Incidental Mutation 'R9092:Pdzph1'
ID 691098
Institutional Source Beutler Lab
Gene Symbol Pdzph1
Ensembl Gene ENSMUSG00000024227
Gene Name PDZ and pleckstrin homology domains 1
Synonyms 2610034M16Rik
MMRRC Submission 068908-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.084) question?
Stock # R9092 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 59185803-59298344 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 59280125 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 719 (D719G)
Ref Sequence ENSEMBL: ENSMUSP00000025064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025064]
AlphaFold Q8BGR1
Predicted Effect probably damaging
Transcript: ENSMUST00000025064
AA Change: D719G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000025064
Gene: ENSMUSG00000024227
AA Change: D719G

DomainStartEndE-ValueType
Blast:PDZ 780 844 6e-20 BLAST
PDZ 915 984 3.31e-15 SMART
PH 993 1096 9.4e-19 SMART
PH 1120 1218 2.83e-13 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 93% (56/60)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Chl1 T C 6: 103,645,815 (GRCm39) probably benign Het
Crtc3 T C 7: 80,239,628 (GRCm39) M575V probably benign Het
Cux1 T A 5: 136,514,671 (GRCm39) N22I probably damaging Het
Dcun1d2 G A 8: 13,307,935 (GRCm39) R248W probably damaging Het
Dlc1 G T 8: 37,199,860 (GRCm39) H7Q probably benign Het
Drd2 A G 9: 49,307,004 (GRCm39) D30G probably benign Het
Duxf3 GCCC GCC 10: 58,066,944 (GRCm39) probably null Het
E2f7 T C 10: 110,616,874 (GRCm39) S705P probably benign Het
Ephb3 G A 16: 21,041,214 (GRCm39) S977N probably benign Het
F13a1 T G 13: 37,089,993 (GRCm39) D448A probably benign Het
Fam216b T C 14: 78,322,537 (GRCm39) T56A possibly damaging Het
Fcho2 T C 13: 98,886,391 (GRCm39) T408A probably benign Het
Flvcr1 A T 1: 190,740,364 (GRCm39) V552E Het
Gab3 CTT CTTGTT X: 74,043,612 (GRCm39) probably benign Het
Gab3 TCT TCTGCT X: 74,043,602 (GRCm39) probably benign Het
Galnt15 A G 14: 31,780,196 (GRCm39) K622E probably benign Het
Gjb3 GCCAGATGCGCCCA GCCAGATGCGCCCAGATGCGCCCA 4: 127,220,458 (GRCm39) probably null Het
Gjb3 A AGATGCGCCCG 4: 127,220,471 (GRCm39) probably null Het
Gm5414 T G 15: 101,536,345 (GRCm39) R93S probably benign Het
Gtf2i A G 5: 134,318,241 (GRCm39) *87Q probably null Het
Il7r T A 15: 9,510,270 (GRCm39) H261L probably benign Het
Itsn1 T A 16: 91,609,002 (GRCm39) M250K possibly damaging Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,079,903 (GRCm39) probably benign Het
Liat1 A G 11: 75,893,887 (GRCm39) D88G possibly damaging Het
Lrrc47 C A 4: 154,096,421 (GRCm39) T72K possibly damaging Het
Map2k4 C A 11: 65,581,599 (GRCm39) R371L probably benign Het
Mmrn2 T C 14: 34,118,587 (GRCm39) F158L probably benign Het
Mtus1 A T 8: 41,455,475 (GRCm39) L242Q probably damaging Het
Myo5a T C 9: 75,054,414 (GRCm39) probably null Het
Noc3l T A 19: 38,798,487 (GRCm39) K305I probably damaging Het
Or4p8 T C 2: 88,727,321 (GRCm39) T207A probably damaging Het
Pag1 T C 3: 9,764,848 (GRCm39) T102A probably benign Het
Pam A G 1: 97,791,976 (GRCm39) S482P probably benign Het
Pax1 T G 2: 147,204,287 (GRCm39) W23G unknown Het
Pcdhgb1 T A 18: 37,813,989 (GRCm39) V160D possibly damaging Het
Phlda1 T C 10: 111,342,474 (GRCm39) L70S possibly damaging Het
