Mutagenetix > Incidental Mutation

Incidental Mutation 'R9092:Vps16'

691051

Institutional Source

Beutler Lab

Gene Symbol

Vps16

Ensembl Gene

ENSMUSG00000027411

Gene Name

VSP16 CORVET/HOPS core subunit

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.973) question?

Stock #

R9092 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

130424339-130444269 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 130439673 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 318 (I318T)

Ref Sequence

ENSEMBL: ENSMUSP00000028900 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028900] [ENSMUST00000128994]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000028900
AA Change: I318T

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000028900
Gene: ENSMUSG00000027411
AA Change: I318T

Domain	Start	End	E-Value	Type
Pfam:Vps16_N	4	420	1e-166	PFAM
low complexity region	452	462	N/A	INTRINSIC
Pfam:Vps16_C	517	835	5.5e-150	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000128994
AA Change: I277T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000115899
Gene: ENSMUSG00000027411
AA Change: I277T

Domain	Start	End	E-Value	Type
Pfam:Vps16_N	4	212	3.2e-74	PFAM
Pfam:Vps16_N	205	316	1e-45	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.8%
20x: 99.4%

Validation Efficiency

93% (56/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene encodes the human homolog of yeast class C Vps16 protein. The mammalian class C Vps proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mice with a homozygous point mutation in exon 3 display impaired motor function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700016K19Rik	A	G	11: 76,003,061	D88G	possibly damaging	Het
Chl1	T	C	6: 103,668,854		probably benign	Het
Crtc3	T	C	7: 80,589,880	M575V	probably benign	Het
Cux1	T	A	5: 136,485,817	N22I	probably damaging	Het
Dcun1d2	G	A	8: 13,257,935	R248W	probably damaging	Het
Dlc1	G	T	8: 36,732,706	H7Q	probably benign	Het
Drd2	A	G	9: 49,395,704	D30G	probably benign	Het
Duxf3	GCCC	GCC	10: 58,231,122		probably null	Het
E2f7	T	C	10: 110,781,013	S705P	probably benign	Het
Ephb3	G	A	16: 21,222,464	S977N	probably benign	Het
F13a1	T	G	13: 36,906,019	D448A	probably benign	Het
Fam216b	T	C	14: 78,085,097	T56A	possibly damaging	Het
Fcho2	T	C	13: 98,749,883	T408A	probably benign	Het
Flvcr1	A	T	1: 191,008,167	V552E		Het
Gab3	TCT	TCTGCT	X: 74,999,996		probably benign	Het
Gab3	CTT	CTTGTT	X: 75,000,006		probably benign	Het
Galnt15	A	G	14: 32,058,239	K622E	probably benign	Het
Gjb3	GCCAGATGCGCCCA	GCCAGATGCGCCCAGATGCGCCCA	4: 127,326,665		probably null	Het
Gjb3	A	AGATGCGCCCG	4: 127,326,678		probably null	Het
Gm5414	T	G	15: 101,627,910	R93S	probably benign	Het
Gtf2i	A	G	5: 134,289,387	*87Q	probably null	Het
Il7r	T	A	15: 9,510,184	H261L	probably benign	Het
Itsn1	T	A	16: 91,812,114	M250K	possibly damaging	Het
Krt9	TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC	TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC	11: 100,189,077		probably benign	Het
Lrrc47	C	A	4: 154,011,964	T72K	possibly damaging	Het
Map2k4	C	A	11: 65,690,773	R371L	probably benign	Het
Mmrn2	T	C	14: 34,396,630	F158L	probably benign	Het
Mtus1	A	T	8: 41,002,438	L242Q	probably damaging	Het
Myo5a	T	C	9: 75,147,132		probably null	Het
Noc3l	T	A	19: 38,810,043	K305I	probably damaging	Het
Olfr1208	T	C	2: 88,896,977	T207A	probably damaging	Het
Pag1	T	C	3: 9,699,788	T102A	probably benign	Het
Pam	A	G	1: 97,864,251	S482P	probably benign	Het
Pax1	T	G	2: 147,362,367	W23G	unknown	Het
Pcdhgb1	T	A	18: 37,680,936	V160D	possibly damaging	Het
Pdzph1	T	C	17: 58,973,130	D719G	probably damaging	Het
Phlda1	T	C	10: 111,506,613	L70S	possibly damaging	Het
Pikfyve	G	A	1: 65,244,400	R732K	probably damaging	Het
Pkd1	G	T	17: 24,569,373	V702F	possibly damaging	Het
Pkhd1	A	G	1: 20,562,362	Y610H	probably benign	Het
Pofut1	T	G	2: 153,259,588	H87Q	probably benign	Het
Runx2	C	A	17: 44,735,556	D109Y	probably damaging	Het
Serpina1b	T	A	12: 103,730,281	I290F	probably benign	Het
Sez6	G	A	11: 77,974,295	E623K	possibly damaging	Het
Sh3tc1	T	C	5: 35,716,977	N198S	probably benign	Het
Slc27a6	C	A	18: 58,609,258	R515S	probably benign	Het
Sorbs3	C	T	14: 70,207,555	V25I	probably benign	Het
Speg	A	G	1: 75,422,734	E2275G	probably benign	Het
Tmem161b	C	T	13: 84,292,384	T307I	possibly damaging	Het
Tmem30a	T	C	9: 79,771,299	D361G	probably damaging	Het
Tmprss11c	T	C	5: 86,237,636	T326A	probably benign	Het
Tpbg	T	C	9: 85,844,863	V295A	possibly damaging	Het
Ulk4	A	T	9: 121,073,937	I1158N		Het
Utp20	C	A	10: 88,768,817	A1739S	probably benign	Het
Utp20	T	C	10: 88,775,318	N1379S	probably damaging	Het
Vmn1r66	T	A	7: 10,274,183	I308F	possibly damaging	Het
Vmn2r101	A	T	17: 19,589,545	T198S	probably benign	Het
Wdr11	T	A	7: 129,624,727	W750R	probably damaging	Het
Zfp608	A	G	18: 54,898,576	I764T	probably benign	Het
Zfp708	C	A	13: 67,070,500	D420Y	probably damaging	Het

