Incidental Mutation 'R9091:Cyp17a1'
ID 691044
Institutional Source Beutler Lab
Gene Symbol Cyp17a1
Ensembl Gene ENSMUSG00000003555
Gene Name cytochrome P450, family 17, subfamily a, polypeptide 1
Synonyms steroid 17-alpha hydroxylase, p450c17, Cyp17
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.200) question?
Stock # R9091 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 46667165-46672974 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 46667591 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 420 (T420A)
Ref Sequence ENSEMBL: ENSMUSP00000026012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026012]
AlphaFold P27786
Predicted Effect probably benign
Transcript: ENSMUST00000026012
AA Change: T420A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000026012
Gene: ENSMUSG00000003555
AA Change: T420A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:p450 28 492 2.6e-140 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum. It has both 17alpha-hydroxylase and 17,20-lyase activities and is a key enzyme in the steroidogenic pathway that produces progestins, mineralocorticoids, glucocorticoids, androgens, and estrogens. Mutations in this gene are associated with isolated steroid-17 alpha-hydroxylase deficiency, 17-alpha-hydroxylase/17,20-lyase deficiency, pseudohermaphroditism, and adrenal hyperplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos display early embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A C 17: 33,067,727 C34G probably damaging Het
Actrt3 T A 3: 30,598,632 E104D probably damaging Het
Arih2 A T 9: 108,616,691 D174E probably damaging Het
Armc4 T A 18: 7,217,846 K623* probably null Het
Asprv1 T C 6: 86,629,095 F308L probably damaging Het
Baiap2l2 A G 15: 79,284,005 probably null Het
Btla T C 16: 45,244,293 F203L possibly damaging Het
C1rb A T 6: 124,574,988 D283V probably damaging Het
C87436 C G 6: 86,465,831 Q462E probably benign Het
Ccdc149 T C 5: 52,406,010 D147G possibly damaging Het
Chd6 A T 2: 161,029,873 L214* probably null Het
Chrna4 C A 2: 181,028,850 R371L possibly damaging Het
Cit C A 5: 115,846,102 probably benign Het
Cpne5 A G 17: 29,225,189 probably null Het
Cr1l T C 1: 195,106,896 E400G possibly damaging Het
Creb3l2 T C 6: 37,355,648 N304D probably damaging Het
Cyp24a1 A G 2: 170,485,933 I463T probably damaging Het
Cyp3a41b A T 5: 145,578,163 I84N probably damaging Het
Dnajc6 G A 4: 101,639,362 V909M possibly damaging Het
Dtl A G 1: 191,556,811 Y264H probably damaging Het
Dysf C T 6: 84,100,234 R660* probably null Het
Egf A G 3: 129,735,800 probably null Het
Eva1c T C 16: 90,904,343 S402P probably benign Het
Fcho2 A T 13: 98,789,361 probably null Het
Fhdc1 G A 3: 84,444,983 R197C unknown Het
Foxa2 T A 2: 148,044,506 M136L probably benign Het
Gm10226 T C 17: 21,691,959 C34R possibly damaging Het
Gm29735 ACAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAACAGCAGGATTCGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAAGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCA ACAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAACAGCAGGATTCGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAAGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCA 7: 142,156,529 probably benign Het
Gm8947 T C 1: 151,193,102 S229P probably benign Het
Ighv9-2 A T 12: 114,109,276 S26T probably damaging Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kat6a T G 8: 22,930,174 I745M probably damaging Het
Klhdc1 T C 12: 69,263,194 L290P probably damaging Het
Lcp2 C T 11: 34,089,688 T496I Het
Map4k4 T C 1: 40,003,763 W593R probably benign Het
Mefv T G 16: 3,717,977 Q29P probably damaging Het
Mgat5b T C 11: 116,968,443 Y34H Het
Mlip C T 9: 77,229,798 R609Q probably benign Het
Muc2 A G 7: 141,704,267 D34G Het
Nbeal1 C T 1: 60,268,389 P1687S possibly damaging Het
Notch1 T A 2: 26,479,883 I477L probably damaging Het
Olfr1239 A T 2: 89,418,368 L15Q probably damaging Het
Olfr1496 T C 19: 13,780,969 V117A probably benign Het
Olfr364-ps1 G A 2: 37,147,035 M274I probably benign Het
Olfr624 T A 7: 103,670,917 N38I probably damaging Het
