Incidental Mutation 'R9092:Pikfyve'
ID 691046
Institutional Source Beutler Lab
Gene Symbol Pikfyve
Ensembl Gene ENSMUSG00000025949
Gene Name phosphoinositide kinase, FYVE type zinc finger containing
Synonyms PipkIII, Pip5k3, 5230400C17Rik
MMRRC Submission 068908-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9092 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 65225842-65317854 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 65283559 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Lysine at position 732 (R732K)
Ref Sequence ENSEMBL: ENSMUSP00000095314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081154] [ENSMUST00000097707] [ENSMUST00000190058]
AlphaFold Q9Z1T6
Predicted Effect possibly damaging
Transcript: ENSMUST00000081154
AA Change: R687K

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000079926
Gene: ENSMUSG00000025949
AA Change: R687K

DomainStartEndE-ValueType
low complexity region 58 81 N/A INTRINSIC
FYVE 161 230 5.95e-18 SMART
DEP 376 451 9.05e-27 SMART
Pfam:Cpn60_TCP1 547 822 2e-37 PFAM
low complexity region 1177 1189 N/A INTRINSIC
low complexity region 1516 1536 N/A INTRINSIC
PIPKc 1745 2039 3.03e-162 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000097707
AA Change: R732K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095314
Gene: ENSMUSG00000025949
AA Change: R732K

DomainStartEndE-ValueType
low complexity region 58 81 N/A INTRINSIC
FYVE 150 219 5.95e-18 SMART
DEP 365 440 9.05e-27 SMART
Pfam:Cpn60_TCP1 590 864 1.8e-35 PFAM
low complexity region 1222 1234 N/A INTRINSIC
low complexity region 1561 1581 N/A INTRINSIC
PIPKc 1790 2084 3.03e-162 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190058
SMART Domains Protein: ENSMUSP00000140204
Gene: ENSMUSG00000025949

DomainStartEndE-ValueType
low complexity region 58 81 N/A INTRINSIC
Meta Mutation Damage Score 0.2532 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 93% (56/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylated derivatives of phosphatidylinositol (PtdIns) regulate cytoskeletal functions, membrane trafficking, and receptor signaling by recruiting protein complexes to cell- and endosomal-membranes. Humans have multiple PtdIns proteins that differ by the degree and position of phosphorylation of the inositol ring. This gene encodes an enzyme (PIKfyve; also known as phosphatidylinositol-3-phosphate 5-kinase type III or PIPKIII) that phosphorylates the D-5 position in PtdIns and phosphatidylinositol-3-phosphate (PtdIns3P) to make PtdIns5P and PtdIns(3,5)biphosphate. The D-5 position also can be phosphorylated by type I PtdIns4P-5-kinases (PIP5Ks) that are encoded by distinct genes and preferentially phosphorylate D-4 phosphorylated PtdIns. In contrast, PIKfyve preferentially phosphorylates D-3 phosphorylated PtdIns. In addition to being a lipid kinase, PIKfyve also has protein kinase activity. PIKfyve regulates endomembrane homeostasis and plays a role in the biogenesis of endosome carrier vesicles from early endosomes. Mutations in this gene cause corneal fleck dystrophy (CFD); an autosomal dominant disorder characterized by numerous small white flecks present in all layers of the corneal stroma. Histologically, these flecks appear to be keratocytes distended with lipid and mucopolysaccharide filled intracytoplasmic vacuoles. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele die prior to implantation with reduced numbers of inner cell mass and trophectoderm cells and blastocoele abnormalities. Mice homozygous for a second null allele show embryonic lethality between somite formation and embryo turning with abnormal visceral endoderm. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Gene trapped(16)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Chl1 T C 6: 103,645,815 (GRCm39) probably benign Het
