GRCm39) missense possibly damaging 0.94
R1103:Syne2 UTSW 12 76,156,609 (GRCm39) missense probably benign 0.00
R1144:Syne2 UTSW 12 76,013,298 (GRCm39) missense probably benign 0.04
R1194:Syne2 UTSW 12 75,981,287 (GRCm39) missense probably damaging 1.00
R1247:Syne2 UTSW 12 76,014,264 (GRCm39) missense probably benign 0.39
R1276:Syne2 UTSW 12 75,987,963 (GRCm39) critical splice acceptor site probably null
R1343:Syne2 UTSW 12 76,080,417 (GRCm39) missense probably damaging 1.00
R1442:Syne2 UTSW 12 75,993,489 (GRCm39) missense probably damaging 1.00
R1448:Syne2 UTSW 12 76,098,952 (GRCm39) missense possibly damaging 0.56
R1448:Syne2 UTSW 12 76,067,099 (GRCm39) splice site probably null
R1522:Syne2 UTSW 12 76,150,557 (GRCm39) missense probably damaging 0.98
R1528:Syne2 UTSW 12 76,012,874 (GRCm39) missense probably benign 0.00
R1636:Syne2 UTSW 12 76,051,506 (GRCm39) missense probably benign 0.01
R1637:Syne2 UTSW 12 76,042,776 (GRCm39) missense probably damaging 1.00
R1650:Syne2 UTSW 12 75,951,033 (GRCm39) nonsense probably null
R1654:Syne2 UTSW 12 76,147,868 (GRCm39) missense possibly damaging 0.56
R1714:Syne2 UTSW 12 76,101,713 (GRCm39) missense probably benign 0.26
R1750:Syne2 UTSW 12 76,099,579 (GRCm39) missense probably damaging 1.00
R1772:Syne2 UTSW 12 75,985,503 (GRCm39) missense probably benign 0.19
R1797:Syne2 UTSW 12 76,010,557 (GRCm39) missense probably benign 0.00
R1830:Syne2 UTSW 12 76,156,636 (GRCm39) missense probably damaging 1.00
R1837:Syne2 UTSW 12 76,014,434 (GRCm39) missense probably damaging 0.99
R1908:Syne2 UTSW 12 76,141,053 (GRCm39) critical splice acceptor site probably null
R1913:Syne2 UTSW 12 75,946,020 (GRCm39) missense possibly damaging 0.60
R1944:Syne2 UTSW 12 76,121,318 (GRCm39) missense probably damaging 1.00
R1950:Syne2 UTSW 12 75,999,644 (GRCm39) missense probably benign
R1958:Syne2 UTSW 12 76,016,319 (GRCm39) missense probably benign 0.11
R2018:Syne2 UTSW 12 76,121,353 (GRCm39) missense probably damaging 1.00
R2037:Syne2 UTSW 12 76,072,343 (GRCm39) missense probably benign 0.04
R2067:Syne2 UTSW 12 75,935,116 (GRCm39) critical splice donor site probably null
R2073:Syne2 UTSW 12 76,062,353 (GRCm39) missense possibly damaging 0.54
R2099:Syne2 UTSW 12 76,026,747 (GRCm39) missense probably benign 0.06
R2102:Syne2 UTSW 12 76,074,853 (GRCm39) missense probably benign 0.01
R2134:Syne2 UTSW 12 75,999,560 (GRCm39) missense probably damaging 0.99
R2135:Syne2 UTSW 12 75,999,560 (GRCm39) missense probably damaging 0.99
R2157:Syne2 UTSW 12 76,141,230 (GRCm39) missense probably damaging 1.00
R2173:Syne2 UTSW 12 76,147,763 (GRCm39) splice site probably benign
R2248:Syne2 UTSW 12 76,143,678 (GRCm39) missense probably damaging 1.00
R2276:Syne2 UTSW 12 75,974,240 (GRCm39) missense possibly damaging 0.87
R2277:Syne2 UTSW 12 75,974,240 (GRCm39) missense possibly damaging 0.87
R2278:Syne2 UTSW 12 75,974,240 (GRCm39) missense possibly damaging 0.87
R2279:Syne2 UTSW 12 75,974,240 (GRCm39) missense possibly damaging 0.87
