Incidental Mutation 'R9092:Ulk4'
ID 691072
Institutional Source Beutler Lab
Gene Symbol Ulk4
Ensembl Gene ENSMUSG00000040936
Gene Name unc-51-like kinase 4
Synonyms 4932415A06Rik
MMRRC Submission 068908-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.682) question?
Stock # R9092 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 120793520-121115225 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 120903003 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 1158 (I1158N)
Ref Sequence ENSEMBL: ENSMUSP00000057960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051479] [ENSMUST00000051565] [ENSMUST00000171061] [ENSMUST00000171923]
AlphaFold no structure available at present
Predicted Effect
SMART Domains Protein: ENSMUSP00000057960
Gene: ENSMUSG00000040936
AA Change: I1158N

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 277 9.9e-26 PFAM
Pfam:Pkinase 4 280 4.6e-49 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1161 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000051565
SMART Domains Protein: ENSMUSP00000054833
Gene: ENSMUSG00000040936

DomainStartEndE-ValueType
SCOP:d1jvpp_ 1 32 9e-6 SMART
Blast:S_TKc 4 45 2e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000171061
SMART Domains Protein: ENSMUSP00000129214
Gene: ENSMUSG00000040936

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 277 4.3e-26 PFAM
Pfam:Pkinase 4 280 2.1e-49 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000171923
AA Change: I1158N

PolyPhen 2 Score 0.652 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000131342
Gene: ENSMUSG00000040936
AA Change: I1158N

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 153 3.1e-14 PFAM
Pfam:Pkinase 4 280 4.9e-50 PFAM
Pfam:Pkinase_Tyr 165 277 6.1e-10 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1171 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 93% (56/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the unc-51-like serine/threonine kinase (STK) family. Members of this protein family play a role in neuronal growth and endocytosis. The encoded protein is likely involved in neurite branching, neurite elongation and neuronal migration. Genome-wide association studies (GWAS) indicate an association of variations in this gene with blood pressure and hypertension. Sequence variations in this gene may also be be associated with psychiatric disorders, including schizophrenia and bipolar disorder. Pseudogenes associated with this gene have been identified and are located on chromosome 15. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for a null allele show reduced body size, hydrocephaly, dilated brain ventricles, otitis media, and premature death. Hypomorphic mice show partial corpus callosum aplasia, hydrocephaly, subcommissural organ and ependymal motile ciliary defects, aqueduct stenosis, and impaired CSF flow. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, other(1) Gene trapped(1)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Chl1 T C 6: 103,645,815 (GRCm39) probably benign Het
Crtc3 T C 7: 80,239,628 (GRCm39) M575V probably benign Het
Cux1 T A 5: 136,514,671 (GRCm39) N22I probably damaging Het