Crtc3 T C 7: 80,239,628 (GRCm39) M575V probably benign Het
Cux1 T A 5: 136,514,671 (GRCm39) N22I probably damaging Het
Dcun1d2 G A 8: 13,307,935 (GRCm39) R248W probably damaging Het
Dlc1 G T 8: 37,199,860 (GRCm39) H7Q probably benign Het
Drd2 A G 9: 49,307,004 (GRCm39) D30G probably benign Het
Duxf3 GCCC GCC 10: 58,066,944 (GRCm39) probably null Het
E2f7 T C 10: 110,616,874 (GRCm39) S705P probably benign Het
Ephb3 G A 16: 21,041,214 (GRCm39) S977N probably benign Het
F13a1 T G 13: 37,089,993 (GRCm39) D448A probably benign Het
Fam216b T C 14: 78,322,537 (GRCm39) T56A possibly damaging Het
Fcho2 T C 13: 98,886,391 (GRCm39) T408A probably benign Het
Flvcr1 A T 1: 190,740,364 (GRCm39) V552E Het
Gab3 CTT CTTGTT X: 74,043,612 (GRCm39) probably benign Het
Gab3 TCT TCTGCT X: 74,043,602 (GRCm39) probably benign Het
Galnt15 A G 14: 31,780,196 (GRCm39) K622E probably benign Het
Gjb3 GCCAGATGCGCCCA GCCAGATGCGCCCAGATGCGCCCA 4: 127,220,458 (GRCm39) probably null Het
Gjb3 A AGATGCGCCCG 4: 127,220,471 (GRCm39) probably null Het
Gm5414 T G 15: 101,536,345 (GRCm39) R93S probably benign Het
Gtf2i A G 5: 134,318,241 (GRCm39) *87Q probably null Het
Il7r T A 15: 9,510,270 (GRCm39) H261L probably benign Het
Itsn1 T A 16: 91,609,002 (GRCm39) M250K possibly damaging Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,079,903 (GRCm39) probably benign Het
Liat1 A G 11: 75,893,887 (GRCm39) D88G possibly damaging Het
Lrrc47 C A 4: 154,096,421 (GRCm39) T72K possibly damaging Het
Map2k4 C A 11: 65,581,599 (GRCm39) R371L probably benign Het
Mmrn2 T C 14: 34,118,587 (GRCm39) F158L probably benign Het
Mtus1 A T 8: 41,455,475 (GRCm39) L242Q probably damaging Het
Myo5a T C 9: 75,054,414 (GRCm39) probably null Het
Noc3l T A 19: 38,798,487 (GRCm39) K305I probably damaging Het
Or4p8 T C 2: 88,727,321 (GRCm39) T207A probably damaging Het
Pag1 T C 3: 9,764,848 (GRCm39) T102A probably benign Het
Pam A G 1: 97,791,976 (GRCm39) S482P probably benign Het
Pax1 T G 2: 147,204,287 (GRCm39) W23G unknown Het
Pcdhgb1 T A 18: 37,813,989 (GRCm39) V160D possibly damaging Het
Pdzph1 T C 17: 59,280,125 (GRCm39) D719G probably damaging Het
Phlda1 T C 10: 111,342,474 (GRCm39) L70S possibly damaging Het
Pkd1 G T 17: 24,788,347 (GRCm39) V702F possibly damaging Het
Pkhd1 A G 1: 20,632,586 (GRCm39) Y610H probably benign Het
Pofut1 T G 2: 153,101,508 (GRCm39) H87Q probably benign Het
Runx2 C A 17: 45,046,443 (GRCm39) D109Y probably damaging Het
Serpina1b T A 12: 103,696,540 (GRCm39) I290F probably benign Het
Sez6 G A 11: 77,865,121 (GRCm39) E623K possibly damaging Het
Sh3tc1 T C 5: 35,874,321 (GRCm39) N198S probably benign Het
Slc27a6 C A 18: 58,742,330 (GRCm39) R515S probably benign Het
Sorbs3 C T 14: 70,445,004 (GRCm39) V25I probably benign Het
Speg A G 1: 75,399,378 (GRCm39) E2275G probably benign Het
Tmem161b C T 13: 84,440,503 (GRCm39) T307I possibly damaging Het
Tmem30a T C 9: 79,678,581 (GRCm39) D361G probably damaging Het
Tmprss11c T C 5: 86,385,495 (GRCm39) T326A probably benign Het
