Mutagenetix > Incidental Mutation

Incidental Mutation 'R9093:Abcb11'

691112

Institutional Source

Beutler Lab

Gene Symbol

Abcb11

Ensembl Gene

ENSMUSG00000027048

Gene Name

ATP-binding cassette, sub-family B (MDR/TAP), member 11

Synonyms

PFIC2, Bsep, PGY4, Lith1, ABC16, sister of P-glycoprotein

MMRRC Submission

Accession Numbers

Genbank: NM_021022; MGI: 1351619

Essential gene?

Possibly essential (E-score: 0.602) question?

Stock #

R9093 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

69238282-69342616 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 69239169 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 1294 (V1294E)

Ref Sequence

ENSEMBL: ENSMUSP00000099771 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102709] [ENSMUST00000102710] [ENSMUST00000180142]

AlphaFold

Q9QY30

Predicted Effect

probably damaging
Transcript: ENSMUST00000102709
AA Change: V1294E

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000099770
Gene: ENSMUSG00000027048
AA Change: V1294E

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	62	373	1.3e-65	PFAM
AAA	447	639	1.65e-17	SMART
Pfam:ABC_membrane	755	1031	2.7e-55	PFAM
AAA	1105	1299	1.9e-17	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000102710
AA Change: V1294E

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000099771
Gene: ENSMUSG00000027048
AA Change: V1294E

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	62	371	1.7e-72	PFAM
AAA	447	639	1.65e-17	SMART
Pfam:ABC_membrane	755	1029	3.2e-59	PFAM
AAA	1105	1299	1.9e-17	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000180142
AA Change: V1294E

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000137017
Gene: ENSMUSG00000027048
AA Change: V1294E

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	62	371	1.4e-72	PFAM
AAA	447	639	1.65e-17	SMART
Pfam:ABC_membrane	755	1029	2.5e-59	PFAM
AAA	1105	1299	1.9e-17	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

97% (76/78)