R2483:Syne2 UTSW 12 76,142,311 (GRCm39) missense probably damaging 1.00
R2877:Syne2 UTSW 12 76,047,605 (GRCm39) missense probably benign 0.00
R2884:Syne2 UTSW 12 76,010,533 (GRCm39) missense probably benign 0.00
R3119:Syne2 UTSW 12 75,956,058 (GRCm39) missense probably benign 0.01
R3499:Syne2 UTSW 12 76,101,752 (GRCm39) splice site probably null
R3827:Syne2 UTSW 12 76,033,805 (GRCm39) missense probably benign 0.02
R3847:Syne2 UTSW 12 76,095,396 (GRCm39) missense probably damaging 1.00
R3849:Syne2 UTSW 12 76,092,839 (GRCm39) nonsense probably null
R3850:Syne2 UTSW 12 76,095,396 (GRCm39) missense probably damaging 1.00
R3859:Syne2 UTSW 12 75,976,558 (GRCm39) missense possibly damaging 0.55
R3861:Syne2 UTSW 12 76,013,253 (GRCm39) missense probably damaging 0.98
R4078:Syne2 UTSW 12 76,082,398 (GRCm39) missense probably damaging 1.00
R4116:Syne2 UTSW 12 75,977,853 (GRCm39) missense probably damaging 1.00
R4326:Syne2 UTSW 12 75,999,516 (GRCm39) missense probably damaging 1.00
R4335:Syne2 UTSW 12 76,074,866 (GRCm39) missense probably damaging 1.00
R4410:Syne2 UTSW 12 76,141,167 (GRCm39) missense probably damaging 1.00
R4412:Syne2 UTSW 12 76,152,834 (GRCm39) missense probably benign 0.01
R4444:Syne2 UTSW 12 76,069,804 (GRCm39) missense probably damaging 1.00
R4595:Syne2 UTSW 12 76,013,845 (GRCm39) missense possibly damaging 0.88
R4604:Syne2 UTSW 12 76,014,484 (GRCm39) missense probably damaging 0.99
R4606:Syne2 UTSW 12 76,036,027 (GRCm39) missense probably damaging 1.00
R4651:Syne2 UTSW 12 76,036,013 (GRCm39) missense probably damaging 0.99
R4656:Syne2 UTSW 12 76,078,147 (GRCm39) missense probably damaging 1.00
R4675:Syne2 UTSW 12 75,996,075 (GRCm39) missense probably damaging 1.00
R4790:Syne2 UTSW 12 76,067,165 (GRCm39) missense probably benign 0.19
R4791:Syne2 UTSW 12 75,956,018 (GRCm39) missense possibly damaging 0.96
R4799:Syne2 UTSW 12 75,945,941 (GRCm39) missense probably benign 0.04
R4836:Syne2 UTSW 12 76,026,593 (GRCm39) missense probably damaging 1.00
R4880:Syne2 UTSW 12 76,026,593 (GRCm39) missense probably damaging 1.00
R4881:Syne2 UTSW 12 76,026,593 (GRCm39) missense probably damaging 1.00
R4899:Syne2 UTSW 12 75,900,875 (GRCm39) missense probably benign 0.03
R4934:Syne2 UTSW 12 75,946,046 (GRCm39) missense probably benign 0.14
R4981:Syne2 UTSW 12 75,987,993 (GRCm39) missense probably damaging 0.98
R4996:Syne2 UTSW 12 75,990,724 (GRCm39) missense possibly damaging 0.87
R5056:Syne2 UTSW 12 75,955,905 (GRCm39) unclassified probably benign
R5066:Syne2 UTSW 12 76,013,325 (GRCm39) missense probably benign 0.05
R5095:Syne2 UTSW 12 75,999,600 (GRCm39) missense probably damaging 0.99
R5151:Syne2 UTSW 12 76,090,484 (GRCm39) missense probably benign 0.06
R5193:Syne2 UTSW 12 76,141,194 (GRCm39) missense probably damaging 1.00
R5267:Syne2 UTSW 12 75,985,515 (GRCm39) missense possibly damaging 0.74
R5288:Syne2 UTSW 12 76,146,112 (GRCm39) missense possibly damaging 0.94
R5402:Syne2 UTSW 12 76,106,213 (GRCm39) missense probably damaging 0.98
R5434:Syne2 UTSW 12 76,018,649 (GRCm39) missense probably damaging 1.00