Tpbg T C 9: 85,726,916 (GRCm39) V295A possibly damaging Het
Ulk4 A T 9: 120,903,003 (GRCm39) I1158N Het
Utp20 C A 10: 88,604,679 (GRCm39) A1739S probably benign Het
Utp20 T C 10: 88,611,180 (GRCm39) N1379S probably damaging Het
Vmn1r66 T A 7: 10,008,110 (GRCm39) I308F possibly damaging Het
Vmn2r101 A T 17: 19,809,807 (GRCm39) T198S probably benign Het
Vps16 T C 2: 130,281,593 (GRCm39) I318T probably damaging Het
Wdr11 T A 7: 129,226,451 (GRCm39) W750R probably damaging Het
Zfp608 A G 18: 55,031,648 (GRCm39) I764T probably benign Het
Zfp708 C A 13: 67,218,564 (GRCm39) D420Y probably damaging Het
Other mutations in Pikfyve
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Pikfyve APN 1 65,299,280 (GRCm39) critical splice donor site probably null
IGL01135:Pikfyve APN 1 65,290,794 (GRCm39) missense probably damaging 0.96
IGL01511:Pikfyve APN 1 65,298,028 (GRCm39) nonsense probably null
IGL01759:Pikfyve APN 1 65,292,512 (GRCm39) missense probably benign 0.06
IGL01888:Pikfyve APN 1 65,262,799 (GRCm39) missense probably damaging 1.00
IGL01967:Pikfyve APN 1 65,303,524 (GRCm39) missense possibly damaging 0.89
IGL02055:Pikfyve APN 1 65,277,703 (GRCm39) critical splice donor site probably null
IGL02119:Pikfyve APN 1 65,311,730 (GRCm39) missense probably damaging 1.00
IGL02141:Pikfyve APN 1 65,285,556 (GRCm39) missense probably benign 0.13
IGL02207:Pikfyve APN 1 65,290,837 (GRCm39) critical splice donor site probably null
IGL02380:Pikfyve APN 1 65,295,180 (GRCm39) missense probably damaging 0.99
IGL02400:Pikfyve APN 1 65,291,728 (GRCm39) missense probably damaging 1.00
IGL02403:Pikfyve APN 1 65,283,663 (GRCm39) missense probably damaging 0.99
IGL02426:Pikfyve APN 1 65,290,771 (GRCm39) missense possibly damaging 0.77
IGL02496:Pikfyve APN 1 65,303,535 (GRCm39) missense possibly damaging 0.94
IGL02573:Pikfyve APN 1 65,270,014 (GRCm39) critical splice donor site probably null
IGL02746:Pikfyve APN 1 65,273,431 (GRCm39) missense probably damaging 1.00
IGL02814:Pikfyve APN 1 65,289,353 (GRCm39) nonsense probably null
IGL02890:Pikfyve APN 1 65,269,956 (GRCm39) missense probably benign 0.00
IGL03102:Pikfyve APN 1 65,291,626 (GRCm39) nonsense probably null
IGL03294:Pikfyve APN 1 65,286,226 (GRCm39) missense probably damaging 1.00
falcon UTSW 1 65,235,900 (GRCm39) missense probably damaging 1.00
oompa UTSW 1 65,235,865 (GRCm39) missense probably damaging 1.00
wonka UTSW 1 65,235,865 (GRCm39) missense probably damaging 1.00
G5538:Pikfyve UTSW 1 65,242,075 (GRCm39) missense probably damaging 1.00
R0031:Pikfyve UTSW 1 65,255,088 (GRCm39) splice site probably benign
R0196:Pikfyve UTSW 1 65,295,231 (GRCm39) missense possibly damaging 0.92
R0212:Pikfyve UTSW 1 65,302,064 (GRCm39) missense probably benign 0.41
R0319:Pikfyve UTSW 1 65,285,490 (GRCm39) missense probably benign 0.01
R0332:Pikfyve UTSW 1 65,303,558 (GRCm39) missense probably benign 0.02
R0389:Pikfyve UTSW 1 65,235,865 (GRCm39) missense probably damaging 1.00
R0443:Pikfyve UTSW 1 65,235,865 (GRCm39) missense probably damaging 1.00
R0503:Pikfyve UTSW 1 65,259,058 (GRCm39) missense probably damaging 0.97
R0722:Pikfyve UTSW 1 65,292,682 (GRCm39) missense probably damaging 0.99
R0906:Pikfyve UTSW 1 65,292,556 (GRCm39) missense probably damaging 1.00
R0907:Pikfyve UTSW 1 65,241,989 (GRCm39) missense possibly damaging 0.64
R0970:Pikfyve UTSW 1 65,304,983 (GRCm39) missense probably damaging 0.99
R1188:Pikfyve UTSW 1 65,286,118 (GRCm39) missense possibly damaging 0.46
