Incidental Mutation 'R9093:Hectd4'
ID 691129
Institutional Source Beutler Lab
Gene Symbol Hectd4
Ensembl Gene ENSMUSG00000042744
Gene Name HECT domain E3 ubiquitin protein ligase 4
Synonyms Gm15800
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.927) question?
Stock # R9093 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 121358282-121506640 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 121411677 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 451 (N451S)
Ref Sequence ENSEMBL: ENSMUSP00000048345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042614]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000042614
AA Change: N451S

PolyPhen 2 Score 0.144 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000048345
Gene: ENSMUSG00000042744
AA Change: N451S

DomainStartEndE-ValueType
low complexity region 224 234 N/A INTRINSIC
low complexity region 266 282 N/A INTRINSIC
low complexity region 553 564 N/A INTRINSIC
low complexity region 725 735 N/A INTRINSIC
low complexity region 1252 1265 N/A INTRINSIC
coiled coil region 1372 1398 N/A INTRINSIC
low complexity region 1551 1562 N/A INTRINSIC
low complexity region 1725 1741 N/A INTRINSIC
low complexity region 1892 1904 N/A INTRINSIC
low complexity region 2656 2666 N/A INTRINSIC
low complexity region 2857 2872 N/A INTRINSIC
low complexity region 2901 2917 N/A INTRINSIC
low complexity region 2921 2933 N/A INTRINSIC
low complexity region 3232 3246 N/A INTRINSIC
low complexity region 3275 3335 N/A INTRINSIC
low complexity region 3441 3448 N/A INTRINSIC
low complexity region 3473 3506 N/A INTRINSIC
low complexity region 3512 3533 N/A INTRINSIC
low complexity region 3540 3554 N/A INTRINSIC
low complexity region 3794 3822 N/A INTRINSIC
HECTc 4048 4412 4.78e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 97% (76/78)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,069,513 (GRCm39) V1294E probably damaging Het
Ada C T 2: 163,577,308 (GRCm39) G60D probably benign Het
Aff3 G T 1: 38,291,738 (GRCm39) R390S possibly damaging Het
Aldh3b3 T A 19: 4,013,959 (GRCm39) N53K possibly damaging Het
Ankrd36 G A 11: 5,589,132 (GRCm39) M410I probably benign Het
Ap2b1 T A 11: 83,215,395 (GRCm39) I113N probably damaging Het
Art5 G T 7: 101,747,396 (GRCm39) H128N probably benign Het
Calhm2 A C 19: 47,121,599 (GRCm39) L190R probably benign Het
Catsperg1 G C 7: 28,884,152 (GRCm39) T987R probably damaging Het
Cdh18 A T 15: 23,474,064 (GRCm39) I645F probably damaging Het
Cenpe C T 3: 134,945,641 (GRCm39) Q1052* probably null Het
Cfap221 G T 1: 119,863,856 (GRCm39) Q563K probably damaging Het
Cfap54 T A 10: 92,651,770 (GRCm39) E3093D probably benign Het
Chd4 A G 6: 125,090,974 (GRCm39) M1186V probably benign Het
Chst15 A T 7: 131,870,646 (GRCm39) probably null Het
Clca3a2 T C 3: 144,781,481 (GRCm39) T688A probably benign Het
Cmtm1 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG 8: 105,036,334 (GRCm39) probably null Het
Cul1 T A 6: 47,495,173 (GRCm39) N518K probably damaging Het
