Incidental Mutation 'R9093:Cenpe'
ID 691119
Institutional Source Beutler Lab
Gene Symbol Cenpe
Ensembl Gene ENSMUSG00000045328
Gene Name centromere protein E
Synonyms 312kDa, CENP-E, Kif10, N-7 kinesin
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9093 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 135212537-135273611 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 135239880 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 1052 (Q1052*)
Ref Sequence ENSEMBL: ENSMUSP00000057938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062893] [ENSMUST00000197369]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000062893
AA Change: Q1052*
SMART Domains Protein: ENSMUSP00000057938
Gene: ENSMUSG00000045328
AA Change: Q1052*

DomainStartEndE-ValueType
KISc 4 337 2.4e-172 SMART
coiled coil region 493 612 N/A INTRINSIC
coiled coil region 637 752 N/A INTRINSIC
internal_repeat_1 768 801 3.5e-5 PROSPERO
coiled coil region 821 991 N/A INTRINSIC
low complexity region 1119 1143 N/A INTRINSIC
internal_repeat_2 1225 1238 6.26e-5 PROSPERO
low complexity region 1446 1467 N/A INTRINSIC
low complexity region 1480 1498 N/A INTRINSIC
internal_repeat_2 1614 1627 6.26e-5 PROSPERO
internal_repeat_1 2018 2051 3.5e-5 PROSPERO
coiled coil region 2226 2247 N/A INTRINSIC
coiled coil region 2316 2363 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197369
SMART Domains Protein: ENSMUSP00000143435
Gene: ENSMUSG00000045328

DomainStartEndE-ValueType
coiled coil region 2 49 N/A INTRINSIC
coiled coil region 85 172 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Centrosome-associated protein E (CENPE) is a kinesin-like motor protein that accumulates in the G2 phase of the cell cycle. Unlike other centrosome-associated proteins, it is not present during interphase and first appears at the centromere region of chromosomes during prometaphase. This protein is required for stable spindle microtubule capture at kinetochores which is a necessary step in chromosome alignment during prometaphase. This protein also couples chromosome position to microtubule depolymerizing activity. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for a knock-out allele display early embryonic lethality. Mutant embryos grown in culture exhibit inner cell mass growth defects and mitotic chromosome misalignment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik G A 9: 51,290,216 P180L possibly damaging Het
Abcb11 A T 2: 69,239,169 V1294E probably damaging Het
Ada C T 2: 163,735,388 G60D probably benign Het
Aff3 G T 1: 38,252,657 R390S possibly damaging Het
Aldh3b3 T A 19: 3,963,959 N53K possibly damaging Het
Ankrd36 G A 11: 5,639,132 M410I probably benign Het
Ap2b1 T A 11: 83,324,569 I113N probably damaging Het
Art5 G T 7: 102,098,189 H128N probably benign Het
Calhm2 A C 19: 47,133,160 L190R probably benign Het
Catsperg1 G C 7: 29,184,727 T987R probably damaging Het
Ccdc114 G A 7: 45,947,541 V431I possibly damaging Het
Cdh18 A T 15: 23,473,978 I645F probably damaging Het
Cfap221 G T 1: 119,936,126 Q563K probably damaging Het
Cfap54 T A 10: 92,815,908 E3093D probably benign Het
Chd4 A G 6: 125,114,011 M1186V probably benign Het
Chst15 A T 7: 132,268,917 probably null Het
Clca2 T C 3: 145,075,720 T688A probably benign Het
Cmtm1 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG 8: 104,309,702 probably null Het