Pikfyve G A 1: 65,283,559 (GRCm39) R732K probably damaging Het
Pkd1 G T 17: 24,788,347 (GRCm39) V702F possibly damaging Het
Pkhd1 A G 1: 20,632,586 (GRCm39) Y610H probably benign Het
Pofut1 T G 2: 153,101,508 (GRCm39) H87Q probably benign Het
Runx2 C A 17: 45,046,443 (GRCm39) D109Y probably damaging Het
Serpina1b T A 12: 103,696,540 (GRCm39) I290F probably benign Het
Sez6 G A 11: 77,865,121 (GRCm39) E623K possibly damaging Het
Sh3tc1 T C 5: 35,874,321 (GRCm39) N198S probably benign Het
Slc27a6 C A 18: 58,742,330 (GRCm39) R515S probably benign Het
Sorbs3 C T 14: 70,445,004 (GRCm39) V25I probably benign Het
Speg A G 1: 75,399,378 (GRCm39) E2275G probably benign Het
Tmem161b C T 13: 84,440,503 (GRCm39) T307I possibly damaging Het
Tmem30a T C 9: 79,678,581 (GRCm39) D361G probably damaging Het
Tmprss11c T C 5: 86,385,495 (GRCm39) T326A probably benign Het
Tpbg T C 9: 85,726,916 (GRCm39) V295A possibly damaging Het
Ulk4 A T 9: 120,903,003 (GRCm39) I1158N Het
Utp20 C A 10: 88,604,679 (GRCm39) A1739S probably benign Het
Utp20 T C 10: 88,611,180 (GRCm39) N1379S probably damaging Het
Vmn1r66 T A 7: 10,008,110 (GRCm39) I308F possibly damaging Het
Vmn2r101 A T 17: 19,809,807 (GRCm39) T198S probably benign Het
Vps16 T C 2: 130,281,593 (GRCm39) I318T probably damaging Het
Wdr11 T A 7: 129,226,451 (GRCm39) W750R probably damaging Het
Zfp608 A G 18: 55,031,648 (GRCm39) I764T probably benign Het
Zfp708 C A 13: 67,218,564 (GRCm39) D420Y probably damaging Het
Other mutations in Pdzph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Pdzph1 APN 17 59,281,791 (GRCm39) missense possibly damaging 0.46
IGL00644:Pdzph1 APN 17 59,195,105 (GRCm39) missense probably benign
IGL01413:Pdzph1 APN 17 59,186,147 (GRCm39) missense possibly damaging 0.82
IGL01530:Pdzph1 APN 17 59,229,710 (GRCm39) missense probably damaging 1.00
IGL02089:Pdzph1 APN 17 59,274,334 (GRCm39) missense possibly damaging 0.92
IGL02201:Pdzph1 APN 17 59,274,506 (GRCm39) splice site probably benign
IGL02548:Pdzph1 APN 17 59,280,386 (GRCm39) missense probably benign 0.10
IGL02618:Pdzph1 APN 17 59,186,068 (GRCm39) utr 3 prime probably benign
IGL02660:Pdzph1 APN 17 59,187,642 (GRCm39) missense probably damaging 0.97
IGL02749:Pdzph1 APN 17 59,239,478 (GRCm39) missense possibly damaging 0.95
IGL02876:Pdzph1 APN 17 59,281,064 (GRCm39) missense probably benign
IGL03304:Pdzph1 APN 17 59,187,641 (GRCm39) missense probably damaging 1.00
IGL03336:Pdzph1 APN 17 59,281,229 (GRCm39) missense probably benign 0.00
R0008:Pdzph1 UTSW 17 59,229,756 (GRCm39) splice site probably benign
R0008:Pdzph1 UTSW 17 59,229,756 (GRCm39) splice site probably benign
R0498:Pdzph1 UTSW 17 59,280,825 (GRCm39) missense probably benign 0.00
R0553:Pdzph1 UTSW 17 59,229,722 (GRCm39) missense probably damaging 1.00
R0594:Pdzph1 UTSW 17 59,261,474 (GRCm39) missense possibly damaging 0.76
R1306:Pdzph1 UTSW 17 59,239,427 (GRCm39) missense possibly damaging 0.90
R1370:Pdzph1 UTSW 17 59,281,082 (GRCm39) missense possibly damaging 0.73
R1382:Pdzph1 UTSW 17 59,281,742 (GRCm39) missense probably benign 0.10
R1463:Pdzph1 UTSW 17 59,239,440 (GRCm39) missense probably damaging 1.00
R1766:Pdzph1 UTSW 17 59,280,747 (GRCm39) missense probably benign 0.16