E230025N22Rik G T 18: 36,821,952 (GRCm39) L247I possibly damaging Het
Eno4 A T 19: 58,941,600 (GRCm39) K174* probably null Het
Enpp3 G A 10: 24,671,702 (GRCm39) P431S probably benign Het
Fbh1 T A 2: 11,764,801 (GRCm39) Q444H probably damaging Het
Fbxo31 G A 8: 122,281,136 (GRCm39) R337C probably damaging Het
Fbxw14 A G 9: 109,105,250 (GRCm39) I305T probably benign Het
Fhip1b T A 7: 105,034,599 (GRCm39) T408S probably damaging Het
Gas2 T A 7: 51,602,969 (GRCm39) C216S probably damaging Het
Gjb3 GCCAGATGCGCCCA GCCAGATGCGCCCAGATGCGCCCA 4: 127,220,458 (GRCm39) probably null Het
Glp2r T A 11: 67,621,459 (GRCm39) R344* probably null Het
Gm17430 A G 18: 9,726,640 (GRCm39) Y11H probably damaging Het
Gyg1 T A 3: 20,176,901 (GRCm39) D363V probably damaging Het
H2bc18 G A 3: 96,177,290 (GRCm39) A75T probably benign Het
Hif1a T C 12: 73,979,111 (GRCm39) Y212H probably benign Het
Hoxd11 A T 2: 74,514,482 (GRCm39) *337C probably null Het
Kif24 A G 4: 41,428,691 (GRCm39) F90L probably benign Het
Klhl20 A T 1: 160,923,231 (GRCm39) C497* probably null Het
Loxl1 C A 9: 58,219,224 (GRCm39) A316S probably benign Het
Lrig3 C T 10: 125,845,950 (GRCm39) P793L possibly damaging Het
Macc1 A G 12: 119,410,561 (GRCm39) D443G probably benign Het
Maip1 A T 1: 57,446,311 (GRCm39) Y127F possibly damaging Het
Mrm2 A T 5: 140,314,427 (GRCm39) F136Y probably benign Het
Nasp G T 4: 116,468,017 (GRCm39) L323I probably benign Het
Ndufb8 A T 19: 44,538,823 (GRCm39) L166Q probably damaging Het
Nid2 C T 14: 19,858,009 (GRCm39) T1274I Het
Nup210 T A 6: 91,066,872 (GRCm39) T160S probably benign Het
Nutm2 A G 13: 50,628,964 (GRCm39) K676R probably damaging Het
Odad1 G A 7: 45,596,965 (GRCm39) V431I possibly damaging Het
Or10a3n T C 7: 108,493,609 (GRCm39) R7G probably benign Het
Or2a20 A G 6: 43,194,500 (GRCm39) T218A probably benign Het
Or56b1b A T 7: 108,164,454 (GRCm39) C183S probably damaging Het
Or5ak20 T A 2: 85,183,852 (GRCm39) R139S probably benign Het
Or7g33 A G 9: 19,448,914 (GRCm39) V104A probably benign Het
Or8b9 A T 9: 37,766,294 (GRCm39) Y60F probably damaging Het
Or9m1 A T 2: 87,733,480 (GRCm39) I180N probably benign Het
Pcdhga12 C A 18: 37,899,931 (GRCm39) N254K possibly damaging Het
Pm20d1 G T 1: 131,743,753 (GRCm39) V473F probably benign Het
Pou2af2 G A 9: 51,201,516 (GRCm39) P180L possibly damaging Het
Rab11fip1 A G 8: 27,633,355 (GRCm39) V596A probably damaging Het
Rapgef6 C T 11: 54,487,912 (GRCm39) Q13* probably null Het
Rasef T C 4: 73,698,583 (GRCm39) D26G probably benign Het
Rbfox2 A T 15: 77,190,658 (GRCm39) V29E probably benign Het
Recql4 G A 15: 76,589,685 (GRCm39) P787S unknown Het
Rnf19a A C 15: 36,253,450 (GRCm39) probably benign Het
Rnf214 A G 9: 45,811,054 (GRCm39) I203T probably damaging Het
Rnmt A C 18: 68,451,146 (GRCm39) E396D probably benign Het
Scn4a G A 11: 106,210,638 (GRCm39) S1793L probably benign Het
Sdcbp G T 4: 6,386,709 (GRCm39) probably null Het
Slfn3 A G 11: 83,103,948 (GRCm39) N273S probably damaging Het
Slk A G 19: 47,603,883 (GRCm39) D209G Het