Dcun1d2 G A 8: 13,307,935 (GRCm39) R248W probably damaging Het
Dlc1 G T 8: 37,199,860 (GRCm39) H7Q probably benign Het
Drd2 A G 9: 49,307,004 (GRCm39) D30G probably benign Het
Duxf3 GCCC GCC 10: 58,066,944 (GRCm39) probably null Het
E2f7 T C 10: 110,616,874 (GRCm39) S705P probably benign Het
Ephb3 G A 16: 21,041,214 (GRCm39) S977N probably benign Het
F13a1 T G 13: 37,089,993 (GRCm39) D448A probably benign Het
Fam216b T C 14: 78,322,537 (GRCm39) T56A possibly damaging Het
Fcho2 T C 13: 98,886,391 (GRCm39) T408A probably benign Het
Flvcr1 A T 1: 190,740,364 (GRCm39) V552E Het
Gab3 CTT CTTGTT X: 74,043,612 (GRCm39) probably benign Het
Gab3 TCT TCTGCT X: 74,043,602 (GRCm39) probably benign Het
Galnt15 A G 14: 31,780,196 (GRCm39) K622E probably benign Het
Gjb3 GCCAGATGCGCCCA GCCAGATGCGCCCAGATGCGCCCA 4: 127,220,458 (GRCm39) probably null Het
Gjb3 A AGATGCGCCCG 4: 127,220,471 (GRCm39) probably null Het
Gm5414 T G 15: 101,536,345 (GRCm39) R93S probably benign Het
Gtf2i A G 5: 134,318,241 (GRCm39) *87Q probably null Het
Il7r T A 15: 9,510,270 (GRCm39) H261L probably benign Het
Itsn1 T A 16: 91,609,002 (GRCm39) M250K possibly damaging Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,079,903 (GRCm39) probably benign Het
Liat1 A G 11: 75,893,887 (GRCm39) D88G possibly damaging Het
Lrrc47 C A 4: 154,096,421 (GRCm39) T72K possibly damaging Het
Map2k4 C A 11: 65,581,599 (GRCm39) R371L probably benign Het
Mmrn2 T C 14: 34,118,587 (GRCm39) F158L probably benign Het
Mtus1 A T 8: 41,455,475 (GRCm39) L242Q probably damaging Het
Myo5a T C 9: 75,054,414 (GRCm39) probably null Het
Noc3l T A 19: 38,798,487 (GRCm39) K305I probably damaging Het
Or4p8 T C 2: 88,727,321 (GRCm39) T207A probably damaging Het
Pag1 T C 3: 9,764,848 (GRCm39) T102A probably benign Het
Pam A G 1: 97,791,976 (GRCm39) S482P probably benign Het
Pax1 T G 2: 147,204,287 (GRCm39) W23G unknown Het
Pcdhgb1 T A 18: 37,813,989 (GRCm39) V160D possibly damaging Het
Pdzph1 T C 17: 59,280,125 (GRCm39) D719G probably damaging Het
Phlda1 T C 10: 111,342,474 (GRCm39) L70S possibly damaging Het
Pikfyve G A 1: 65,283,559 (GRCm39) R732K probably damaging Het
Pkd1 G T 17: 24,788,347 (GRCm39) V702F possibly damaging Het
Pkhd1 A G 1: 20,632,586 (GRCm39) Y610H probably benign Het
Pofut1 T G 2: 153,101,508 (GRCm39) H87Q probably benign Het
Runx2 C A 17: 45,046,443 (GRCm39) D109Y probably damaging Het
Serpina1b T A 12: 103,696,540 (GRCm39) I290F probably benign Het
Sez6 G A 11: 77,865,121 (GRCm39) E623K possibly damaging Het
Sh3tc1 T C 5: 35,874,321 (GRCm39) N198S probably benign Het
Slc27a6 C A 18: 58,742,330 (GRCm39) R515S probably benign Het
Sorbs3 C T 14: 70,445,004 (GRCm39) V25I probably benign Het
Speg A G 1: 75,399,378 (GRCm39) E2275G probably benign Het
Tmem161b C T 13: 84,440,503 (GRCm39) T307I possibly damaging Het
Tmem30a T C 9: 79,678,581 (GRCm39) D361G probably damaging Het
Tmprss11c T C 5: 86,385,495 (GRCm39) T326A probably benign Het
Tpbg T C 9: 85,726,916 (GRCm39) V295A possibly damaging Het
Utp20 C A 10: 88,604,679 (GRCm39) A1739S probably benign Het
Utp20 T C 10: 88,611,180 (GRCm39) N1379S probably damaging Het