Olfr807 A G 10: 129,755,279 M57T probably damaging Het
Pak7 A T 2: 136,116,768 S133R probably damaging Het
Pcyt1a C A 16: 32,466,514 D187E probably benign Het
Pdlim7 G T 13: 55,507,541 T161K probably damaging Het
Pik3r4 A G 9: 105,669,909 K962R probably benign Het
Pkd1l2 T C 8: 117,032,694 K1516E probably damaging Het
Plk5 C G 10: 80,357,996 R40G probably damaging Het
Ptchd3 A T 11: 121,842,354 Y690F probably benign Het
Ptpn13 A T 5: 103,501,869 R379S possibly damaging Het
Rbm27 C T 18: 42,305,764 A410V probably benign Het
Rnase4 A G 14: 51,105,205 T129A probably benign Het
Serpinb11 C T 1: 107,376,803 T166I probably benign Het
Shank2 A G 7: 144,409,968 T438A possibly damaging Het
Slc13a2 T C 11: 78,404,432 N172D probably damaging Het
Slc2a8 A G 2: 32,974,852 F428L probably damaging Het
Slc38a6 T C 12: 73,351,770 M358T probably benign Het
Snx29 A G 16: 11,395,291 H107R probably benign Het
Sorbs2 T G 8: 45,795,737 V675G probably benign Het
Spint3 G A 2: 164,573,234 A21V probably benign Het
Susd1 A T 4: 59,412,226 V162E probably benign Het
Syne2 T G 12: 75,931,060 N1426K probably damaging Het
Synj2 T C 17: 6,017,600 V638A possibly damaging Het
Thada A T 17: 84,231,161 L1473Q probably damaging Het
Trim36 G A 18: 46,167,513 S697L possibly damaging Het
Ttbk1 A T 17: 46,470,591 I412N possibly damaging Het
Tubb2a T C 13: 34,074,595 D404G probably damaging Het
Tyk2 T A 9: 21,124,545 N114Y probably damaging Het
Umodl1 A G 17: 30,966,704 D139G probably damaging Het
Vmn2r101 T A 17: 19,589,982 N343K probably benign Het
Vnn1 A G 10: 23,904,566 D484G probably damaging Het
Vps13b A G 15: 35,770,773 T2121A probably benign Het
Wdr81 T C 11: 75,454,390 E17G probably benign Het
Wnk2 T G 13: 49,071,029 K1117Q probably benign Het
Zbtb46 C T 2: 181,424,345 R4Q probably benign Het
Zfp608 T A 18: 54,899,118 K583N probably damaging Het
Zfp729b A T 13: 67,592,361 L595H probably damaging Het
Other mutations in Cyp17a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01524:Cyp17a1 APN 19 46671056 missense probably benign 0.00
IGL01839:Cyp17a1 APN 19 46670671 missense possibly damaging 0.89
IGL01901:Cyp17a1 APN 19 46671092 missense possibly damaging 0.64
IGL02033:Cyp17a1 APN 19 46672607 nonsense probably null
IGL02349:Cyp17a1 APN 19 46667497 missense probably damaging 1.00
IGL02663:Cyp17a1 APN 19 46672566 missense probably damaging 1.00
IGL02883:Cyp17a1 APN 19 46669351 missense probably benign 0.00
IGL03092:Cyp17a1 APN 19 46672611 missense possibly damaging 0.79
IGL03239:Cyp17a1 APN 19 46667357 missense probably damaging 1.00
IGL03336:Cyp17a1 APN 19 46671035 missense probably benign 0.00
R3773:Cyp17a1 UTSW 19 46669723 missense probably damaging 0.97
R4445:Cyp17a1 UTSW 19 46668023 missense probably damaging 1.00
R4446:Cyp17a1 UTSW 19 46668023 missense probably damaging 1.00
R4572:Cyp17a1 UTSW 19 46670551 missense probably damaging 1.00
R5544:Cyp17a1 UTSW 19 46672654 missense probably damaging 1.00
R5730:Cyp17a1 UTSW 19 46672656 missense possibly damaging 0.49
R6163:Cyp17a1 UTSW 19 46669322 missense possibly damaging 0.69
R6271:Cyp17a1 UTSW 19 46672720 missense probably benign 0.17
R6728:Cyp17a1 UTSW 19 46669234 missense probably benign
R6729:Cyp17a1 UTSW 19 46670581 missense probably benign
R7025:Cyp17a1 UTSW 19 46670980 missense probably damaging 0.98
R7395:Cyp17a1 UTSW 19 46670695 missense probably benign
R8056:Cyp17a1 UTSW 19 46670591 missense possibly damaging 0.95
R8308:Cyp17a1 UTSW 19 46668077 missense probably benign 0.09
R8735:Cyp17a1 UTSW 19 46671094 critical splice acceptor site probably null
R8737:Cyp17a1 UTSW 19 46669727 missense probably benign 0.09
R9270:Cyp17a1 UTSW 19 46667591 missense probably benign 0.00
R9364:Cyp17a1 UTSW 19 46668726 missense probably damaging 1.00
X0020:Cyp17a1 UTSW 19 46671020 missense possibly damaging 0.88
Z1177:Cyp17a1 UTSW 19 46672659 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GATCAGAAAGACCACCTTGGGG -3'
(R):5'- ATGTAGGCATCTGTCTCCCAAG -3'

Sequencing Primer
(F):5'- ACCACCTTGGGGTCACC -3'
(R):5'- ATCTGTCTCCCAAGAGGCCTG -3'
Posted On 2021-12-30