Tent5b A G 4: 133,214,352 (GRCm39) T408A probably damaging Het
Tmem135 T A 7: 88,797,204 (GRCm39) M351L probably benign Het
Tmem64 A G 4: 15,266,391 (GRCm39) H147R probably benign Het
Tnfsf4 T C 1: 161,244,629 (GRCm39) L106P probably damaging Het
Tonsl A T 15: 76,515,270 (GRCm39) C1039S probably damaging Het
Ube4a A T 9: 44,864,462 (GRCm39) F44I possibly damaging Het
Vmn2r40 A G 7: 8,911,172 (GRCm39) L707P Het
Vmn2r87 G A 10: 130,308,165 (GRCm39) T691I probably benign Het
Wbp11 A T 6: 136,803,044 (GRCm39) S7T possibly damaging Het
Zfp386 C A 12: 116,023,878 (GRCm39) S532* probably null Het
Other mutations in Hectd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Hectd4 APN 5 121,501,933 (GRCm39) missense possibly damaging 0.51
IGL00976:Hectd4 APN 5 121,487,169 (GRCm39) missense probably benign 0.18
IGL01085:Hectd4 APN 5 121,469,764 (GRCm39) missense probably damaging 1.00
IGL01112:Hectd4 APN 5 121,445,013 (GRCm39) missense probably benign 0.01
IGL01402:Hectd4 APN 5 121,477,480 (GRCm39) splice site probably benign
IGL01474:Hectd4 APN 5 121,474,712 (GRCm39) missense possibly damaging 0.53
IGL01503:Hectd4 APN 5 121,456,714 (GRCm39) missense probably benign 0.28
IGL01548:Hectd4 APN 5 121,502,723 (GRCm39) missense possibly damaging 0.71
IGL01656:Hectd4 APN 5 121,460,763 (GRCm39) missense probably damaging 0.99
IGL01756:Hectd4 APN 5 121,482,887 (GRCm39) missense probably benign 0.28
IGL01819:Hectd4 APN 5 121,466,481 (GRCm39) missense possibly damaging 0.85
IGL02080:Hectd4 APN 5 121,504,669 (GRCm39) utr 3 prime probably benign
IGL02488:Hectd4 APN 5 121,430,150 (GRCm39) missense probably benign 0.33
IGL02490:Hectd4 APN 5 121,456,676 (GRCm39) missense possibly damaging 0.82
IGL02558:Hectd4 APN 5 121,482,848 (GRCm39) missense probably benign 0.28
IGL02626:Hectd4 APN 5 121,491,944 (GRCm39) missense possibly damaging 0.86
IGL02649:Hectd4 APN 5 121,487,465 (GRCm39) missense possibly damaging 0.73
IGL02736:Hectd4 APN 5 121,480,782 (GRCm39) missense possibly damaging 0.73
IGL02861:Hectd4 APN 5 121,445,067 (GRCm39) missense possibly damaging 0.81
IGL02880:Hectd4 APN 5 121,503,116 (GRCm39) missense possibly damaging 0.93
IGL02889:Hectd4 APN 5 121,503,116 (GRCm39) missense possibly damaging 0.93
IGL02953:Hectd4 APN 5 121,503,116 (GRCm39) missense possibly damaging 0.93
IGL02969:Hectd4 APN 5 121,503,116 (GRCm39) missense possibly damaging 0.93
IGL03031:Hectd4 APN 5 121,486,857 (GRCm39) missense possibly damaging 0.96
IGL03066:Hectd4 APN 5 121,503,116 (GRCm39) missense possibly damaging 0.93
IGL03160:Hectd4 APN 5 121,397,942 (GRCm39) missense probably benign
IGL03181:Hectd4 APN 5 121,492,021 (GRCm39) missense possibly damaging 0.91
IGL03265:Hectd4 APN 5 121,398,002 (GRCm39) splice site probably benign
IGL03375:Hectd4 APN 5 121,466,445 (GRCm39) missense possibly damaging 0.72
Achilles UTSW 5 121,445,444 (GRCm39) nonsense probably null
agamemnon UTSW 5 121,391,921 (GRCm39) splice site probably benign
clymnestra UTSW 5 121,472,438 (GRCm39) missense possibly damaging 0.86