Other mutations in Vps16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01327:Vps16	APN	2	130437696	missense	probably benign	0.19
IGL01400:Vps16	APN	2	130438353	missense	possibly damaging	0.73
IGL01542:Vps16	APN	2	130438394	missense	probably damaging	0.97
IGL02011:Vps16	APN	2	130441479	missense	probably benign	0.04
IGL02192:Vps16	APN	2	130440932	missense	probably damaging	0.98
IGL02220:Vps16	APN	2	130441653	missense	possibly damaging	0.85
IGL02587:Vps16	APN	2	130439716	critical splice donor site	probably null
R0427:Vps16	UTSW	2	130438850	missense	probably benign	0.00
R0507:Vps16	UTSW	2	130437712	critical splice donor site	probably null
R1550:Vps16	UTSW	2	130440340	missense	probably benign	0.09
R1789:Vps16	UTSW	2	130443600	missense	probably benign	0.42
R3895:Vps16	UTSW	2	130438676	missense	possibly damaging	0.96
R3981:Vps16	UTSW	2	130442594	missense	possibly damaging	0.77
R4092:Vps16	UTSW	2	130439912	missense	probably damaging	1.00
R4555:Vps16	UTSW	2	130443576	missense	probably damaging	1.00
R4569:Vps16	UTSW	2	130442204	missense	probably benign
R4803:Vps16	UTSW	2	130438110	missense	probably benign	0.27
R4835:Vps16	UTSW	2	130438300	splice site	probably benign
R5022:Vps16	UTSW	2	130439452	missense	probably benign	0.07
R5023:Vps16	UTSW	2	130439452	missense	probably benign	0.07
R5057:Vps16	UTSW	2	130439452	missense	probably benign	0.07
R5158:Vps16	UTSW	2	130441279	missense	probably damaging	1.00
R5177:Vps16	UTSW	2	130443368	nonsense	probably null
R5540:Vps16	UTSW	2	130442385	missense	probably benign	0.00
R5680:Vps16	UTSW	2	130440324	missense	possibly damaging	0.64
R5689:Vps16	UTSW	2	130439091	nonsense	probably null
R5690:Vps16	UTSW	2	130439091	nonsense	probably null
R5926:Vps16	UTSW	2	130443556	missense	probably damaging	0.97
R5992:Vps16	UTSW	2	130424449	critical splice donor site	probably null
R6135:Vps16	UTSW	2	130438653	missense	possibly damaging	0.57
R6370:Vps16	UTSW	2	130443384	missense	probably damaging	1.00
R6898:Vps16	UTSW	2	130437681	missense	possibly damaging	0.74
R7378:Vps16	UTSW	2	130438179	missense	probably damaging	1.00
R7487:Vps16	UTSW	2	130439057	nonsense	probably null
R7641:Vps16	UTSW	2	130440528	missense	probably benign	0.28
R7720:Vps16	UTSW	2	130441703	nonsense	probably null
R8246:Vps16	UTSW	2	130438873	missense	probably damaging	1.00
R8363:Vps16	UTSW	2	130442241	missense	probably benign	0.08
R9128:Vps16	UTSW	2	130424399	missense	possibly damaging	0.51
R9352:Vps16	UTSW	2	130441903	critical splice donor site	probably null
R9406:Vps16	UTSW	2	130441505	critical splice donor site	probably null
R9508:Vps16	UTSW	2	130442441	missense	possibly damaging	0.94
R9800:Vps16	UTSW	2	130440485	missense	probably benign	0.02
RF021:Vps16	UTSW	2	130438209	missense	probably benign	0.09
Z1177:Vps16	UTSW	2	130441426	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAAGGAAAGGGCTGTTGTTG -3'
(R):5'- CTCTTCACTGGCCACTAGAAGAG -3'

Sequencing Primer
(F):5'- CTGGGAGAGGCGGCTGATG -3'
(R):5'- ACTGGCCACTAGAAGAGGAGTTTTTG -3'

Posted On

2021-12-30