Incidental Mutation 'R9092:Ulk4'
ID 691072
Institutional Source Beutler Lab
Gene Symbol Ulk4
Ensembl Gene ENSMUSG00000040936
Gene Name unc-51-like kinase 4
Synonyms 4932415A06Rik
Accession Numbers

Genbank: NM_177589; MGI: 1921622

Is this an essential gene? Possibly non essential (E-score: 0.481) question?
Stock # R9092 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 120955351-121277197 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 121073937 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 1158 (I1158N)
Ref Sequence ENSEMBL: ENSMUSP00000057960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051479] [ENSMUST00000051565] [ENSMUST00000171061] [ENSMUST00000171923]
AlphaFold no structure available at present
Predicted Effect
SMART Domains Protein: ENSMUSP00000057960
Gene: ENSMUSG00000040936
AA Change: I1158N

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 277 9.9e-26 PFAM
Pfam:Pkinase 4 280 4.6e-49 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1161 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000051565
SMART Domains Protein: ENSMUSP00000054833
Gene: ENSMUSG00000040936

DomainStartEndE-ValueType
SCOP:d1jvpp_ 1 32 9e-6 SMART
Blast:S_TKc 4 45 2e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000171061
SMART Domains Protein: ENSMUSP00000129214
Gene: ENSMUSG00000040936

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 277 4.3e-26 PFAM
Pfam:Pkinase 4 280 2.1e-49 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000171923
AA Change: I1158N

PolyPhen 2 Score 0.652 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000131342
Gene: ENSMUSG00000040936
AA Change: I1158N