R1773:Pdzph1 UTSW 17 59,281,808 (GRCm39) missense probably damaging 0.98
R1862:Pdzph1 UTSW 17 59,229,578 (GRCm39) missense probably damaging 1.00
R2070:Pdzph1 UTSW 17 59,281,092 (GRCm39) missense probably benign 0.04
R2071:Pdzph1 UTSW 17 59,281,092 (GRCm39) missense probably benign 0.04
R2229:Pdzph1 UTSW 17 59,239,407 (GRCm39) splice site probably benign
R2264:Pdzph1 UTSW 17 59,195,162 (GRCm39) critical splice acceptor site probably null
R2334:Pdzph1 UTSW 17 59,229,644 (GRCm39) missense probably damaging 1.00
R3750:Pdzph1 UTSW 17 59,280,331 (GRCm39) nonsense probably null
R4700:Pdzph1 UTSW 17 59,281,541 (GRCm39) missense probably damaging 0.98
R4847:Pdzph1 UTSW 17 59,280,525 (GRCm39) missense possibly damaging 0.95
R4868:Pdzph1 UTSW 17 59,281,751 (GRCm39) missense probably benign 0.00
R5130:Pdzph1 UTSW 17 59,229,604 (GRCm39) missense probably damaging 1.00
R5329:Pdzph1 UTSW 17 59,281,875 (GRCm39) missense probably damaging 1.00
R5574:Pdzph1 UTSW 17 59,280,942 (GRCm39) missense probably benign 0.00
R5770:Pdzph1 UTSW 17 59,186,146 (GRCm39) missense probably damaging 1.00
R5795:Pdzph1 UTSW 17 59,192,862 (GRCm39) missense possibly damaging 0.47
R5842:Pdzph1 UTSW 17 59,281,407 (GRCm39) missense possibly damaging 0.64
R5851:Pdzph1 UTSW 17 59,280,741 (GRCm39) missense probably benign 0.02
R6158:Pdzph1 UTSW 17 59,280,622 (GRCm39) missense probably damaging 0.96
R6813:Pdzph1 UTSW 17 59,281,431 (GRCm39) missense probably benign 0.08
R7022:Pdzph1 UTSW 17 59,281,121 (GRCm39) missense probably benign 0.02
R7395:Pdzph1 UTSW 17 59,186,154 (GRCm39) missense possibly damaging 0.85
R7525:Pdzph1 UTSW 17 59,274,336 (GRCm39) missense possibly damaging 0.73
R7944:Pdzph1 UTSW 17 59,239,455 (GRCm39) missense probably damaging 1.00
R7945:Pdzph1 UTSW 17 59,239,455 (GRCm39) missense probably damaging 1.00
R7992:Pdzph1 UTSW 17 59,186,105 (GRCm39) missense possibly damaging 0.71
R8016:Pdzph1 UTSW 17 59,239,476 (GRCm39) missense probably damaging 0.98
R8116:Pdzph1 UTSW 17 59,282,138 (GRCm39) missense probably benign 0.01
R8273:Pdzph1 UTSW 17 59,280,009 (GRCm39) missense probably benign 0.00
R8523:Pdzph1 UTSW 17 59,191,008 (GRCm39) missense probably damaging 1.00
R8819:Pdzph1 UTSW 17 59,187,715 (GRCm39) nonsense probably null
R8820:Pdzph1 UTSW 17 59,187,715 (GRCm39) nonsense probably null
R8839:Pdzph1 UTSW 17 59,257,237 (GRCm39) missense probably benign 0.02
R8871:Pdzph1 UTSW 17 59,195,033 (GRCm39) missense probably damaging 1.00
R8898:Pdzph1 UTSW 17 59,281,334 (GRCm39) missense probably benign 0.00
R8959:Pdzph1 UTSW 17 59,281,599 (GRCm39) missense probably damaging 0.97
R9043:Pdzph1 UTSW 17 59,280,535 (GRCm39) missense probably benign 0.05
R9083:Pdzph1 UTSW 17 59,261,395 (GRCm39) missense possibly damaging 0.94
R9682:Pdzph1 UTSW 17 59,257,262 (GRCm39) missense probably damaging 1.00
R9757:Pdzph1 UTSW 17 59,281,898 (GRCm39) nonsense probably null
R9774:Pdzph1 UTSW 17 59,281,751 (GRCm39) missense probably benign 0.00
X0028:Pdzph1 UTSW 17 59,186,116 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTCTGAGGTGACAACAGTATG -3'
(R):5'- AACCCTAGAGAGTCGACCAG -3'

Sequencing Primer
(F):5'- CAACAGTATGTCCACAGGGTG -3'
(R):5'- CTAGAGAGTCGACCAGCTATCTG -3'
Posted On 2021-12-30