Incidental Mutation 'R9093:Maip1'
ID 691106
Institutional Source Beutler Lab
Gene Symbol Maip1
Ensembl Gene ENSMUSG00000025971
Gene Name matrix AAA peptidase interacting protein 1
Synonyms 9430016H08Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.080) question?
Stock # R9093 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 57445487-57457112 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 57446311 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 127 (Y127F)
Ref Sequence ENSEMBL: ENSMUSP00000027114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027114] [ENSMUST00000079998] [ENSMUST00000160118] [ENSMUST00000160837] [ENSMUST00000162686]
AlphaFold Q8BHE8
Predicted Effect possibly damaging
Transcript: ENSMUST00000027114
AA Change: Y127F

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000027114
Gene: ENSMUSG00000025971
AA Change: Y127F

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
low complexity region 82 93 N/A INTRINSIC
low complexity region 98 109 N/A INTRINSIC
Blast:Tim44 131 210 3e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000079998
SMART Domains Protein: ENSMUSP00000078912
Gene: ENSMUSG00000048495

DomainStartEndE-ValueType
PDB:3AL6|D 1 71 3e-39 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000160118
SMART Domains Protein: ENSMUSP00000125386
Gene: ENSMUSG00000048495

DomainStartEndE-ValueType
PDB:3AL6|D 1 71 1e-38 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000160837
SMART Domains Protein: ENSMUSP00000128576
Gene: ENSMUSG00000048495

DomainStartEndE-ValueType
JmjC 103 255 2.25e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162686
SMART Domains Protein: ENSMUSP00000125427
Gene: ENSMUSG00000048495