Cul1 T A 6: 47,518,239 N518K probably damaging Het
E230025N22Rik G T 18: 36,688,899 L247I possibly damaging Het
Eno4 A T 19: 58,953,168 K174* probably null Het
Enpp3 G A 10: 24,795,804 P431S probably benign Het
Fam160a2 T A 7: 105,385,392 T408S probably damaging Het
Fam46b A G 4: 133,487,041 T408A probably damaging Het
Fbxo18 T A 2: 11,759,990 Q444H probably damaging Het
Fbxo31 G A 8: 121,554,397 R337C probably damaging Het
Fbxw14 A G 9: 109,276,182 I305T probably benign Het
Gas2 T A 7: 51,953,221 C216S probably damaging Het
Gjb3 GCCAGATGCGCCCA GCCAGATGCGCCCAGATGCGCCCA 4: 127,326,665 probably null Het
Glp2r T A 11: 67,730,633 R344* probably null Het
Gm17430 A G 18: 9,726,640 Y11H probably damaging Het
Gyg T A 3: 20,122,737 D363V probably damaging Het
Hectd4 A G 5: 121,273,614 N451S probably benign Het
Hif1a T C 12: 73,932,337 Y212H probably benign Het
Hist2h2bb G A 3: 96,269,974 A75T probably benign Het
Hoxd11 A T 2: 74,684,138 *337C probably null Het
Kif24 A G 4: 41,428,691 F90L probably benign Het
Klhl20 A T 1: 161,095,661 C497* probably null Het
Loxl1 C A 9: 58,311,941 A316S probably benign Het
Lrig3 C T 10: 126,010,081 P793L possibly damaging Het
Macc1 A G 12: 119,446,826 D443G probably benign Het
Maip1 A T 1: 57,407,152 Y127F possibly damaging Het
Mrm2 A T 5: 140,328,672 F136Y probably benign Het
Nasp G T 4: 116,610,820 L323I probably benign Het
Ndufb8 A T 19: 44,550,384 L166Q probably damaging Het
Nid2 C T 14: 19,807,941 T1274I Het
Nup210 T A 6: 91,089,890 T160S probably benign Het
Nutm2 A G 13: 50,474,928 K676R probably damaging Het
Olfr1154 A T 2: 87,903,136 I180N probably benign Het
Olfr434 A G 6: 43,217,566 T218A probably benign Het
Olfr504 A T 7: 108,565,247 C183S probably damaging Het
Olfr519 T C 7: 108,894,402 R7G probably benign Het
Olfr853 A G 9: 19,537,618 V104A probably benign Het
Olfr877 A T 9: 37,854,998 Y60F probably damaging Het
Olfr988 T A 2: 85,353,508 R139S probably benign Het
Pcdhga12 C A 18: 37,766,878 N254K possibly damaging Het
Pm20d1 G T 1: 131,816,015 V473F probably benign Het
Rab11fip1 A G 8: 27,143,327 V596A probably damaging Het
Rapgef6 C T 11: 54,597,086 Q13* probably null Het
Rasef T C 4: 73,780,346 D26G probably benign Het
Rbfox2 A T 15: 77,306,458 V29E probably benign Het
Recql4 G A 15: 76,705,485 P787S unknown Het
Rnf19a A C 15: 36,253,304 probably benign Het
Rnf214 A G 9: 45,899,756 I203T probably damaging Het
Rnmt A C 18: 68,318,075 E396D probably benign Het
Scn4a G A 11: 106,319,812 S1793L probably benign Het
Sdcbp G T 4: 6,386,709 probably null Het
Slfn3 A G 11: 83,213,122 N273S probably damaging Het
Slk A G 19: 47,615,444 D209G Het
Tmem135 T A 7: 89,147,996 M351L probably benign Het
Tmem64 A G 4: 15,266,391 H147R probably benign Het
Tnfsf4 T C 1: 161,417,058 L106P probably damaging Het
Tonsl A T 15: 76,631,070 C1039S probably damaging Het
Ube4a A T 9: 44,953,164 F44I possibly damaging Het
Vmn2r40 A G 7: 8,908,173 L707P Het
Vmn2r87 G A 10: 130,472,296 T691I probably benign Het
Wbp11 A T 6: 136,826,046 S7T possibly damaging Het
Zfp386 C A 12: 116,060,258 S532* probably null Het
Other mutations in Cenpe
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00655:Cenpe APN 3 135231455 critical splice donor site probably null
IGL00799:Cenpe APN 3 135228917 critical splice donor site probably null