hector UTSW 5 121,453,500 (GRCm39) missense probably damaging 1.00
helen UTSW 5 121,448,726 (GRCm39) missense probably damaging 0.97
Merriwether UTSW 5 121,491,614 (GRCm39) missense possibly damaging 0.53
PIT4466001:Hectd4 UTSW 5 121,471,123 (GRCm39) critical splice donor site probably null
R0018:Hectd4 UTSW 5 121,392,242 (GRCm39) missense possibly damaging 0.53
R0024:Hectd4 UTSW 5 121,446,639 (GRCm39) missense possibly damaging 0.92
R0030:Hectd4 UTSW 5 121,400,651 (GRCm39) nonsense probably null
R0080:Hectd4 UTSW 5 121,487,435 (GRCm39) missense probably benign 0.18
R0110:Hectd4 UTSW 5 121,443,736 (GRCm39) missense possibly damaging 0.53
R0110:Hectd4 UTSW 5 121,419,959 (GRCm39) missense possibly damaging 0.90
R0115:Hectd4 UTSW 5 121,433,569 (GRCm39) splice site probably benign
R0128:Hectd4 UTSW 5 121,487,306 (GRCm39) missense possibly damaging 0.86
R0131:Hectd4 UTSW 5 121,471,087 (GRCm39) missense probably benign 0.44
R0131:Hectd4 UTSW 5 121,471,087 (GRCm39) missense probably benign 0.44
R0132:Hectd4 UTSW 5 121,471,087 (GRCm39) missense probably benign 0.44
R0244:Hectd4 UTSW 5 121,467,668 (GRCm39) missense probably benign 0.33
R0281:Hectd4 UTSW 5 121,392,314 (GRCm39) missense possibly damaging 0.85
R0329:Hectd4 UTSW 5 121,397,927 (GRCm39) missense probably benign
R0410:Hectd4 UTSW 5 121,424,329 (GRCm39) missense possibly damaging 0.86
R0422:Hectd4 UTSW 5 121,481,145 (GRCm39) splice site probably null
R0442:Hectd4 UTSW 5 121,462,045 (GRCm39) missense possibly damaging 0.66
R0449:Hectd4 UTSW 5 121,502,653 (GRCm39) splice site probably null
R0469:Hectd4 UTSW 5 121,443,736 (GRCm39) missense possibly damaging 0.53
R0469:Hectd4 UTSW 5 121,419,959 (GRCm39) missense possibly damaging 0.90
R0481:Hectd4 UTSW 5 121,433,569 (GRCm39) splice site probably benign
R0510:Hectd4 UTSW 5 121,443,736 (GRCm39) missense possibly damaging 0.53
R0510:Hectd4 UTSW 5 121,419,959 (GRCm39) missense possibly damaging 0.90
R0520:Hectd4 UTSW 5 121,469,770 (GRCm39) missense possibly damaging 0.53
R0534:Hectd4 UTSW 5 121,486,539 (GRCm39) missense possibly damaging 0.96
R0603:Hectd4 UTSW 5 121,442,400 (GRCm39) missense possibly damaging 0.46
R0617:Hectd4 UTSW 5 121,481,295 (GRCm39) splice site probably benign
R0622:Hectd4 UTSW 5 121,486,688 (GRCm39) missense possibly damaging 0.53
R0626:Hectd4 UTSW 5 121,415,887 (GRCm39) missense probably benign 0.18
R0708:Hectd4 UTSW 5 121,424,526 (GRCm39) critical splice donor site probably null
R0710:Hectd4 UTSW 5 121,474,691 (GRCm39) missense probably benign 0.08
R0763:Hectd4 UTSW 5 121,445,096 (GRCm39) unclassified probably benign
R0764:Hectd4 UTSW 5 121,424,832 (GRCm39) missense possibly damaging 0.46
R1123:Hectd4 UTSW 5 121,424,799 (GRCm39) missense probably damaging 0.96
R1129:Hectd4 UTSW 5 121,448,662 (GRCm39) missense possibly damaging 0.66
R1204:Hectd4 UTSW 5 121,488,548 (GRCm39) missense possibly damaging 0.85
R1237:Hectd4 UTSW 5 121,459,570 (GRCm39) missense possibly damaging 0.90
R1257:Hectd4 UTSW 5 121,456,687 (GRCm39) nonsense probably null
