Incidental Mutation 'R9092:Vps16'
ID 691051
Institutional Source Beutler Lab
Gene Symbol Vps16
Ensembl Gene ENSMUSG00000027411
Gene Name VSP16 CORVET/HOPS core subunit
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.973) question?
Stock # R9092 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 130424339-130444269 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 130439673 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 318 (I318T)
Ref Sequence ENSEMBL: ENSMUSP00000028900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028900] [ENSMUST00000128994]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000028900
AA Change: I318T

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000028900
Gene: ENSMUSG00000027411
AA Change: I318T

DomainStartEndE-ValueType
Pfam:Vps16_N 4 420 1e-166 PFAM
low complexity region 452 462 N/A INTRINSIC
Pfam:Vps16_C 517 835 5.5e-150 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000128994
AA Change: I277T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115899
Gene: ENSMUSG00000027411
AA Change: I277T

DomainStartEndE-ValueType
Pfam:Vps16_N 4 212 3.2e-74 PFAM
Pfam:Vps16_N 205 316 1e-45 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 93% (56/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene encodes the human homolog of yeast class C Vps16 protein. The mammalian class C Vps proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mice with a homozygous point mutation in exon 3 display impaired motor function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016K19Rik A G 11: 76,003,061 D88G possibly damaging Het
Chl1 T C 6: 103,668,854 probably benign Het
Crtc3 T C 7: 80,589,880 M575V probably benign Het
Cux1 T A 5: 136,485,817 N22I probably damaging Het
Dcun1d2 G A 8: 13,257,935 R248W probably damaging Het
Dlc1 G T 8: 36,732,706 H7Q probably benign Het
Drd2 A G 9: 49,395,704 D30G probably benign Het
Duxf3 GCCC GCC 10: 58,231,122 probably null Het
E2f7 T C 10: 110,781,013 S705P probably benign Het
Ephb3 G A 16: 21,222,464 S977N probably benign Het
F13a1 T G 13: 36,906,019 D448A probably benign Het
Fam216b T C 14: 78,085,097 T56A possibly damaging Het
Fcho2 T C 13: 98,749,883 T408A probably benign Het
Flvcr1 A T 1: 191,008,167 V552E Het
Gab3 TCT TCTGCT X: 74,999,996 probably benign Het
Gab3 CTT CTTGTT X: 75,000,006 probably benign Het
Galnt15 A G 14: 32,058,239 K622E probably benign Het
Gjb3 GCCAGATGCGCCCA GCCAGATGCGCCCAGATGCGCCCA 4: 127,326,665 probably null Het
Gjb3 A AGATGCGCCCG 4: 127,326,678 probably null Het
Gm5414 T G 15: 101,627,910 R93S probably benign Het
Gtf2i A G 5: 134,289,387 *87Q probably null Het
Il7r T A 15: 9,510,184 H261L probably benign Het
Itsn1 T A 16: 91,812,114 M250K possibly damaging Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Lrrc47 C A 4: 154,011,964 T72K possibly damaging Het
Map2k4 C A 11: 65,690,773 R371L probably benign Het
Mmrn2 T C 14: 34,396,630 F158L probably benign Het
Mtus1 A T 8: 41,002,438 L242Q probably damaging Het
Myo5a T C 9: 75,147,132 probably null Het
Noc3l T A 19: 38,810,043 K305I probably damaging Het
Olfr1208 T C 2: 88,896,977 T207A probably damaging Het
Pag1 T C 3: 9,699,788 T102A probably benign Het
Pam A G 1: 97,864,251 S482P probably benign Het
Pax1 T G 2: 147,362,367 W23G unknown Het
Pcdhgb1 T A 18: 37,680,936 V160D possibly damaging Het
Pdzph1 T C 17: 58,973,130 D719G probably damaging Het
Phlda1 T C 10: 111,506,613 L70S possibly damaging Het
Pikfyve G A 1: 65,244,400 R732K probably damaging Het
Pkd1 G T 17: 24,569,373 V702F possibly damaging Het
Pkhd1 A G 1: 20,562,362 Y610H probably benign Het
Pofut1 T G 2: 153,259,588 H87Q probably benign Het
Runx2 C A 17: 44,735,556 D109Y probably damaging Het
Serpina1b T A 12: 103,730,281 I290F probably benign Het
Sez6 G A 11: 77,974,295 E623K possibly damaging Het