R5441:Syne2 UTSW 12 76,035,917 (GRCm39) missense possibly damaging 0.75
R5488:Syne2 UTSW 12 75,934,946 (GRCm39) missense probably benign 0.13
R5497:Syne2 UTSW 12 75,927,163 (GRCm39) missense probably benign 0.19
R5506:Syne2 UTSW 12 75,985,495 (GRCm39) missense probably benign 0.01
R5509:Syne2 UTSW 12 75,968,018 (GRCm39) missense probably damaging 1.00
R5518:Syne2 UTSW 12 75,991,944 (GRCm39) missense possibly damaging 0.88
R5561:Syne2 UTSW 12 76,141,232 (GRCm39) nonsense probably null
R5581:Syne2 UTSW 12 75,991,859 (GRCm39) missense probably benign 0.01
R5625:Syne2 UTSW 12 76,141,886 (GRCm39) missense probably benign 0.06
R5642:Syne2 UTSW 12 75,965,306 (GRCm39) missense probably damaging 1.00
R5665:Syne2 UTSW 12 76,154,991 (GRCm39) critical splice donor site probably null
R5666:Syne2 UTSW 12 75,997,733 (GRCm39) missense probably benign 0.16
R5670:Syne2 UTSW 12 75,997,733 (GRCm39) missense probably benign 0.16
R5691:Syne2 UTSW 12 76,074,630 (GRCm39) frame shift probably null
R5696:Syne2 UTSW 12 76,040,919 (GRCm39) missense probably benign 0.00
R5720:Syne2 UTSW 12 76,014,441 (GRCm39) missense probably benign 0.03
R5739:Syne2 UTSW 12 76,044,239 (GRCm39) missense possibly damaging 0.53
R5840:Syne2 UTSW 12 75,927,065 (GRCm39) splice site probably null
R5846:Syne2 UTSW 12 76,074,898 (GRCm39) missense probably benign 0.01
R5850:Syne2 UTSW 12 76,144,749 (GRCm39) missense probably damaging 1.00
R5889:Syne2 UTSW 12 76,119,026 (GRCm39) nonsense probably null
R5912:Syne2 UTSW 12 75,955,721 (GRCm39) critical splice donor site probably null
R5931:Syne2 UTSW 12 76,055,639 (GRCm39) missense probably benign 0.37
R5985:Syne2 UTSW 12 76,012,933 (GRCm39) missense probably damaging 0.96
R5988:Syne2 UTSW 12 75,976,191 (GRCm39) critical splice donor site probably null
R5990:Syne2 UTSW 12 76,070,918 (GRCm39) missense probably benign 0.10
R6038:Syne2 UTSW 12 75,925,158 (GRCm39) nonsense probably null
R6038:Syne2 UTSW 12 75,925,158 (GRCm39) nonsense probably null
R6132:Syne2 UTSW 12 75,991,921 (GRCm39) missense probably benign 0.14
R6136:Syne2 UTSW 12 75,952,099 (GRCm39) missense probably benign 0.24
R6229:Syne2 UTSW 12 75,967,994 (GRCm39) missense probably benign 0.00
R6252:Syne2 UTSW 12 76,016,210 (GRCm39) missense probably benign 0.39
R6271:Syne2 UTSW 12 75,937,155 (GRCm39) missense probably damaging 1.00
R6320:Syne2 UTSW 12 76,108,424 (GRCm39) missense probably damaging 0.96
R6339:Syne2 UTSW 12 76,035,927 (GRCm39) missense probably benign 0.34
R6380:Syne2 UTSW 12 76,151,754 (GRCm39) missense probably damaging 0.98
R6394:Syne2 UTSW 12 76,037,269 (GRCm39) missense probably benign 0.09
R6419:Syne2 UTSW 12 76,143,740 (GRCm39) missense probably damaging 1.00
R6426:Syne2 UTSW 12 75,969,857 (GRCm39) missense probably null 0.97
R6434:Syne2 UTSW 12 76,088,230 (GRCm39) missense probably damaging 0.99
R6437:Syne2 UTSW 12 76,037,188 (GRCm39) missense possibly damaging 0.87
R6466:Syne2 UTSW 12 75,990,675 (GRCm39) missense probably damaging 0.97
R6501:Syne2 UTSW 12 76,074,621 (GRCm39) splice site probably null