R1391:Hectd4 UTSW 5 121,491,758 (GRCm39) missense possibly damaging 0.96
R1395:Hectd4 UTSW 5 121,466,576 (GRCm39) critical splice donor site probably null
R1468:Hectd4 UTSW 5 121,487,235 (GRCm39) missense possibly damaging 0.65
R1468:Hectd4 UTSW 5 121,487,235 (GRCm39) missense possibly damaging 0.65
R1545:Hectd4 UTSW 5 121,462,019 (GRCm39) missense possibly damaging 0.87
R1553:Hectd4 UTSW 5 121,487,322 (GRCm39) missense probably benign 0.00
R1572:Hectd4 UTSW 5 121,439,941 (GRCm39) missense possibly damaging 0.85
R1662:Hectd4 UTSW 5 121,455,308 (GRCm39) missense probably benign 0.01
R1705:Hectd4 UTSW 5 121,436,167 (GRCm39) missense probably benign
R1715:Hectd4 UTSW 5 121,482,881 (GRCm39) missense possibly damaging 0.85
R1728:Hectd4 UTSW 5 121,439,902 (GRCm39) missense possibly damaging 0.51
R1736:Hectd4 UTSW 5 121,487,593 (GRCm39) missense possibly damaging 0.53
R1768:Hectd4 UTSW 5 121,496,366 (GRCm39) missense possibly damaging 0.70
R1775:Hectd4 UTSW 5 121,429,254 (GRCm39) splice site probably benign
R1784:Hectd4 UTSW 5 121,439,902 (GRCm39) missense possibly damaging 0.51
R1843:Hectd4 UTSW 5 121,435,243 (GRCm39) missense possibly damaging 0.53
R1914:Hectd4 UTSW 5 121,460,357 (GRCm39) missense probably benign 0.08
R1915:Hectd4 UTSW 5 121,460,357 (GRCm39) missense probably benign 0.08
R2024:Hectd4 UTSW 5 121,419,981 (GRCm39) missense possibly damaging 0.86
R2103:Hectd4 UTSW 5 121,493,692 (GRCm39) missense probably benign 0.04
R2108:Hectd4 UTSW 5 121,471,487 (GRCm39) missense possibly damaging 0.72
R2124:Hectd4 UTSW 5 121,456,702 (GRCm39) missense probably damaging 0.97
R2150:Hectd4 UTSW 5 121,391,921 (GRCm39) splice site probably benign
R2192:Hectd4 UTSW 5 121,453,206 (GRCm39) missense possibly damaging 0.46
R2301:Hectd4 UTSW 5 121,491,600 (GRCm39) missense probably benign 0.18
R2324:Hectd4 UTSW 5 121,453,500 (GRCm39) missense probably damaging 1.00
R2331:Hectd4 UTSW 5 121,458,089 (GRCm39) missense probably benign 0.05
R2504:Hectd4 UTSW 5 121,402,030 (GRCm39) missense possibly damaging 0.73
R2504:Hectd4 UTSW 5 121,358,683 (GRCm39) missense unknown
R2904:Hectd4 UTSW 5 121,430,787 (GRCm39) splice site probably benign
R3843:Hectd4 UTSW 5 121,397,936 (GRCm39) missense possibly damaging 0.72
R3934:Hectd4 UTSW 5 121,458,164 (GRCm39) critical splice donor site probably null
R3944:Hectd4 UTSW 5 121,441,588 (GRCm39) splice site probably benign
R4133:Hectd4 UTSW 5 121,415,897 (GRCm39) critical splice donor site probably null
R4271:Hectd4 UTSW 5 121,358,567 (GRCm39) small deletion probably benign
R4413:Hectd4 UTSW 5 121,488,544 (GRCm39) missense possibly damaging 0.53
R4456:Hectd4 UTSW 5 121,446,334 (GRCm39) missense possibly damaging 0.65
R4489:Hectd4 UTSW 5 121,424,320 (GRCm39) missense possibly damaging 0.73
R4539:Hectd4 UTSW 5 121,452,970 (GRCm39) nonsense probably null
R4564:Hectd4 UTSW 5 121,488,494 (GRCm39) missense probably benign 0.33
R4582:Hectd4 UTSW 5 121,424,482 (GRCm39) missense possibly damaging 0.53
R4629:Hectd4 UTSW 5 121,435,266 (GRCm39) missense probably benign 0.01