Vmn1r66 T A 7: 10,008,110 (GRCm39) I308F possibly damaging Het
Vmn2r101 A T 17: 19,809,807 (GRCm39) T198S probably benign Het
Vps16 T C 2: 130,281,593 (GRCm39) I318T probably damaging Het
Wdr11 T A 7: 129,226,451 (GRCm39) W750R probably damaging Het
Zfp608 A G 18: 55,031,648 (GRCm39) I764T probably benign Het
Zfp708 C A 13: 67,218,564 (GRCm39) D420Y probably damaging Het
Other mutations in Ulk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Ulk4 APN 9 120,997,358 (GRCm39) missense possibly damaging 0.48
IGL01345:Ulk4 APN 9 121,037,228 (GRCm39) missense possibly damaging 0.48
IGL01432:Ulk4 APN 9 121,095,367 (GRCm39) missense probably damaging 1.00
IGL01807:Ulk4 APN 9 121,084,251 (GRCm39) missense probably damaging 1.00
IGL02139:Ulk4 APN 9 120,970,897 (GRCm39) splice site probably null
IGL02266:Ulk4 APN 9 120,910,766 (GRCm39) missense probably benign 0.10
IGL02511:Ulk4 APN 9 121,017,420 (GRCm39) missense probably damaging 1.00
IGL02546:Ulk4 APN 9 120,981,373 (GRCm39) nonsense probably null
IGL02687:Ulk4 APN 9 121,021,728 (GRCm39) missense possibly damaging 0.89
IGL03220:Ulk4 APN 9 120,974,402 (GRCm39) missense probably damaging 1.00
3-1:Ulk4 UTSW 9 121,084,237 (GRCm39) missense probably benign 0.02
R0031:Ulk4 UTSW 9 121,102,048 (GRCm39) missense probably damaging 1.00
R0433:Ulk4 UTSW 9 120,873,885 (GRCm39) missense probably benign 0.27
R0513:Ulk4 UTSW 9 120,981,391 (GRCm39) missense probably benign 0.13
R0524:Ulk4 UTSW 9 121,081,717 (GRCm39) critical splice donor site probably null
R1268:Ulk4 UTSW 9 121,086,140 (GRCm39) splice site probably benign
R1439:Ulk4 UTSW 9 121,095,324 (GRCm39) missense possibly damaging 0.58
R1470:Ulk4 UTSW 9 120,910,722 (GRCm39) missense probably benign 0.00
R1470:Ulk4 UTSW 9 120,910,722 (GRCm39) missense probably benign 0.00
R1531:Ulk4 UTSW 9 120,873,841 (GRCm39) missense probably damaging 0.97
R1595:Ulk4 UTSW 9 120,873,904 (GRCm39) missense probably damaging 0.96
R1620:Ulk4 UTSW 9 121,033,871 (GRCm39) missense possibly damaging 0.81
R1835:Ulk4 UTSW 9 120,997,250 (GRCm39) missense probably null 1.00
R1966:Ulk4 UTSW 9 121,086,182 (GRCm39) missense probably benign
R2129:Ulk4 UTSW 9 120,981,248 (GRCm39) missense probably benign 0.03
R2329:Ulk4 UTSW 9 121,101,953 (GRCm39) missense probably damaging 1.00
R2877:Ulk4 UTSW 9 121,089,105 (GRCm39) missense probably benign 0.11
R2878:Ulk4 UTSW 9 121,089,105 (GRCm39) missense probably benign 0.11
R3734:Ulk4 UTSW 9 121,091,055 (GRCm39) missense probably benign 0.21
R3769:Ulk4 UTSW 9 121,092,766 (GRCm39) missense probably benign 0.00
R4005:Ulk4 UTSW 9 120,997,265 (GRCm39) missense possibly damaging 0.94
R4024:Ulk4 UTSW 9 120,873,915 (GRCm39) missense possibly damaging 0.86
R4321:Ulk4 UTSW 9 120,903,062 (GRCm39) missense probably benign 0.00
R4461:Ulk4 UTSW 9 120,985,950 (GRCm39) missense possibly damaging 0.83
R4537:Ulk4 UTSW 9 121,092,704 (GRCm39) nonsense probably null
R4542:Ulk4 UTSW 9 121,092,704 (GRCm39) nonsense probably null
R4572:Ulk4 UTSW 9 121,021,830 (GRCm39) missense probably damaging 1.00
R4647:Ulk4 UTSW 9 120,970,918 (GRCm39) missense probably benign 0.15
R4712:Ulk4 UTSW 9 121,073,436 (GRCm39) missense probably benign 0.23