R6552:Syne2 UTSW 12 75,937,015 (GRCm39) missense possibly damaging 0.89
R6744:Syne2 UTSW 12 76,121,221 (GRCm39) missense probably damaging 1.00
R6810:Syne2 UTSW 12 75,989,659 (GRCm39) missense probably benign 0.00
R6831:Syne2 UTSW 12 76,013,568 (GRCm39) missense probably benign 0.39
R6861:Syne2 UTSW 12 75,956,040 (GRCm39) missense probably damaging 1.00
R6875:Syne2 UTSW 12 76,082,404 (GRCm39) missense probably damaging 0.99
R6892:Syne2 UTSW 12 76,009,302 (GRCm39) missense probably damaging 0.98
R6899:Syne2 UTSW 12 76,142,503 (GRCm39) splice site probably null
R6906:Syne2 UTSW 12 76,042,760 (GRCm39) missense possibly damaging 0.93
R6909:Syne2 UTSW 12 76,110,969 (GRCm39) missense probably benign 0.04
R6925:Syne2 UTSW 12 75,900,906 (GRCm39) missense possibly damaging 0.58
R6949:Syne2 UTSW 12 76,012,771 (GRCm39) missense probably benign 0.00
R6952:Syne2 UTSW 12 75,974,205 (GRCm39) missense possibly damaging 0.76
R6996:Syne2 UTSW 12 76,074,786 (GRCm39) missense probably damaging 0.99
R7080:Syne2 UTSW 12 76,099,501 (GRCm39) missense probably benign 0.00
R7083:Syne2 UTSW 12 75,990,662 (GRCm39) missense probably damaging 1.00
R7090:Syne2 UTSW 12 75,989,125 (GRCm39) missense probably benign
R7144:Syne2 UTSW 12 76,052,152 (GRCm39) missense probably benign 0.03
R7154:Syne2 UTSW 12 76,106,231 (GRCm39) missense possibly damaging 0.63
R7177:Syne2 UTSW 12 76,018,654 (GRCm39) nonsense probably null
R7190:Syne2 UTSW 12 76,113,361 (GRCm39) missense probably benign 0.01
R7206:Syne2 UTSW 12 76,051,531 (GRCm39) missense probably benign 0.02
R7208:Syne2 UTSW 12 76,078,172 (GRCm39) splice site probably null
R7230:Syne2 UTSW 12 75,980,674 (GRCm39) missense probably benign 0.12
R7260:Syne2 UTSW 12 75,991,853 (GRCm39) missense probably damaging 1.00
R7272:Syne2 UTSW 12 76,095,417 (GRCm39) missense probably benign 0.00
R7296:Syne2 UTSW 12 76,149,810 (GRCm39) missense probably benign 0.00
R7322:Syne2 UTSW 12 76,030,798 (GRCm39) missense probably damaging 1.00
R7329:Syne2 UTSW 12 76,013,758 (GRCm39) missense probably benign 0.01
R7332:Syne2 UTSW 12 76,014,529 (GRCm39) critical splice donor site probably null
R7381:Syne2 UTSW 12 75,973,263 (GRCm39) missense probably benign 0.11
R7401:Syne2 UTSW 12 76,014,155 (GRCm39) missense probably damaging 0.98
R7403:Syne2 UTSW 12 75,962,020 (GRCm39) missense not run
R7429:Syne2 UTSW 12 76,087,184 (GRCm39) nonsense probably null
R7429:Syne2 UTSW 12 75,980,770 (GRCm39) missense probably damaging 1.00
R7430:Syne2 UTSW 12 76,087,184 (GRCm39) nonsense probably null
R7430:Syne2 UTSW 12 75,980,770 (GRCm39) missense probably damaging 1.00
R7438:Syne2 UTSW 12 76,062,337 (GRCm39) missense probably benign 0.04
R7447:Syne2 UTSW 12 76,074,853 (GRCm39) missense probably benign 0.01
R7466:Syne2 UTSW 12 76,092,960 (GRCm39) missense possibly damaging 0.92
R7493:Syne2 UTSW 12 76,012,654 (GRCm39) missense probably benign 0.00
R7502:Syne2 UTSW 12 76,141,100 (GRCm39) missense probably damaging 1.00
R7543:Syne2 UTSW 12 75,953,616 (GRCm39) missense possibly damaging 0.93