MGI Phenotype

FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. The protein encoded by this gene is the major canalicular bile salt transporter in humans and mice. Mutations in the human gene cause a form of progressive familial intrahepatic cholestases which are a group of inherited disorders with severe cholestatic liver disease from early infancy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display intrahepatic cholestasis. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810046K07Rik	G	A	9: 51,290,216	P180L	possibly damaging	Het
Ada	C	T	2: 163,735,388	G60D	probably benign	Het
Aff3	G	T	1: 38,252,657	R390S	possibly damaging	Het
Aldh3b3	T	A	19: 3,963,959	N53K	possibly damaging	Het
Ankrd36	G	A	11: 5,639,132	M410I	probably benign	Het
Ap2b1	T	A	11: 83,324,569	I113N	probably damaging	Het
Art5	G	T	7: 102,098,189	H128N	probably benign	Het
Calhm2	A	C	19: 47,133,160	L190R	probably benign	Het
Catsperg1	G	C	7: 29,184,727	T987R	probably damaging	Het
Ccdc114	G	A	7: 45,947,541	V431I	possibly damaging	Het
Cdh18	A	T	15: 23,473,978	I645F	probably damaging	Het
Cenpe	C	T	3: 135,239,880	Q1052*	probably null	Het
Cfap221	G	T	1: 119,936,126	Q563K	probably damaging	Het
Cfap54	T	A	10: 92,815,908	E3093D	probably benign	Het
Chd4	A	G	6: 125,114,011	M1186V	probably benign	Het
Chst15	A	T	7: 132,268,917		probably null	Het
Clca2	T	C	3: 145,075,720	T688A	probably benign	Het
Cmtm1	TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG	TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG	8: 104,309,702		probably null	Het
Cul1	T	A	6: 47,518,239	N518K	probably damaging	Het
E230025N22Rik	G	T	18: 36,688,899	L247I	possibly damaging	Het
Eno4	A	T	19: 58,953,168	K174*	probably null	Het
Enpp3	G	A	10: 24,795,804	P431S	probably benign	Het
Fam160a2	T	A	7: 105,385,392	T408S	probably damaging	Het
Fam46b	A	G	4: 133,487,041	T408A	probably damaging	Het
Fbxo18	T	A	2: 11,759,990	Q444H	probably damaging	Het
Fbxo31	G	A	8: 121,554,397	R337C	probably damaging	Het
Fbxw14	A	G	9: 109,276,182	I305T	probably benign	Het
Gas2	T	A	7: 51,953,221	C216S	probably damaging	Het
Gjb3	GCCAGATGCGCCCA	GCCAGATGCGCCCAGATGCGCCCA	4: 127,326,665		probably null	Het
Glp2r	T	A	11: 67,730,633	R344*	probably null	Het
Gm17430	A	G	18: 9,726,640	Y11H	probably damaging	Het
Gyg	T	A	3: 20,122,737	D363V	probably damaging	Het
Hectd4	A	G	5: 121,273,614	N451S	probably benign	Het
Hif1a	T	C	12: 73,932,337	Y212H	probably benign	Het
Hist2h2bb	G	A	3: 96,269,974	A75T	probably benign	Het
Hoxd11	A	T	2: 74,684,138	*337C	probably null	Het
Kif24	A	G	4: 41,428,691	F90L	probably benign	Het
Klhl20	A	T	1: 161,095,661	C497*	probably null	Het
Loxl1	C	A	9: 58,311,941	A316S	probably benign	Het
Lrig3	C	T	10: 126,010,081	P793L	possibly damaging	Het
Macc1	A	G	12: 119,446,826	D443G	probably benign	Het
Maip1	A	T	1: 57,407,152	Y127F	possibly damaging	Het
Mrm2	A	T	5: 140,328,672	F136Y	probably benign	Het
Nasp	G	T	4: 116,610,820	L323I	probably benign	Het
Ndufb8	A	T	19: 44,550,384	L166Q	probably damaging	Het
Nid2	C	T	14: 19,807,941	T1274I		Het
Nup210	T	A	6: 91,089,890	T160S	probably benign	Het
Nutm2	A	G	13: 50,474,928	K676R	probably damaging	Het
Olfr1154	A	T	2: 87,903,136	I180N	probably benign	Het
Olfr434	A	G	6: 43,217,566	T218A	probably benign	Het
Olfr504	A	T	7: 108,565,247	C183S	probably damaging	Het
Olfr519	T	C	7: 108,894,402	R7G	probably benign	Het
Olfr853	A	G	9: 19,537,618	V104A	probably benign	Het
Olfr877	A	T	9: 37,854,998	Y60F	probably damaging	Het
Olfr988	T	A	2: 85,353,508	R139S	probably benign	Het
Pcdhga12	C	A	18: 37,766,878	N254K	possibly damaging	Het
Pm20d1	G	T	1: 131,816,015	V473F	probably benign	Het
Rab11fip1	A	G	8: 27,143,327	V596A	probably damaging	Het
Rapgef6	C	T	11: 54,597,086	Q13*	probably null	Het
Rasef	T	C	4: 73,780,346	D26G	probably benign	Het
Rbfox2	A	T	15: 77,306,458	V29E	probably benign	Het
Recql4	G	A	15: 76,705,485	P787S	unknown	Het
Rnf19a	A	C	15: 36,253,304		probably benign	Het
Rnf214	A	G	9: 45,899,756	I203T	probably damaging	Het
Rnmt	A	C	18: 68,318,075	E396D	probably benign	Het
Scn4a	G	A	11: 106,319,812	S1793L	probably benign	Het
Sdcbp	G	T	4: 6,386,709		probably null	Het
Slfn3	A	G	11: 83,213,122	N273S	probably damaging	Het
Slk	A	G	19: 47,615,444	D209G		Het
Tmem135	T	A	7: 89,147,996	M351L	probably benign	Het
Tmem64	A	G	4: 15,266,391	H147R	probably benign	Het
Tnfsf4	T	C	1: 161,417,058	L106P	probably damaging	Het
Tonsl	A	T	15: 76,631,070	C1039S	probably damaging	Het
Ube4a	A	T	9: 44,953,164	F44I	possibly damaging	Het
Vmn2r40	A	G	7: 8,908,173	L707P		Het
Vmn2r87	G	A	10: 130,472,296	T691I	probably benign	Het
Wbp11	A	T	6: 136,826,046	S7T	possibly damaging	Het
Zfp386	C	A	12: 116,060,258	S532*	probably null	Het