R4633:Hectd4 UTSW 5 121,487,279 (GRCm39) missense probably benign 0.33
R4643:Hectd4 UTSW 5 121,487,118 (GRCm39) missense possibly damaging 0.53
R4679:Hectd4 UTSW 5 121,463,314 (GRCm39) missense possibly damaging 0.72
R4681:Hectd4 UTSW 5 121,441,678 (GRCm39) missense possibly damaging 0.86
R4734:Hectd4 UTSW 5 121,480,040 (GRCm39) missense possibly damaging 0.53
R4739:Hectd4 UTSW 5 121,486,505 (GRCm39) missense probably benign
R4781:Hectd4 UTSW 5 121,444,170 (GRCm39) critical splice donor site probably null
R4860:Hectd4 UTSW 5 121,443,881 (GRCm39) missense probably benign 0.04
R4860:Hectd4 UTSW 5 121,443,881 (GRCm39) missense probably benign 0.04
R4869:Hectd4 UTSW 5 121,460,735 (GRCm39) missense possibly damaging 0.46
R4909:Hectd4 UTSW 5 121,401,954 (GRCm39) missense probably benign 0.18
R4922:Hectd4 UTSW 5 121,497,378 (GRCm39) missense possibly damaging 0.86
R4925:Hectd4 UTSW 5 121,460,753 (GRCm39) missense possibly damaging 0.83
R5004:Hectd4 UTSW 5 121,467,628 (GRCm39) missense possibly damaging 0.93
R5004:Hectd4 UTSW 5 121,466,262 (GRCm39) splice site probably null
R5129:Hectd4 UTSW 5 121,481,573 (GRCm39) missense possibly damaging 0.87
R5217:Hectd4 UTSW 5 121,491,614 (GRCm39) missense possibly damaging 0.53
R5267:Hectd4 UTSW 5 121,482,887 (GRCm39) missense probably benign 0.28
R5344:Hectd4 UTSW 5 121,481,739 (GRCm39) missense probably benign 0.28
R5345:Hectd4 UTSW 5 121,402,037 (GRCm39) missense possibly damaging 0.85
R5347:Hectd4 UTSW 5 121,442,511 (GRCm39) missense probably benign 0.33
R5360:Hectd4 UTSW 5 121,453,464 (GRCm39) missense possibly damaging 0.90
R5363:Hectd4 UTSW 5 121,448,666 (GRCm39) missense probably benign 0.04
R5445:Hectd4 UTSW 5 121,404,337 (GRCm39) missense probably benign 0.00
R5479:Hectd4 UTSW 5 121,445,011 (GRCm39) missense probably benign
R5507:Hectd4 UTSW 5 121,419,164 (GRCm39) missense unknown
R5552:Hectd4 UTSW 5 121,480,914 (GRCm39) missense possibly damaging 0.96
R5691:Hectd4 UTSW 5 121,486,878 (GRCm39) missense possibly damaging 0.85
R5745:Hectd4 UTSW 5 121,491,565 (GRCm39) missense possibly damaging 0.96
R5757:Hectd4 UTSW 5 121,486,682 (GRCm39) missense possibly damaging 0.72
R5845:Hectd4 UTSW 5 121,445,587 (GRCm39) critical splice donor site probably null
R5869:Hectd4 UTSW 5 121,481,288 (GRCm39) critical splice donor site probably null
R5913:Hectd4 UTSW 5 121,462,037 (GRCm39) missense possibly damaging 0.83
R5920:Hectd4 UTSW 5 121,446,334 (GRCm39) missense possibly damaging 0.65
R5943:Hectd4 UTSW 5 121,460,357 (GRCm39) missense probably benign 0.01
R6219:Hectd4 UTSW 5 121,446,941 (GRCm39) missense possibly damaging 0.92
R6250:Hectd4 UTSW 5 121,477,561 (GRCm39) missense possibly damaging 0.85
R6301:Hectd4 UTSW 5 121,392,283 (GRCm39) missense possibly damaging 0.91
R6428:Hectd4 UTSW 5 121,488,508 (GRCm39) missense possibly damaging 0.53
R6446:Hectd4 UTSW 5 121,472,438 (GRCm39) missense possibly damaging 0.86
R6453:Hectd4 UTSW 5 121,488,655 (GRCm39) missense probably damaging 1.00