R7569:Syne2 UTSW 12 75,974,164 (GRCm39) missense probably benign 0.00
R7599:Syne2 UTSW 12 76,013,145 (GRCm39) missense probably benign 0.04
R7618:Syne2 UTSW 12 75,992,108 (GRCm39) missense probably benign 0.01
R7639:Syne2 UTSW 12 75,981,273 (GRCm39) missense probably damaging 1.00
R7698:Syne2 UTSW 12 75,995,838 (GRCm39) missense probably damaging 0.99
R7702:Syne2 UTSW 12 76,037,161 (GRCm39) missense probably benign 0.16
R7737:Syne2 UTSW 12 75,989,622 (GRCm39) missense probably damaging 1.00
R7742:Syne2 UTSW 12 76,106,209 (GRCm39) missense probably benign 0.02
R7753:Syne2 UTSW 12 76,085,697 (GRCm39) missense probably benign 0.43
R7755:Syne2 UTSW 12 76,044,181 (GRCm39) missense probably benign 0.19
R7757:Syne2 UTSW 12 76,108,553 (GRCm39) missense possibly damaging 0.87
R7790:Syne2 UTSW 12 75,975,877 (GRCm39) splice site probably null
R7808:Syne2 UTSW 12 76,030,501 (GRCm39) splice site probably null
R7809:Syne2 UTSW 12 76,014,230 (GRCm39) missense probably benign 0.00
R7811:Syne2 UTSW 12 76,030,501 (GRCm39) splice site probably null
R7834:Syne2 UTSW 12 76,014,021 (GRCm39) missense probably benign 0.00
R7853:Syne2 UTSW 12 76,078,278 (GRCm39) missense probably damaging 1.00
R7867:Syne2 UTSW 12 76,030,501 (GRCm39) splice site probably null
R7896:Syne2 UTSW 12 76,082,397 (GRCm39) missense probably damaging 0.99
R7903:Syne2 UTSW 12 76,110,958 (GRCm39) missense probably damaging 1.00
R7944:Syne2 UTSW 12 75,951,079 (GRCm39) missense probably damaging 0.98
R7945:Syne2 UTSW 12 75,951,079 (GRCm39) missense probably damaging 0.98
R7963:Syne2 UTSW 12 76,067,174 (GRCm39) missense probably benign 0.38
R7996:Syne2 UTSW 12 76,051,441 (GRCm39) missense probably damaging 1.00
R7998:Syne2 UTSW 12 76,134,632 (GRCm39) missense probably damaging 1.00
R8010:Syne2 UTSW 12 75,977,512 (GRCm39) missense probably benign 0.39
R8016:Syne2 UTSW 12 75,989,681 (GRCm39) missense probably benign 0.19
R8140:Syne2 UTSW 12 75,959,127 (GRCm39) missense possibly damaging 0.63
R8141:Syne2 UTSW 12 76,108,442 (GRCm39) missense possibly damaging 0.66
R8206:Syne2 UTSW 12 76,062,365 (GRCm39) missense probably benign 0.03
R8258:Syne2 UTSW 12 75,996,143 (GRCm39) missense possibly damaging 0.95
R8259:Syne2 UTSW 12 75,996,143 (GRCm39) missense possibly damaging 0.95
R8320:Syne2 UTSW 12 76,150,604 (GRCm39) missense probably damaging 0.99
R8464:Syne2 UTSW 12 76,012,546 (GRCm39) missense probably benign 0.39
R8465:Syne2 UTSW 12 75,900,898 (GRCm39) missense possibly damaging 0.92
R8486:Syne2 UTSW 12 76,088,881 (GRCm39) nonsense probably null
R8488:Syne2 UTSW 12 76,012,546 (GRCm39) missense probably benign 0.39
R8511:Syne2 UTSW 12 76,055,647 (GRCm39) missense probably benign 0.03
R8540:Syne2 UTSW 12 76,141,148 (GRCm39) missense probably damaging 1.00
R8711:Syne2 UTSW 12 76,104,258 (GRCm39) missense probably damaging 1.00
R8722:Syne2 UTSW 12 75,972,095 (GRCm39) missense probably benign 0.04
R8827:Syne2 UTSW 12 76,095,357 (GRCm39) missense probably benign 0.00