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 153 3.1e-14 PFAM
Pfam:Pkinase 4 280 4.9e-50 PFAM
Pfam:Pkinase_Tyr 165 277 6.1e-10 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1171 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the unc-51-like serine/threonine kinase (STK) family. Members of this protein family play a role in neuronal growth and endocytosis. The encoded protein is likely involved in neurite branching, neurite elongation and neuronal migration. Genome-wide association studies (GWAS) indicate an association of variations in this gene with blood pressure and hypertension. Sequence variations in this gene may also be be associated with psychiatric disorders, including schizophrenia and bipolar disorder. Pseudogenes associated with this gene have been identified and are located on chromosome 15. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for a null allele show reduced body size, hydrocephaly, dilated brain ventricles, otitis media, and premature death. Hypomorphic mice show partial corpus callosum aplasia, hydrocephaly, subcommissural organ and ependymal motile ciliary defects, aqueduct stenosis, and impaired CSF flow. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, other(1) Gene trapped(1)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016K19Rik A G 11: 76,003,061 D88G possibly damaging Het
Crtc3 T C 7: 80,589,880 M575V probably benign Het
Cux1 T A 5: 136,485,817 N22I probably damaging Het
Dcun1d2 G A 8: 13,257,935 R248W probably damaging Het
Dlc1 G T 8: 36,732,706 H7Q probably benign Het
Drd2 A G 9: 49,395,704 D30G probably benign Het
Duxf3 GCCC GCC 10: 58,231,122 probably null Het
E2f7 T C 10: 110,781,013 S705P probably benign Het
Ephb3 G A 16: 21,222,464 S977N probably benign Het
F13a1 T G 13: 36,906,019 D448A probably benign Het
Fam216b T C 14: 78,085,097 T56A possibly damaging Het
Fcho2 T C 13: 98,749,883 T408A probably benign Het
Flvcr1 A T 1: 191,008,167 V552E Het
Gab3 TCT TCTGCT X: 74,999,996 probably benign Het
Gab3 CTT CTTGTT X: 75,000,006 probably benign Het
Galnt15 A G 14: 32,058,239 K622E probably benign Het
Gjb3 GCCAGATGCGCCCA GCCAGATGCGCCCAGATGCGCCCA 4: 127,326,665 probably null Het
Gjb3 AGATGCGCCC AGATGCGCCCTGATGCGCCC 4: 127,326,668 probably null Het
Gjb3 A AGATGCGCCCG 4: 127,326,678 probably null Het
Gm5414 T G 15: 101,627,910 R93S probably benign Het
Il7r T A 15: 9,510,184 H261L probably benign Het
Itsn1 T A 16: 91,812,114 M250K possibly damaging Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Lrrc47 C A 4: 154,011,964 T72K possibly damaging Het
Map2k4 C A 11: 65,690,773 R371L probably benign Het
Mmrn2 T C 14: 34,396,630 F158L probably benign Het
Mtus1 A T 8: 41,002,438 L242Q probably damaging Het
Myo5a T C 9: 75,147,132 probably null Het
Noc3l T A 19: 38,810,043 K305I probably damaging Het
Olfr1208 T C 2: 88,896,977 T207A probably damaging Het
Pag1 T C 3: 9,699,788 T102A probably benign Het
Pam A G 1: 97,864,251 S482P probably benign Het
Pax1 T G 2: 147,362,367 W23G unknown Het
Pcdhgb1 T A 18: 37,680,936 V160D possibly damaging Het
Pdzph1 T C 17: 58,973,130 D719G probably damaging Het
Phlda1 T C 10: 111,506,613 L70S possibly damaging Het
Pikfyve G A 1: 65,244,400 R732K probably damaging Het
Pkd1 G T 17: 24,569,373 V702F possibly damaging Het
Pkhd1 A G 1: 20,562,362 Y610H probably benign Het
Pofut1 T G 2: 153,259,588 H87Q probably benign Het
Runx2 C A 17: 44,735,556 D109Y probably damaging Het
Serpina1b T A 12: 103,730,281 I290F probably benign Het
Sez6 G A 11: 77,974,295 E623K possibly damaging Het
Sh3tc1 T C 5: 35,716,977 N198S probably benign Het
Slc27a6 C A 18: 58,609,258 R515S probably benign Het
Sorbs3 C T 14: 70,207,555 V25I probably benign Het
Speg A G 1: 75,422,734 E2275G probably benign Het
Tmem161b C T 13: 84,292,384 T307I possibly damaging Het
Tmem30a T C 9: 79,771,299 D361G probably damaging Het
Tmprss11c T C 5: 86,237,636 T326A probably benign Het
Tpbg T C 9: 85,844,863 V295A possibly damaging Het
Utp20 C A 10: 88,768,817 A1739S probably benign Het
Utp20 T C 10: 88,775,318 N1379S probably damaging Het
Vmn1r66 T A 7: 10,274,183 I308F possibly damaging Het
Vmn2r101 A T 17: 19,589,545 T198S probably benign Het
Vps16 T C 2: 130,439,673 I318T probably damaging Het
Wdr11 T A 7: 129,624,727 W750R probably damaging Het
Zfp608 A G 18: 54,898,576 I764T probably benign Het
Zfp708 C A 13: 67,070,500 D420Y probably damaging Het
Other mutations in Ulk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Ulk4 APN 9 121168292 missense possibly damaging 0.48
IGL01345:Ulk4 APN 9 121208162 missense possibly damaging 0.48
IGL01432:Ulk4 APN 9 121266301 missense probably damaging 1.00
IGL01807:Ulk4 APN 9 121255185 missense probably damaging 1.00