IGL00815:Cenpe APN 3 135259351 missense probably benign
IGL01446:Cenpe APN 3 135237539 missense probably benign 0.01
IGL01469:Cenpe APN 3 135228806 missense probably damaging 1.00
IGL01843:Cenpe APN 3 135218507 missense possibly damaging 0.88
IGL02254:Cenpe APN 3 135255477 missense probably benign
IGL02337:Cenpe APN 3 135220276 splice site probably benign
IGL02382:Cenpe APN 3 135247386 missense probably benign
IGL02458:Cenpe APN 3 135230108 nonsense probably null
IGL02934:Cenpe APN 3 135264351 missense probably damaging 1.00
IGL03335:Cenpe APN 3 135243625 missense probably benign
R0086:Cenpe UTSW 3 135264424 splice site probably benign
R0173:Cenpe UTSW 3 135259983 missense probably benign 0.00
R0394:Cenpe UTSW 3 135216425 splice site probably benign
R0411:Cenpe UTSW 3 135222255 missense probably damaging 1.00
R0624:Cenpe UTSW 3 135246586 missense probably benign 0.00
R0634:Cenpe UTSW 3 135246827 missense probably damaging 1.00
R0648:Cenpe UTSW 3 135230082 missense probably damaging 1.00
R0691:Cenpe UTSW 3 135217305 missense probably damaging 1.00
R1184:Cenpe UTSW 3 135264422 critical splice donor site probably null
R1530:Cenpe UTSW 3 135246902 missense possibly damaging 0.92
R1559:Cenpe UTSW 3 135270900 missense probably benign 0.07
R1562:Cenpe UTSW 3 135238394 missense possibly damaging 0.53
R1568:Cenpe UTSW 3 135239758 missense probably benign 0.01
R1712:Cenpe UTSW 3 135265933 missense probably damaging 0.99
R1828:Cenpe UTSW 3 135246496 missense probably damaging 0.99
R1846:Cenpe UTSW 3 135239845 missense probably damaging 1.00
R1861:Cenpe UTSW 3 135268979 missense probably damaging 1.00
R1938:Cenpe UTSW 3 135247479 missense probably damaging 0.98
R1961:Cenpe UTSW 3 135242493 missense probably damaging 1.00
R2062:Cenpe UTSW 3 135222321 splice site probably benign
R2118:Cenpe UTSW 3 135246884 missense possibly damaging 0.94
R2127:Cenpe UTSW 3 135239780 missense probably benign 0.08
R2156:Cenpe UTSW 3 135247474 missense probably benign 0.34
R2265:Cenpe UTSW 3 135261636 missense probably benign 0.02
R2268:Cenpe UTSW 3 135261636 missense probably benign 0.02
R2392:Cenpe UTSW 3 135248113 missense probably damaging 1.00
R2508:Cenpe UTSW 3 135241073 missense possibly damaging 0.92
R3084:Cenpe UTSW 3 135241021 missense probably damaging 1.00
R3779:Cenpe UTSW 3 135256576 missense possibly damaging 0.87
R3833:Cenpe UTSW 3 135222322 splice site probably benign
R3974:Cenpe UTSW 3 135235225 splice site probably null
R3975:Cenpe UTSW 3 135235225 splice site probably null
R3975:Cenpe UTSW 3 135238472 critical splice donor site probably null
R4151:Cenpe UTSW 3 135215153 missense probably benign 0.36
R4166:Cenpe UTSW 3 135243718 missense probably damaging 1.00
R4581:Cenpe UTSW 3 135247000 missense probably benign 0.30
R4622:Cenpe UTSW 3 135243708 missense probably benign 0.22
R4692:Cenpe UTSW 3 135216379 missense probably benign 0.29
R4769:Cenpe UTSW 3 135248151 missense probably benign
R4976:Cenpe UTSW 3 135234876 missense probably damaging 1.00
R4983:Cenpe UTSW 3 135234928 missense probably damaging 1.00
R4990:Cenpe UTSW 3 135256640 missense probably damaging 1.00
R5002:Cenpe UTSW 3 135247081 missense probably benign
R5057:Cenpe UTSW 3 135220313 missense probably benign 0.14
R5063:Cenpe UTSW 3 135270954 missense probably damaging 0.99
R5181:Cenpe UTSW 3 135242303 missense probably damaging 0.99