Other mutations in Abcb11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00544:Abcb11	APN	2	69284681	missense	possibly damaging	0.90
IGL01407:Abcb11	APN	2	69245944	missense	probably damaging	1.00
IGL01583:Abcb11	APN	2	69296409	missense	possibly damaging	0.81
IGL01813:Abcb11	APN	2	69287592	splice site	probably benign
IGL01885:Abcb11	APN	2	69287627	missense	probably damaging	1.00
IGL01937:Abcb11	APN	2	69287612	missense	probably damaging	1.00
IGL02058:Abcb11	APN	2	69243498	missense	probably damaging	0.98
IGL02117:Abcb11	APN	2	69323825	splice site	probably benign
IGL02119:Abcb11	APN	2	69328000	critical splice acceptor site	probably null
IGL02120:Abcb11	APN	2	69257310	missense	probably damaging	1.00
IGL02158:Abcb11	APN	2	69299925	missense	probably damaging	0.96
IGL02212:Abcb11	APN	2	69248889	missense	probably damaging	0.97
IGL02306:Abcb11	APN	2	69265457	nonsense	probably null
IGL02505:Abcb11	APN	2	69245761	missense	probably damaging	1.00
IGL02538:Abcb11	APN	2	69306605	missense	possibly damaging	0.67
IGL02793:Abcb11	APN	2	69291949	missense	possibly damaging	0.90
IGL02863:Abcb11	APN	2	69284682	missense	probably damaging	0.99
IGL02875:Abcb11	APN	2	69291949	missense	possibly damaging	0.90
IGL03164:Abcb11	APN	2	69291999	nonsense	probably null
IGL03181:Abcb11	APN	2	69328008	intron	probably benign
3-1:Abcb11	UTSW	2	69327993	missense	probably benign	0.00
FR4737:Abcb11	UTSW	2	69243518	missense	probably damaging	0.97
R0031:Abcb11	UTSW	2	69285308	missense	probably damaging	1.00
R0398:Abcb11	UTSW	2	69286666	missense	probably null	0.82
R0413:Abcb11	UTSW	2	69328011	intron	probably benign
R0437:Abcb11	UTSW	2	69257295	missense	probably damaging	1.00
R0496:Abcb11	UTSW	2	69277884	splice site	probably benign
R0646:Abcb11	UTSW	2	69285283	missense	probably damaging	1.00
R0669:Abcb11	UTSW	2	69329318	missense	probably benign	0.15
R0856:Abcb11	UTSW	2	69323918	missense	probably benign
R1061:Abcb11	UTSW	2	69277809	missense	probably benign	0.00
R1460:Abcb11	UTSW	2	69257374	splice site	probably benign
R1714:Abcb11	UTSW	2	69306581	missense	probably damaging	0.99
R1739:Abcb11	UTSW	2	69261566	missense	probably damaging	1.00
R1856:Abcb11	UTSW	2	69245923	missense	probably damaging	1.00
R1994:Abcb11	UTSW	2	69282670	splice site	probably null
R2086:Abcb11	UTSW	2	69259476	splice site	probably benign
R2133:Abcb11	UTSW	2	69323883	missense	possibly damaging	0.65
R2516:Abcb11	UTSW	2	69329329	missense	possibly damaging	0.88
R2930:Abcb11	UTSW	2	69257358	missense	probably damaging	0.96
R3771:Abcb11	UTSW	2	69329376	splice site	probably benign
R3772:Abcb11	UTSW	2	69329376	splice site	probably benign
R3979:Abcb11	UTSW	2	69323976	missense	probably benign	0.11
R4227:Abcb11	UTSW	2	69284776	missense	probably damaging	1.00
R4255:Abcb11	UTSW	2	69306605	missense	probably benign	0.03
R4614:Abcb11	UTSW	2	69284681	missense	possibly damaging	0.90
R4647:Abcb11	UTSW	2	69285271	missense	probably damaging	1.00
R4719:Abcb11	UTSW	2	69259627	missense	probably damaging	1.00
R4734:Abcb11	UTSW	2	69323962	missense	possibly damaging	0.73
R4765:Abcb11	UTSW	2	69245867	missense	probably damaging	1.00
R4861:Abcb11	UTSW	2	69245905	missense	probably damaging	1.00
R4861:Abcb11	UTSW	2	69245905	missense	probably damaging	1.00
R4870:Abcb11	UTSW	2	69239196	missense	probably damaging	0.99
R4988:Abcb11	UTSW	2	69323892	missense	probably benign	0.12
R5028:Abcb11	UTSW	2	69274012	missense	probably damaging	1.00
R5048:Abcb11	UTSW	2	69308506	missense	probably benign	0.06
R5177:Abcb11	UTSW	2	69285295	missense	probably damaging	1.00