R4730:Ulk4 UTSW 9 121,092,791 (GRCm39) missense probably benign 0.05
R4731:Ulk4 UTSW 9 121,092,704 (GRCm39) nonsense probably null
R4732:Ulk4 UTSW 9 121,092,704 (GRCm39) nonsense probably null
R4733:Ulk4 UTSW 9 121,092,704 (GRCm39) nonsense probably null
R4737:Ulk4 UTSW 9 120,902,938 (GRCm39) nonsense probably null
R4781:Ulk4 UTSW 9 120,932,642 (GRCm39) missense probably benign 0.00
R4860:Ulk4 UTSW 9 121,079,968 (GRCm39) missense possibly damaging 0.68
R4926:Ulk4 UTSW 9 121,087,798 (GRCm39) missense probably benign 0.00
R4990:Ulk4 UTSW 9 121,021,852 (GRCm39) missense probably benign 0.01
R6056:Ulk4 UTSW 9 121,102,021 (GRCm39) missense probably damaging 1.00
R6448:Ulk4 UTSW 9 120,932,696 (GRCm39) missense probably damaging 0.99
R6546:Ulk4 UTSW 9 120,970,960 (GRCm39) missense probably damaging 1.00
R6668:Ulk4 UTSW 9 121,017,408 (GRCm39) missense probably damaging 1.00
R6915:Ulk4 UTSW 9 121,087,886 (GRCm39) missense probably benign
R6929:Ulk4 UTSW 9 120,903,081 (GRCm39) missense probably benign 0.02
R7069:Ulk4 UTSW 9 121,095,583 (GRCm39) missense probably benign 0.25
R7069:Ulk4 UTSW 9 121,087,876 (GRCm39) missense probably benign 0.01
R7293:Ulk4 UTSW 9 121,084,190 (GRCm39) missense probably damaging 1.00
R7299:Ulk4 UTSW 9 120,974,125 (GRCm39) missense probably benign 0.32
R7301:Ulk4 UTSW 9 120,974,125 (GRCm39) missense probably benign 0.32
R7337:Ulk4 UTSW 9 121,077,993 (GRCm39) missense probably benign 0.44
R7395:Ulk4 UTSW 9 121,084,178 (GRCm39) missense probably benign
R7423:Ulk4 UTSW 9 120,932,687 (GRCm39) missense possibly damaging 0.48
R7545:Ulk4 UTSW 9 120,970,904 (GRCm39) missense probably benign 0.00
R7753:Ulk4 UTSW 9 121,095,578 (GRCm39) critical splice donor site probably null
R7790:Ulk4 UTSW 9 121,092,734 (GRCm39) missense possibly damaging 0.70
R7791:Ulk4 UTSW 9 121,092,734 (GRCm39) missense possibly damaging 0.70
R7793:Ulk4 UTSW 9 121,092,734 (GRCm39) missense possibly damaging 0.70
R7834:Ulk4 UTSW 9 121,092,734 (GRCm39) missense possibly damaging 0.70
R7836:Ulk4 UTSW 9 120,873,885 (GRCm39) missense possibly damaging 0.72
R7960:Ulk4 UTSW 9 121,102,022 (GRCm39) missense probably damaging 1.00
R8087:Ulk4 UTSW 9 121,095,317 (GRCm39) missense probably damaging 0.99
R8203:Ulk4 UTSW 9 120,997,274 (GRCm39) missense probably damaging 0.96
R8246:Ulk4 UTSW 9 120,985,941 (GRCm39) makesense probably null
R8430:Ulk4 UTSW 9 121,086,144 (GRCm39) critical splice donor site probably null
R8841:Ulk4 UTSW 9 121,033,804 (GRCm39) missense probably damaging 1.00
R9014:Ulk4 UTSW 9 121,017,294 (GRCm39) missense probably benign 0.00
R9126:Ulk4 UTSW 9 121,090,988 (GRCm39) missense probably damaging 0.99
R9176:Ulk4 UTSW 9 120,974,128 (GRCm39) missense probably benign
R9235:Ulk4 UTSW 9 120,981,217 (GRCm39) missense probably benign 0.13
R9713:Ulk4 UTSW 9 120,873,862 (GRCm39) nonsense probably null
X0024:Ulk4 UTSW 9 121,021,819 (GRCm39) missense probably damaging 1.00
X0066:Ulk4 UTSW 9 121,091,672 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCAGTGATAAGCCACCTGG -3'
(R):5'- TGAAGCACAGTGTCCCTTC -3'

Sequencing Primer
(F):5'- CCACCTGGCCTAAAGTCAAG -3'
(R):5'- AGGGCCTCCATCCTTCCAG -3'
Posted On 2021-12-30