R1412:Pikfyve UTSW 1 65,241,989 (GRCm39) missense possibly damaging 0.64
R1421:Pikfyve UTSW 1 65,310,470 (GRCm39) missense probably damaging 1.00
R1468:Pikfyve UTSW 1 65,290,825 (GRCm39) missense probably damaging 0.98
R1468:Pikfyve UTSW 1 65,290,825 (GRCm39) missense probably damaging 0.98
R1472:Pikfyve UTSW 1 65,263,360 (GRCm39) missense probably damaging 0.96
R1478:Pikfyve UTSW 1 65,302,136 (GRCm39) critical splice donor site probably null
R1501:Pikfyve UTSW 1 65,304,443 (GRCm39) missense possibly damaging 0.84
R1757:Pikfyve UTSW 1 65,291,707 (GRCm39) missense probably damaging 0.99
R1773:Pikfyve UTSW 1 65,285,529 (GRCm39) missense probably benign
R1773:Pikfyve UTSW 1 65,231,430 (GRCm39) missense probably damaging 0.99
R1795:Pikfyve UTSW 1 65,291,716 (GRCm39) missense probably damaging 1.00
R1855:Pikfyve UTSW 1 65,297,957 (GRCm39) missense probably benign 0.03
R1905:Pikfyve UTSW 1 65,231,454 (GRCm39) critical splice donor site probably null
R1995:Pikfyve UTSW 1 65,285,867 (GRCm39) missense probably damaging 1.00
R2034:Pikfyve UTSW 1 65,261,516 (GRCm39) missense probably damaging 1.00
R2045:Pikfyve UTSW 1 65,292,512 (GRCm39) missense probably benign 0.06
R2229:Pikfyve UTSW 1 65,307,014 (GRCm39) missense probably damaging 1.00
R2295:Pikfyve UTSW 1 65,285,835 (GRCm39) missense probably damaging 0.99
R2913:Pikfyve UTSW 1 65,292,676 (GRCm39) missense probably damaging 1.00
R3818:Pikfyve UTSW 1 65,284,917 (GRCm39) missense probably damaging 1.00
R3832:Pikfyve UTSW 1 65,283,579 (GRCm39) missense probably damaging 0.99
R3850:Pikfyve UTSW 1 65,270,004 (GRCm39) missense probably damaging 1.00
R3946:Pikfyve UTSW 1 65,235,840 (GRCm39) missense probably damaging 1.00
R4105:Pikfyve UTSW 1 65,229,679 (GRCm39) unclassified probably benign
R4542:Pikfyve UTSW 1 65,283,589 (GRCm39) missense probably damaging 1.00
R4574:Pikfyve UTSW 1 65,231,351 (GRCm39) missense probably damaging 1.00
R4601:Pikfyve UTSW 1 65,273,421 (GRCm39) missense probably damaging 1.00
R4667:Pikfyve UTSW 1 65,289,432 (GRCm39) missense probably damaging 1.00
R4668:Pikfyve UTSW 1 65,289,432 (GRCm39) missense probably damaging 1.00
R4669:Pikfyve UTSW 1 65,289,432 (GRCm39) missense probably damaging 1.00
R4707:Pikfyve UTSW 1 65,307,005 (GRCm39) missense probably benign
R4716:Pikfyve UTSW 1 65,285,635 (GRCm39) missense possibly damaging 0.84
R4758:Pikfyve UTSW 1 65,311,674 (GRCm39) missense possibly damaging 0.84
R4784:Pikfyve UTSW 1 65,307,005 (GRCm39) missense probably benign
R4785:Pikfyve UTSW 1 65,307,005 (GRCm39) missense probably benign
R4805:Pikfyve UTSW 1 65,307,959 (GRCm39) missense probably damaging 0.99
R4831:Pikfyve UTSW 1 65,235,900 (GRCm39) missense probably damaging 1.00
R4837:Pikfyve UTSW 1 65,285,749 (GRCm39) missense possibly damaging 0.92
R5064:Pikfyve UTSW 1 65,292,566 (GRCm39) missense probably damaging 1.00
R5115:Pikfyve UTSW 1 65,263,276 (GRCm39) intron probably benign
R5265:Pikfyve UTSW 1 65,306,988 (GRCm39) missense possibly damaging 0.72
R5279:Pikfyve UTSW 1 65,235,858 (GRCm39) nonsense probably null
R5384:Pikfyve UTSW 1 65,283,568 (GRCm39) missense probably damaging 1.00
R5387:Pikfyve UTSW 1 65,304,427 (GRCm39) missense possibly damaging 0.94
R5461:Pikfyve UTSW 1 65,274,192 (GRCm39) missense probably damaging 1.00
R5467:Pikfyve UTSW 1 65,291,654 (GRCm39) missense probably damaging 1.00
R5560:Pikfyve UTSW 1 65,292,566 (GRCm39) missense probably damaging 1.00