DomainStartEndE-ValueType
JmjC 105 265 5.8e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 97% (76/78)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,069,513 (GRCm39) V1294E probably damaging Het
Ada C T 2: 163,577,308 (GRCm39) G60D probably benign Het
Aff3 G T 1: 38,291,738 (GRCm39) R390S possibly damaging Het
Aldh3b3 T A 19: 4,013,959 (GRCm39) N53K possibly damaging Het
Ankrd36 G A 11: 5,589,132 (GRCm39) M410I probably benign Het
Ap2b1 T A 11: 83,215,395 (GRCm39) I113N probably damaging Het
Art5 G T 7: 101,747,396 (GRCm39) H128N probably benign Het
Calhm2 A C 19: 47,121,599 (GRCm39) L190R probably benign Het
Catsperg1 G C 7: 28,884,152 (GRCm39) T987R probably damaging Het
Cdh18 A T 15: 23,474,064 (GRCm39) I645F probably damaging Het
Cenpe C T 3: 134,945,641 (GRCm39) Q1052* probably null Het
Cfap221 G T 1: 119,863,856 (GRCm39) Q563K probably damaging Het
Cfap54 T A 10: 92,651,770 (GRCm39) E3093D probably benign Het
Chd4 A G 6: 125,090,974 (GRCm39) M1186V probably benign Het
Chst15 A T 7: 131,870,646 (GRCm39) probably null Het
Clca3a2 T C 3: 144,781,481 (GRCm39) T688A probably benign Het
Cmtm1 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG 8: 105,036,334 (GRCm39) probably null Het
Cul1 T A 6: 47,495,173 (GRCm39) N518K probably damaging Het
E230025N22Rik G T 18: 36,821,952 (GRCm39) L247I possibly damaging Het
Eno4 A T 19: 58,941,600 (GRCm39) K174* probably null Het
Enpp3 G A 10: 24,671,702 (GRCm39) P431S probably benign Het
Fbh1 T A 2: 11,764,801 (GRCm39) Q444H probably damaging Het
Fbxo31 G A 8: 122,281,136 (GRCm39) R337C probably damaging Het
Fbxw14 A G 9: 109,105,250 (GRCm39) I305T probably benign Het
Fhip1b T A 7: 105,034,599 (GRCm39) T408S probably damaging Het
Gas2 T A 7: 51,602,969 (GRCm39) C216S probably damaging Het
Gjb3 GCCAGATGCGCCCA GCCAGATGCGCCCAGATGCGCCCA 4: 127,220,458 (GRCm39) probably null Het
Glp2r T A 11: 67,621,459 (GRCm39) R344* probably null Het
Gm17430 A G 18: 9,726,640 (GRCm39) Y11H probably damaging Het
Gyg1 T A 3: 20,176,901 (GRCm39) D363V probably damaging Het
H2bc18 G A 3: 96,177,290 (GRCm39) A75T probably benign Het
Hectd4 A G 5: 121,411,677 (GRCm39) N451S probably benign Het
Hif1a T C 12: 73,979,111 (GRCm39) Y212H probably benign Het
Hoxd11 A T 2: 74,514,482 (GRCm39) *337C probably null Het
Kif24 A G 4: 41,428,691 (GRCm39) F90L probably benign Het
Klhl20 A T 1: 160,923,231 (GRCm39) C497* probably null Het
Loxl1 C A 9: 58,219,224 (GRCm39) A316S probably benign Het
Lrig3 C T 10: 125,845,950 (GRCm39) P793L possibly damaging Het
Macc1 A G 12: 119,410,561 (GRCm39) D443G probably benign Het
Mrm2 A T 5: 140,314,427 (GRCm39) F136Y probably benign Het
Nasp G T 4: 116,468,017 (GRCm39) L323I probably benign Het
Ndufb8 A T 19: 44,538,823 (GRCm39) L166Q probably damaging Het
Nid2 C T 14: 19,858,009 (GRCm39) T1274I Het
Nup210 T A 6: 91,066,872 (GRCm39) T160S probably benign Het
Nutm2 A G 13: 50,628,964 (GRCm39) K676R probably damaging Het
Odad1 G A 7: 45,596,965 (GRCm39) V431I possibly damaging Het
Or10a3n T C 7: 108,493,609 (GRCm39) R7G probably benign Het
Or2a20 A G 6: 43,194,500 (GRCm39) T218A probably benign Het
Or56b1b A T 7: 108,164,454 (GRCm39) C183S probably damaging Het
Or5ak20 T A 2: 85,183,852 (GRCm39) R139S probably benign Het
Or7g33 A G 9: 19,448,914 (GRCm39) V104A probably benign Het
Or8b9 A T 9: 37,766,294 (GRCm39) Y60F probably damaging Het
Or9m1 A T 2: 87,733,480 (GRCm39) I180N probably benign Het
Pcdhga12 C A 18: 37,899,931 (GRCm39) N254K possibly damaging Het
Pm20d1 G T 1: 131,743,753 (GRCm39) V473F probably benign Het
Pou2af2 G A 9: 51,201,516 (GRCm39) P180L possibly damaging Het
Rab11fip1 A G 8: 27,633,355 (GRCm39) V596A probably damaging Het
Rapgef6 C T 11: 54,487,912 (GRCm39) Q13* probably null Het
Rasef T C 4: 73,698,583 (GRCm39) D26G probably benign Het
Rbfox2 A T 15: 77,190,658 (GRCm39) V29E probably benign Het
Recql4 G A 15: 76,589,685 (GRCm39) P787S unknown Het
Rnf19a A C 15: 36,253,450 (GRCm39) probably benign Het
Rnf214 A G 9: 45,811,054 (GRCm39) I203T probably damaging Het
Rnmt A C 18: 68,451,146 (GRCm39) E396D probably benign Het
Scn4a G A 11: 106,210,638 (GRCm39) S1793L probably benign Het
Sdcbp G T 4: 6,386,709 (GRCm39) probably null Het
Slfn3 A G 11: 83,103,948 (GRCm39) N273S probably damaging Het
Slk A G 19: 47,603,883 (GRCm39) D209G Het
Tent5b A G 4: 133,214,352 (GRCm39) T408A probably damaging Het
Tmem135 T A 7: 88,797,204 (GRCm39) M351L probably benign Het
Tmem64 A G 4: 15,266,391 (GRCm39) H147R probably benign Het
Tnfsf4 T C 1: 161,244,629 (GRCm39) L106P probably damaging Het
Tonsl A T 15: 76,515,270 (GRCm39) C1039S probably damaging Het
Ube4a A T 9: 44,864,462 (GRCm39) F44I possibly damaging Het
Vmn2r40 A G 7: 8,911,172 (GRCm39) L707P Het
Vmn2r87 G A 10: 130,308,165 (GRCm39) T691I probably benign Het
Wbp11 A T 6: 136,803,044 (GRCm39) S7T possibly damaging Het
Zfp386 C A 12: 116,023,878 (GRCm39) S532* probably null Het
Other mutations in Maip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02732:Maip1 APN 1 57,449,114 (GRCm39) missense probably damaging 1.00
IGL03064:Maip1 APN 1 57,446,359 (GRCm39) missense probably damaging 1.00
R0403:Maip1 UTSW 1 57,446,355 (GRCm39) missense probably benign 0.14
R0411:Maip1 UTSW 1 57,454,852 (GRCm39) missense probably damaging 1.00
R0732:Maip1 UTSW 1 57,450,994 (GRCm39) missense probably damaging 1.00
R1569:Maip1 UTSW 1 57,452,554 (GRCm39) splice site probably benign
R1620:Maip1 UTSW 1 57,449,144 (GRCm39) critical splice donor site probably null
R2830:Maip1 UTSW 1 57,454,822 (GRCm39) missense possibly damaging 0.53
R4574:Maip1 UTSW 1 57,452,404 (GRCm39) missense possibly damaging 0.90
R4605:Maip1 UTSW 1 57,450,891 (GRCm39) missense probably benign 0.00
R5082:Maip1 UTSW 1 57,451,010 (GRCm39) critical splice donor site probably null
R5178:Maip1 UTSW 1 57,454,849 (GRCm39) missense probably benign 0.06
R5262:Maip1 UTSW 1 57,446,131 (GRCm39) missense probably damaging 0.96
R5883:Maip1 UTSW 1 57,446,260 (GRCm39) missense probably damaging 0.99
R6837:Maip1 UTSW 1 57,454,891 (GRCm39) makesense probably null
R7445:Maip1 UTSW 1 57,446,190 (GRCm39) missense possibly damaging 0.79
R7687:Maip1 UTSW 1 57,451,003 (GRCm39) missense probably damaging 0.98
R8408:Maip1 UTSW 1 57,449,102 (GRCm39) missense probably damaging 1.00
R8956:Maip1 UTSW 1 57,450,961 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAATTTGCTGCCTGTGC -3'
(R):5'- TACCACGGGTCGCAATGAAG -3'

Sequencing Primer
(F):5'- TACACTCGGGCCTGGACAAG -3'
(R):5'- CACGGGTCGCAATGAAGAAACTTC -3'
Posted On 2021-12-30