IGL02139:Ulk4 APN 9 121141831 splice site probably null
IGL02266:Ulk4 APN 9 121081700 missense probably benign 0.10
IGL02511:Ulk4 APN 9 121188354 missense probably damaging 1.00
IGL02546:Ulk4 APN 9 121152307 nonsense probably null
IGL02687:Ulk4 APN 9 121192662 missense possibly damaging 0.89
IGL03220:Ulk4 APN 9 121145336 missense probably damaging 1.00
3-1:Ulk4 UTSW 9 121255171 missense probably benign 0.02
R0031:Ulk4 UTSW 9 121272982 missense probably damaging 1.00
R0433:Ulk4 UTSW 9 121044819 missense probably benign 0.27
R0513:Ulk4 UTSW 9 121152325 missense probably benign 0.13
R0524:Ulk4 UTSW 9 121252651 critical splice donor site probably null
R1268:Ulk4 UTSW 9 121257074 splice site probably benign
R1439:Ulk4 UTSW 9 121266258 missense possibly damaging 0.58
R1470:Ulk4 UTSW 9 121081656 missense probably benign 0.00
R1470:Ulk4 UTSW 9 121081656 missense probably benign 0.00
R1531:Ulk4 UTSW 9 121044775 missense probably damaging 0.97
R1595:Ulk4 UTSW 9 121044838 missense probably damaging 0.96
R1620:Ulk4 UTSW 9 121204805 missense possibly damaging 0.81
R1835:Ulk4 UTSW 9 121168184 missense probably null 1.00
R1966:Ulk4 UTSW 9 121257116 missense probably benign
R2129:Ulk4 UTSW 9 121152182 missense probably benign 0.03
R2329:Ulk4 UTSW 9 121272887 missense probably damaging 1.00
R2877:Ulk4 UTSW 9 121260039 missense probably benign 0.11
R2878:Ulk4 UTSW 9 121260039 missense probably benign 0.11
R3734:Ulk4 UTSW 9 121261989 missense probably benign 0.21
R3769:Ulk4 UTSW 9 121263700 missense probably benign 0.00
R4005:Ulk4 UTSW 9 121168199 missense possibly damaging 0.94
R4024:Ulk4 UTSW 9 121044849 missense possibly damaging 0.86
R4321:Ulk4 UTSW 9 121073996 missense probably benign 0.00
R4461:Ulk4 UTSW 9 121156884 missense possibly damaging 0.83
R4537:Ulk4 UTSW 9 121263638 nonsense probably null
R4542:Ulk4 UTSW 9 121263638 nonsense probably null
R4572:Ulk4 UTSW 9 121192764 missense probably damaging 1.00
R4647:Ulk4 UTSW 9 121141852 missense probably benign 0.15
R4712:Ulk4 UTSW 9 121244370 missense probably benign 0.23
R4730:Ulk4 UTSW 9 121263725 missense probably benign 0.05
R4731:Ulk4 UTSW 9 121263638 nonsense probably null
R4732:Ulk4 UTSW 9 121263638 nonsense probably null
R4733:Ulk4 UTSW 9 121263638 nonsense probably null
R4737:Ulk4 UTSW 9 121073872 nonsense probably null
R4781:Ulk4 UTSW 9 121103576 missense probably benign 0.00
R4860:Ulk4 UTSW 9 121250902 missense possibly damaging 0.68
R4926:Ulk4 UTSW 9 121258732 missense probably benign 0.00
R4990:Ulk4 UTSW 9 121192786 missense probably benign 0.01
R6056:Ulk4 UTSW 9 121272955 missense probably damaging 1.00
R6448:Ulk4 UTSW 9 121103630 missense probably damaging 0.99
R6546:Ulk4 UTSW 9 121141894 missense probably damaging 1.00
R6668:Ulk4 UTSW 9 121188342 missense probably damaging 1.00
R6915:Ulk4 UTSW 9 121258820 missense probably benign
R6929:Ulk4 UTSW 9 121074015 missense probably benign 0.02
R7069:Ulk4 UTSW 9 121258810 missense probably benign 0.01
R7069:Ulk4 UTSW 9 121266517 missense probably benign 0.25
R7293:Ulk4 UTSW 9 121255124 missense probably damaging 1.00
R7299:Ulk4 UTSW 9 121145059 missense probably benign 0.32
R7301:Ulk4 UTSW 9 121145059 missense probably benign 0.32
R7337:Ulk4 UTSW 9 121248927 missense probably benign 0.44
R7395:Ulk4 UTSW 9 121255112 missense probably benign
R7423:Ulk4 UTSW 9 121103621 missense possibly damaging 0.48
R7545:Ulk4 UTSW 9 121141838 missense probably benign 0.00
R7753:Ulk4 UTSW 9 121266512 critical splice donor site probably null
R7790:Ulk4 UTSW 9 121263668 missense possibly damaging 0.70
R7791:Ulk4 UTSW 9 121263668 missense possibly damaging 0.70
R7793:Ulk4 UTSW 9 121263668 missense possibly damaging 0.70
R7834:Ulk4 UTSW 9 121263668 missense possibly damaging 0.70
R7836:Ulk4 UTSW 9 121044819 missense possibly damaging 0.72
R7960:Ulk4 UTSW 9 121272956 missense probably damaging 1.00
R8087:Ulk4 UTSW 9 121266251 missense probably damaging 0.99
R8203:Ulk4 UTSW 9 121168208 missense probably damaging 0.96
R8246:Ulk4 UTSW 9 121156875 makesense probably null
R8430:Ulk4 UTSW 9 121257078 critical splice donor site probably null
R8841:Ulk4 UTSW 9 121204738 missense probably damaging 1.00
R9014:Ulk4 UTSW 9 121188228 missense probably benign 0.00
R9126:Ulk4 UTSW 9 121261922 missense probably damaging 0.99
R9176:Ulk4 UTSW 9 121145062 missense probably benign
R9235:Ulk4 UTSW 9 121152151 missense probably benign 0.13
X0024:Ulk4 UTSW 9 121192753 missense probably damaging 1.00
X0066:Ulk4 UTSW 9 121262606 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCAGTGATAAGCCACCTGG -3'
(R):5'- TGAAGCACAGTGTCCCTTC -3'

Sequencing Primer
(F):5'- CCACCTGGCCTAAAGTCAAG -3'
(R):5'- AGGGCCTCCATCCTTCCAG -3'
Posted On 2021-12-30