R5575:Pikfyve UTSW 1 65,312,889 (GRCm39) missense probably damaging 1.00
R5611:Pikfyve UTSW 1 65,295,247 (GRCm39) missense probably damaging 0.96
R5663:Pikfyve UTSW 1 65,255,187 (GRCm39) missense probably benign 0.09
R5891:Pikfyve UTSW 1 65,241,896 (GRCm39) missense probably damaging 1.00
R5960:Pikfyve UTSW 1 65,292,597 (GRCm39) nonsense probably null
R6026:Pikfyve UTSW 1 65,311,856 (GRCm39) missense probably damaging 1.00
R6057:Pikfyve UTSW 1 65,311,730 (GRCm39) missense probably damaging 1.00
R6101:Pikfyve UTSW 1 65,303,504 (GRCm39) critical splice acceptor site probably null
R6105:Pikfyve UTSW 1 65,303,504 (GRCm39) critical splice acceptor site probably null
R6161:Pikfyve UTSW 1 65,255,202 (GRCm39) missense probably benign 0.36
R6287:Pikfyve UTSW 1 65,292,691 (GRCm39) critical splice donor site probably null
R6290:Pikfyve UTSW 1 65,242,084 (GRCm39) critical splice donor site probably null
R6296:Pikfyve UTSW 1 65,302,112 (GRCm39) missense probably damaging 0.99
R6516:Pikfyve UTSW 1 65,304,940 (GRCm39) missense probably benign 0.35
R6835:Pikfyve UTSW 1 65,298,002 (GRCm39) missense probably damaging 0.98
R6994:Pikfyve UTSW 1 65,291,689 (GRCm39) missense probably damaging 1.00
R6997:Pikfyve UTSW 1 65,285,822 (GRCm39) missense probably damaging 1.00
R7038:Pikfyve UTSW 1 65,273,520 (GRCm39) missense probably damaging 1.00
R7044:Pikfyve UTSW 1 65,286,013 (GRCm39) missense probably benign 0.01
R7057:Pikfyve UTSW 1 65,286,364 (GRCm39) missense probably benign 0.00
R7525:Pikfyve UTSW 1 65,283,585 (GRCm39) nonsense probably null
R7558:Pikfyve UTSW 1 65,311,782 (GRCm39) missense probably benign 0.01
R7625:Pikfyve UTSW 1 65,307,036 (GRCm39) missense possibly damaging 0.86
R7807:Pikfyve UTSW 1 65,309,101 (GRCm39) missense probably damaging 1.00
R7961:Pikfyve UTSW 1 65,294,293 (GRCm39) missense probably damaging 1.00
R8009:Pikfyve UTSW 1 65,294,293 (GRCm39) missense probably damaging 1.00
R8154:Pikfyve UTSW 1 65,304,948 (GRCm39) missense probably damaging 1.00
R8192:Pikfyve UTSW 1 65,285,554 (GRCm39) missense possibly damaging 0.93
R8275:Pikfyve UTSW 1 65,292,501 (GRCm39) splice site probably benign
R8307:Pikfyve UTSW 1 65,284,894 (GRCm39) missense possibly damaging 0.77
R8710:Pikfyve UTSW 1 65,255,155 (GRCm39) missense possibly damaging 0.94
R8867:Pikfyve UTSW 1 65,283,576 (GRCm39) missense probably damaging 1.00
R8936:Pikfyve UTSW 1 65,310,427 (GRCm39) missense possibly damaging 0.84
R8940:Pikfyve UTSW 1 65,286,129 (GRCm39) missense probably benign 0.00
R8995:Pikfyve UTSW 1 65,244,746 (GRCm39) critical splice acceptor site probably null
R9131:Pikfyve UTSW 1 65,285,239 (GRCm39) missense probably damaging 1.00
R9151:Pikfyve UTSW 1 65,235,898 (GRCm39) missense probably damaging 1.00
R9210:Pikfyve UTSW 1 65,291,719 (GRCm39) missense probably damaging 1.00
R9212:Pikfyve UTSW 1 65,291,719 (GRCm39) missense probably damaging 1.00
R9235:Pikfyve UTSW 1 65,299,188 (GRCm39) missense probably benign 0.37
R9368:Pikfyve UTSW 1 65,307,901 (GRCm39) missense probably damaging 1.00
R9489:Pikfyve UTSW 1 65,303,561 (GRCm39) missense probably benign
R9605:Pikfyve UTSW 1 65,303,561 (GRCm39) missense probably benign
R9686:Pikfyve UTSW 1 65,291,615 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATTGTTAGGGCCTGAAAATCTTTC -3'
(R):5'- GCTGCATACCTACCATACATGC -3'

Sequencing Primer
(F):5'- AGAGGGTGAAACTTTTCCTAAAAC -3'
(R):5'- CAGTAACATGTCCTGAGCA -3'
Posted On 2021-12-30