R5301:Abcb11	UTSW	2	69286847	missense	probably damaging	0.98
R5789:Abcb11	UTSW	2	69245764	missense	probably damaging	1.00
R5892:Abcb11	UTSW	2	69261500	missense	probably damaging	0.99
R6003:Abcb11	UTSW	2	69243467	missense	probably benign	0.43
R6252:Abcb11	UTSW	2	69291961	missense	probably benign	0.10
R6389:Abcb11	UTSW	2	69323894	missense	probably damaging	1.00
R6512:Abcb11	UTSW	2	69282652	missense	probably benign
R6590:Abcb11	UTSW	2	69284718	missense	probably damaging	1.00
R6690:Abcb11	UTSW	2	69284718	missense	probably damaging	1.00
R6732:Abcb11	UTSW	2	69286846	missense	probably damaging	1.00
R6870:Abcb11	UTSW	2	69285298	missense	possibly damaging	0.91
R7028:Abcb11	UTSW	2	69265675	missense	probably benign
R7223:Abcb11	UTSW	2	69274143	missense	probably benign
R7323:Abcb11	UTSW	2	69287635	missense	probably damaging	1.00
R7337:Abcb11	UTSW	2	69245769	missense	probably damaging	1.00
R7339:Abcb11	UTSW	2	69299867	missense	probably damaging	0.99
R7340:Abcb11	UTSW	2	69299867	missense	probably damaging	0.99
R7341:Abcb11	UTSW	2	69299867	missense	probably damaging	0.99
R7343:Abcb11	UTSW	2	69299867	missense	probably damaging	0.99
R7366:Abcb11	UTSW	2	69299867	missense	probably damaging	0.99
R7393:Abcb11	UTSW	2	69299867	missense	probably damaging	0.99
R7394:Abcb11	UTSW	2	69299867	missense	probably damaging	0.99
R7405:Abcb11	UTSW	2	69287619	missense	probably damaging	1.00
R7411:Abcb11	UTSW	2	69303936	critical splice donor site	probably null
R7488:Abcb11	UTSW	2	69277802	missense	probably benign
R7544:Abcb11	UTSW	2	69265486	missense	probably benign	0.05
R7660:Abcb11	UTSW	2	69287594	splice site	probably null
R7754:Abcb11	UTSW	2	69286818	missense	probably damaging	1.00
R7771:Abcb11	UTSW	2	69239191	missense	probably damaging	0.99
R7794:Abcb11	UTSW	2	69286678	missense	possibly damaging	0.62
R7834:Abcb11	UTSW	2	69284724	missense	probably damaging	1.00
R7897:Abcb11	UTSW	2	69323873	small deletion	probably benign
R7897:Abcb11	UTSW	2	69323872	frame shift	probably null
R7937:Abcb11	UTSW	2	69323873	small deletion	probably benign
R8004:Abcb11	UTSW	2	69257210	missense	possibly damaging	0.68
R8089:Abcb11	UTSW	2	69274039	missense	probably benign	0.09
R8279:Abcb11	UTSW	2	69239205	missense	probably benign	0.05
R8426:Abcb11	UTSW	2	69325262	missense	probably benign
R8441:Abcb11	UTSW	2	69257230	missense	possibly damaging	0.93
R8460:Abcb11	UTSW	2	69324037	missense	possibly damaging	0.70
R8462:Abcb11	UTSW	2	69274155	missense	probably benign
R8532:Abcb11	UTSW	2	69259691	missense	possibly damaging	0.69
R8534:Abcb11	UTSW	2	69323846	missense	possibly damaging	0.89
R8711:Abcb11	UTSW	2	69265512	missense	probably damaging	1.00
R8746:Abcb11	UTSW	2	69257410	intron	probably benign
R8964:Abcb11	UTSW	2	69286717	missense	possibly damaging	0.52
R8990:Abcb11	UTSW	2	69274150	missense
R9081:Abcb11	UTSW	2	69292044	missense	possibly damaging	0.59
R9228:Abcb11	UTSW	2	69308465	nonsense	probably null
R9294:Abcb11	UTSW	2	69265496	missense	possibly damaging	0.89
X0058:Abcb11	UTSW	2	69289443	missense	probably benign	0.12
X0062:Abcb11	UTSW	2	69245906	missense	probably damaging	1.00
X0065:Abcb11	UTSW	2	69299866	missense	probably damaging	0.99
Z1176:Abcb11	UTSW	2	69291981	missense	probably damaging	1.00
Z1177:Abcb11	UTSW	2	69329269	critical splice donor site	probably null
Z1177:Abcb11	UTSW	2	69306529	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGATGCCAGTGGATACTTCTG -3'
(R):5'- TGGTATTTGCAATAGCCTCTCC -3'

Sequencing Primer
(F):5'- CCAGTGGATACTTCTGTCTGTAAAGC -3'
(R):5'- ATTTGCAATAGCCTCTCCCAGGG -3'

Posted On

2021-12-30