Sh3tc1 T C 5: 35,716,977 N198S probably benign Het
Slc27a6 C A 18: 58,609,258 R515S probably benign Het
Sorbs3 C T 14: 70,207,555 V25I probably benign Het
Speg A G 1: 75,422,734 E2275G probably benign Het
Tmem161b C T 13: 84,292,384 T307I possibly damaging Het
Tmem30a T C 9: 79,771,299 D361G probably damaging Het
Tmprss11c T C 5: 86,237,636 T326A probably benign Het
Tpbg T C 9: 85,844,863 V295A possibly damaging Het
Ulk4 A T 9: 121,073,937 I1158N Het
Utp20 C A 10: 88,768,817 A1739S probably benign Het
Utp20 T C 10: 88,775,318 N1379S probably damaging Het
Vmn1r66 T A 7: 10,274,183 I308F possibly damaging Het
Vmn2r101 A T 17: 19,589,545 T198S probably benign Het
Wdr11 T A 7: 129,624,727 W750R probably damaging Het
Zfp608 A G 18: 54,898,576 I764T probably benign Het
Zfp708 C A 13: 67,070,500 D420Y probably damaging Het
Other mutations in Vps16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Vps16 APN 2 130437696 missense probably benign 0.19
IGL01400:Vps16 APN 2 130438353 missense possibly damaging 0.73
IGL01542:Vps16 APN 2 130438394 missense probably damaging 0.97
IGL02011:Vps16 APN 2 130441479 missense probably benign 0.04
IGL02192:Vps16 APN 2 130440932 missense probably damaging 0.98
IGL02220:Vps16 APN 2 130441653 missense possibly damaging 0.85
IGL02587:Vps16 APN 2 130439716 critical splice donor site probably null
R0427:Vps16 UTSW 2 130438850 missense probably benign 0.00
R0507:Vps16 UTSW 2 130437712 critical splice donor site probably null
R1550:Vps16 UTSW 2 130440340 missense probably benign 0.09
R1789:Vps16 UTSW 2 130443600 missense probably benign 0.42
R3895:Vps16 UTSW 2 130438676 missense possibly damaging 0.96
R3981:Vps16 UTSW 2 130442594 missense possibly damaging 0.77
R4092:Vps16 UTSW 2 130439912 missense probably damaging 1.00
R4555:Vps16 UTSW 2 130443576 missense probably damaging 1.00
R4569:Vps16 UTSW 2 130442204 missense probably benign
R4803:Vps16 UTSW 2 130438110 missense probably benign 0.27
R4835:Vps16 UTSW 2 130438300 splice site probably benign
R5022:Vps16 UTSW 2 130439452 missense probably benign 0.07
R5023:Vps16 UTSW 2 130439452 missense probably benign 0.07
R5057:Vps16 UTSW 2 130439452 missense probably benign 0.07
R5158:Vps16 UTSW 2 130441279 missense probably damaging 1.00
R5177:Vps16 UTSW 2 130443368 nonsense probably null
R5540:Vps16 UTSW 2 130442385 missense probably benign 0.00
R5680:Vps16 UTSW 2 130440324 missense possibly damaging 0.64
R5689:Vps16 UTSW 2 130439091 nonsense probably null
R5690:Vps16 UTSW 2 130439091 nonsense probably null
R5926:Vps16 UTSW 2 130443556 missense probably damaging 0.97
R5992:Vps16 UTSW 2 130424449 critical splice donor site probably null
R6135:Vps16 UTSW 2 130438653 missense possibly damaging 0.57
R6370:Vps16 UTSW 2 130443384 missense probably damaging 1.00
R6898:Vps16 UTSW 2 130437681 missense possibly damaging 0.74
R7378:Vps16 UTSW 2 130438179 missense probably damaging 1.00
R7487:Vps16 UTSW 2 130439057 nonsense probably null
R7641:Vps16 UTSW 2 130440528 missense probably benign 0.28
R7720:Vps16 UTSW 2 130441703 nonsense probably null
R8246:Vps16 UTSW 2 130438873 missense probably damaging 1.00
R8363:Vps16 UTSW 2 130442241 missense probably benign 0.08
R9128:Vps16 UTSW 2 130424399 missense possibly damaging 0.51
R9352:Vps16 UTSW 2 130441903 critical splice donor site probably null
R9406:Vps16 UTSW 2 130441505 critical splice donor site probably null
R9508:Vps16 UTSW 2 130442441 missense possibly damaging 0.94
R9800:Vps16 UTSW 2 130440485 missense probably benign 0.02
RF021:Vps16 UTSW 2 130438209 missense probably benign 0.09
Z1177:Vps16 UTSW 2 130441426 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGGAAAGGGCTGTTGTTG -3'
(R):5'- CTCTTCACTGGCCACTAGAAGAG -3'

Sequencing Primer
(F):5'- CTGGGAGAGGCGGCTGATG -3'
(R):5'- ACTGGCCACTAGAAGAGGAGTTTTTG -3'
Posted On 2021-12-30