Incidental Mutation 'R9092:Olfr1208'
ID 691050
Institutional Source Beutler Lab
Gene Symbol Olfr1208
Ensembl Gene ENSMUSG00000075114
Gene Name olfactory receptor 1208
Synonyms MOR225-4, GA_x6K02T2Q125-50372411-50371485
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock # R9092 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 88895575-88902311 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 88896977 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 207 (T207A)
Ref Sequence ENSEMBL: ENSMUSP00000149695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099810] [ENSMUST00000214121] [ENSMUST00000214297]
AlphaFold Q8VG47
Predicted Effect probably damaging
Transcript: ENSMUST00000099810
AA Change: T207A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097398
Gene: ENSMUSG00000075114
AA Change: T207A

DomainStartEndE-ValueType
Pfam:7tm_4 28 302 1.9e-48 PFAM
Pfam:7tm_1 38 284 2.6e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214121
AA Change: T207A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000214297
AA Change: T207A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016K19Rik A G 11: 76,003,061 D88G possibly damaging Het
Crtc3 T C 7: 80,589,880 M575V probably benign Het
Cux1 T A 5: 136,485,817 N22I probably damaging Het
Dcun1d2 G A 8: 13,257,935 R248W probably damaging Het
Dlc1 G T 8: 36,732,706 H7Q probably benign Het
Drd2 A G 9: 49,395,704 D30G probably benign Het
Duxf3 GCCC GCC 10: 58,231,122 probably null Het
E2f7 T C 10: 110,781,013 S705P probably benign Het
Ephb3 G A 16: 21,222,464 S977N probably benign Het
F13a1 T G 13: 36,906,019 D448A probably benign Het
Fam216b T C 14: 78,085,097 T56A possibly damaging Het
Fcho2 T C 13: 98,749,883 T408A probably benign Het
Flvcr1 A T 1: 191,008,167 V552E Het
Gab3 TCT TCTGCT X: 74,999,996 probably benign Het
Gab3 CTT CTTGTT X: 75,000,006 probably benign Het
Galnt15 A G 14: 32,058,239 K622E probably benign Het
Gjb3 GCCAGATGCGCCCA GCCAGATGCGCCCAGATGCGCCCA 4: 127,326,665 probably null Het
Gjb3 AGATGCGCCC AGATGCGCCCTGATGCGCCC 4: 127,326,668 probably null Het
Gjb3 A AGATGCGCCCG 4: 127,326,678 probably null Het
Gm5414 T G 15: 101,627,910 R93S probably benign Het
Il7r T A 15: 9,510,184 H261L probably benign Het
Itsn1 T A 16: 91,812,114 M250K possibly damaging Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Lrrc47 C A 4: 154,011,964 T72K possibly damaging Het
Map2k4 C A 11: 65,690,773 R371L probably benign Het
Mmrn2 T C 14: 34,396,630 F158L probably benign Het
Mtus1 A T 8: 41,002,438 L242Q probably damaging Het
Myo5a T C 9: 75,147,132 probably null Het
Noc3l T A 19: 38,810,043 K305I probably damaging Het
Pag1 T C 3: 9,699,788 T102A probably benign Het
Pam A G 1: 97,864,251 S482P probably benign Het
Pax1 T G 2: 147,362,367 W23G unknown Het
Pcdhgb1 T A 18: 37,680,936 V160D possibly damaging Het
Pdzph1 T C 17: 58,973,130 D719G probably damaging Het
Phlda1 T C 10: 111,506,613 L70S possibly damaging Het
Pikfyve G A 1: 65,244,400 R732K probably damaging Het
Pkd1 G T 17: 24,569,373 V702F possibly damaging Het
Pkhd1 A G 1: 20,562,362 Y610H probably benign Het
Pofut1 T G 2: 153,259,588 H87Q probably benign Het
Runx2 C A 17: 44,735,556 D109Y probably damaging Het
Serpina1b T A 12: 103,730,281 I290F probably benign Het
Sez6 G A 11: 77,974,295 E623K possibly damaging Het
Sh3tc1 T C 5: 35,716,977 N198S probably benign Het
Slc27a6 C A 18: 58,609,258 R515S probably benign Het
Sorbs3 C T 14: 70,207,555 V25I probably benign Het
Speg A G 1: 75,422,734 E2275G probably benign Het
Tmem161b C T 13: 84,292,384 T307I possibly damaging Het
Tmem30a T C 9: 79,771,299 D361G probably damaging Het
Tmprss11c T C 5: 86,237,636 T326A probably benign Het
Tpbg T C 9: 85,844,863 V295A possibly damaging Het
Ulk4 A T 9: 121,073,937 I1158N Het
Utp20 C A 10: 88,768,817 A1739S probably benign Het
Utp20 T C 10: 88,775,318 N1379S probably damaging Het
Vmn1r66 T A 7: 10,274,183 I308F possibly damaging Het
Vmn2r101 A T 17: 19,589,545 T198S probably benign Het
Vps16 T C 2: 130,439,673 I318T probably damaging Het
Wdr11 T A 7: 129,624,727 W750R probably damaging Het
Zfp608 A G 18: 54,898,576 I764T probably benign Het
Zfp708 C A 13: 67,070,500 D420Y probably damaging Het
Other mutations in Olfr1208
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01340:Olfr1208 APN 2 88896977 missense probably damaging 1.00
IGL02132:Olfr1208 APN 2 88897159 missense probably benign
IGL02374:Olfr1208 APN 2 88897459 missense probably damaging 1.00
R1378:Olfr1208 UTSW 2 88897026 missense probably benign 0.01
R1570:Olfr1208 UTSW 2 88896946 missense probably damaging 1.00
R2056:Olfr1208 UTSW 2 88896761 missense probably damaging 1.00
R2092:Olfr1208 UTSW 2 88897267 missense probably damaging 0.99
R2185:Olfr1208 UTSW 2 88896703 missense probably damaging 0.99
R5223:Olfr1208 UTSW 2 88897334 missense probably benign 0.03
R5479:Olfr1208 UTSW 2 88896691 missense probably benign 0.13
R6463:Olfr1208 UTSW 2 88897118 missense probably benign 0.00
R6859:Olfr1208 UTSW 2 88896934 missense probably benign
R7347:Olfr1208 UTSW 2 88897271 missense possibly damaging 0.51
R7352:Olfr1208 UTSW 2 88896718 missense probably damaging 1.00
R7544:Olfr1208 UTSW 2 88897361 missense probably damaging 1.00
R7713:Olfr1208 UTSW 2 88897778 start gained probably benign
R7842:Olfr1208 UTSW 2 88896961 missense possibly damaging 0.89
R7869:Olfr1208 UTSW 2 88897064 missense probably benign 0.00
R8137:Olfr1208 UTSW 2 88896669 makesense probably null
R8168:Olfr1208 UTSW 2 88896776 missense probably benign 0.09
R8556:Olfr1208 UTSW 2 88897038 nonsense probably null
R8967:Olfr1208 UTSW 2 88897500 nonsense probably null
R9221:Olfr1208 UTSW 2 88896911 missense probably benign
Z1176:Olfr1208 UTSW 2 88897061 missense probably damaging 1.00
Z1177:Olfr1208 UTSW 2 88896800 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTGTCGTCCCCAACAGAATC -3'
(R):5'- TGAGCAGACAGGTATGTTACATCC -3'

Sequencing Primer
(F):5'- GTCCCCAACAGAATCACCCATTG -3'
(R):5'- ACATCCTTGTGATAGGCTCAG -3'
Posted On 2021-12-30