R5281:Cenpe UTSW 3 135230150 missense possibly damaging 0.89
R5389:Cenpe UTSW 3 135259388 critical splice donor site probably null
R5517:Cenpe UTSW 3 135223265 missense probably damaging 1.00
R5521:Cenpe UTSW 3 135269065 missense probably damaging 1.00
R5607:Cenpe UTSW 3 135235076 nonsense probably null
R5608:Cenpe UTSW 3 135235076 nonsense probably null
R5627:Cenpe UTSW 3 135235473 missense possibly damaging 0.51
R5766:Cenpe UTSW 3 135248413 missense probably damaging 0.96
R5783:Cenpe UTSW 3 135261580 missense probably benign 0.00
R5933:Cenpe UTSW 3 135261628 missense probably benign 0.03
R6073:Cenpe UTSW 3 135260073 nonsense probably null
R6163:Cenpe UTSW 3 135269003 missense probably damaging 0.99
R6192:Cenpe UTSW 3 135248530 missense possibly damaging 0.93
R6224:Cenpe UTSW 3 135243775 missense possibly damaging 0.87
R6313:Cenpe UTSW 3 135230175 missense probably benign 0.26
R6326:Cenpe UTSW 3 135239778 missense probably benign 0.15
R6383:Cenpe UTSW 3 135251528 missense probably damaging 1.00
R6418:Cenpe UTSW 3 135251544 missense probably damaging 0.99
R6797:Cenpe UTSW 3 135238138 missense possibly damaging 0.92
R6810:Cenpe UTSW 3 135243822 missense probably benign 0.00
R6989:Cenpe UTSW 3 135235127 missense probably damaging 1.00
R7009:Cenpe UTSW 3 135235201 missense probably damaging 0.97
R7009:Cenpe UTSW 3 135235202 missense probably benign 0.02
R7039:Cenpe UTSW 3 135255456 missense probably benign 0.28
R7387:Cenpe UTSW 3 135247037 missense probably benign 0.05
R7470:Cenpe UTSW 3 135242155 missense probably damaging 1.00
R7535:Cenpe UTSW 3 135243762 missense possibly damaging 0.90
R7562:Cenpe UTSW 3 135248634 missense probably damaging 1.00
R7573:Cenpe UTSW 3 135247459 missense probably damaging 1.00
R7613:Cenpe UTSW 3 135242302 missense possibly damaging 0.90
R7741:Cenpe UTSW 3 135247335 splice site probably null
R7771:Cenpe UTSW 3 135240941 splice site probably null
R7843:Cenpe UTSW 3 135232959 nonsense probably null
R7973:Cenpe UTSW 3 135223250 missense probably damaging 1.00
R8036:Cenpe UTSW 3 135239848 frame shift probably null
R8069:Cenpe UTSW 3 135243718 missense probably damaging 1.00
R8151:Cenpe UTSW 3 135247022 missense probably benign 0.28
R8176:Cenpe UTSW 3 135230090 missense probably damaging 1.00
R8191:Cenpe UTSW 3 135251614 missense probably benign
R8251:Cenpe UTSW 3 135251684 critical splice donor site probably null
R8425:Cenpe UTSW 3 135242627 nonsense probably null
R8488:Cenpe UTSW 3 135259241 missense probably damaging 1.00
R8811:Cenpe UTSW 3 135223240 missense probably damaging 1.00
R8850:Cenpe UTSW 3 135225016 missense probably damaging 1.00
R8879:Cenpe UTSW 3 135260101 missense probably damaging 0.99
R8899:Cenpe UTSW 3 135239883 missense probably benign 0.18
R9035:Cenpe UTSW 3 135270811 missense probably benign 0.01
R9038:Cenpe UTSW 3 135218036 missense probably benign 0.00
R9221:Cenpe UTSW 3 135230078 missense possibly damaging 0.90
R9365:Cenpe UTSW 3 135248446 missense possibly damaging 0.56
R9443:Cenpe UTSW 3 135270848 missense probably damaging 0.99
Z1177:Cenpe UTSW 3 135216385 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- ACTTCTGGCCAGTGAACAGG -3'
(R):5'- TAGTTCTAACTTAGGCAGAGACATC -3'

Sequencing Primer
(F):5'- GAACCCAAAGCTAGCTGTCTGTATG -3'
(R):5'- GACATCTGTCAAGTCATATAACCATC -3'
Posted On 2021-12-30