R8867:Syne2 UTSW 12 75,989,620 (GRCm39) missense probably damaging 1.00
R8878:Syne2 UTSW 12 75,952,067 (GRCm39) missense probably benign
R8924:Syne2 UTSW 12 75,943,444 (GRCm39) missense probably damaging 0.97
R8966:Syne2 UTSW 12 76,146,197 (GRCm39) missense probably damaging 1.00
R9007:Syne2 UTSW 12 76,146,224 (GRCm39) missense possibly damaging 0.82
R9019:Syne2 UTSW 12 75,999,618 (GRCm39) missense possibly damaging 0.93
R9057:Syne2 UTSW 12 75,937,167 (GRCm39) missense probably damaging 1.00
R9067:Syne2 UTSW 12 75,950,994 (GRCm39) missense probably damaging 1.00
R9081:Syne2 UTSW 12 76,016,290 (GRCm39) nonsense probably null
R9123:Syne2 UTSW 12 76,040,838 (GRCm39) missense probably damaging 1.00
R9147:Syne2 UTSW 12 75,937,158 (GRCm39) missense probably damaging 1.00
R9148:Syne2 UTSW 12 75,937,158 (GRCm39) missense probably damaging 1.00
R9163:Syne2 UTSW 12 76,009,349 (GRCm39) missense possibly damaging 0.88
R9192:Syne2 UTSW 12 76,156,703 (GRCm39) missense probably damaging 1.00
R9248:Syne2 UTSW 12 76,154,230 (GRCm39) intron probably benign
R9270:Syne2 UTSW 12 75,977,834 (GRCm39) missense probably damaging 1.00
R9292:Syne2 UTSW 12 75,997,823 (GRCm39) missense probably benign
R9397:Syne2 UTSW 12 76,040,849 (GRCm39) missense possibly damaging 0.59
R9454:Syne2 UTSW 12 76,141,844 (GRCm39) nonsense probably null
R9454:Syne2 UTSW 12 76,067,275 (GRCm39) missense probably damaging 0.99
R9478:Syne2 UTSW 12 76,154,387 (GRCm39) missense probably damaging 0.96
R9492:Syne2 UTSW 12 75,995,839 (GRCm39) missense possibly damaging 0.77
R9573:Syne2 UTSW 12 75,927,134 (GRCm39) missense probably damaging 1.00
R9611:Syne2 UTSW 12 76,080,460 (GRCm39) missense probably benign 0.05
R9623:Syne2 UTSW 12 75,986,760 (GRCm39) missense probably benign 0.12
R9647:Syne2 UTSW 12 76,151,875 (GRCm39) missense possibly damaging 0.55
R9652:Syne2 UTSW 12 76,101,620 (GRCm39) missense probably benign 0.00
R9667:Syne2 UTSW 12 75,926,951 (GRCm39) missense probably damaging 1.00
R9701:Syne2 UTSW 12 76,037,197 (GRCm39) missense probably damaging 1.00
R9794:Syne2 UTSW 12 76,047,617 (GRCm39) missense probably benign 0.04
R9802:Syne2 UTSW 12 76,037,197 (GRCm39) missense probably damaging 1.00
X0019:Syne2 UTSW 12 76,020,061 (GRCm39) missense probably benign 0.41
X0026:Syne2 UTSW 12 76,147,790 (GRCm39) missense possibly damaging 0.78
X0061:Syne2 UTSW 12 75,974,285 (GRCm39) critical splice donor site probably null
X0066:Syne2 UTSW 12 76,143,701 (GRCm39) missense probably damaging 1.00
Z1176:Syne2 UTSW 12 76,087,157 (GRCm39) missense possibly damaging 0.48
Z1176:Syne2 UTSW 12 76,014,315 (GRCm39) missense probably benign 0.01
Z1177:Syne2 UTSW 12 76,020,197 (GRCm39) missense probably damaging 1.00
Z1177:Syne2 UTSW 12 76,144,748 (GRCm39) missense probably damaging 1.00
Z1177:Syne2 UTSW 12 76,110,912 (GRCm39) missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- CTCCTGATGAAAGAGAAGGCC -3'
(R):5'- TGTTGGAAGGCATGCTGAAC -3'

Sequencing Primer
(F):5'- CTTTGGATGAACGCCTGAGGAC -3'
(R):5'- GCATGCTGAACAGGAATAGTTAG -3'
Posted On 2021-12-30