R6513:Hectd4 UTSW 5 121,494,259 (GRCm39) splice site probably null
R6540:Hectd4 UTSW 5 121,441,634 (GRCm39) missense probably benign 0.33
R6706:Hectd4 UTSW 5 121,458,147 (GRCm39) missense possibly damaging 0.92
R6720:Hectd4 UTSW 5 121,445,444 (GRCm39) nonsense probably null
R6736:Hectd4 UTSW 5 121,415,788 (GRCm39) missense possibly damaging 0.86
R6776:Hectd4 UTSW 5 121,491,574 (GRCm39) missense possibly damaging 0.85
R7033:Hectd4 UTSW 5 121,502,631 (GRCm39) missense possibly damaging 0.86
R7038:Hectd4 UTSW 5 121,437,660 (GRCm39) missense possibly damaging 0.90
R7175:Hectd4 UTSW 5 121,411,692 (GRCm39) missense possibly damaging 0.85
R7180:Hectd4 UTSW 5 121,446,405 (GRCm39) missense probably benign 0.01
R7234:Hectd4 UTSW 5 121,467,136 (GRCm39) missense possibly damaging 0.53
R7253:Hectd4 UTSW 5 121,452,944 (GRCm39) missense possibly damaging 0.66
R7349:Hectd4 UTSW 5 121,448,726 (GRCm39) missense probably damaging 0.97
R7450:Hectd4 UTSW 5 121,419,995 (GRCm39) missense probably benign 0.00
R7467:Hectd4 UTSW 5 121,462,024 (GRCm39) missense possibly damaging 0.66
R7475:Hectd4 UTSW 5 121,496,196 (GRCm39) splice site probably null
R7482:Hectd4 UTSW 5 121,501,941 (GRCm39) missense possibly damaging 0.71
R7512:Hectd4 UTSW 5 121,435,172 (GRCm39) missense possibly damaging 0.72
R7525:Hectd4 UTSW 5 121,481,728 (GRCm39) missense possibly damaging 0.70
R7559:Hectd4 UTSW 5 121,453,573 (GRCm39) splice site probably null
R7560:Hectd4 UTSW 5 121,392,405 (GRCm39) missense possibly damaging 0.53
R7561:Hectd4 UTSW 5 121,429,288 (GRCm39) missense possibly damaging 0.91
R7576:Hectd4 UTSW 5 121,487,522 (GRCm39) missense possibly damaging 0.91
R7584:Hectd4 UTSW 5 121,456,798 (GRCm39) missense possibly damaging 0.83
R7648:Hectd4 UTSW 5 121,392,434 (GRCm39) missense possibly damaging 0.73
R7663:Hectd4 UTSW 5 121,462,094 (GRCm39) missense probably benign 0.06
R7692:Hectd4 UTSW 5 121,459,627 (GRCm39) missense possibly damaging 0.46
R7725:Hectd4 UTSW 5 121,358,680 (GRCm39) missense unknown
R7731:Hectd4 UTSW 5 121,445,077 (GRCm39) missense probably benign 0.00
R7732:Hectd4 UTSW 5 121,474,692 (GRCm39) missense probably benign 0.14
R7782:Hectd4 UTSW 5 121,443,784 (GRCm39) missense possibly damaging 0.53
R7854:Hectd4 UTSW 5 121,467,631 (GRCm39) missense probably benign 0.27
R7898:Hectd4 UTSW 5 121,469,880 (GRCm39) missense probably benign 0.18
R7910:Hectd4 UTSW 5 121,392,291 (GRCm39) missense possibly damaging 0.86
R7962:Hectd4 UTSW 5 121,448,692 (GRCm39) missense probably damaging 0.98
R8003:Hectd4 UTSW 5 121,477,581 (GRCm39) missense possibly damaging 0.85
R8098:Hectd4 UTSW 5 121,459,461 (GRCm39) missense possibly damaging 0.46
R8110:Hectd4 UTSW 5 121,471,012 (GRCm39) missense possibly damaging 0.96
R8118:Hectd4 UTSW 5 121,424,439 (GRCm39) missense probably benign 0.33
R8171:Hectd4 UTSW 5 121,456,819 (GRCm39) missense possibly damaging 0.82
R8234:Hectd4 UTSW 5 121,477,607 (GRCm39) missense possibly damaging 0.72
R8289:Hectd4 UTSW 5 121,404,424 (GRCm39) missense possibly damaging 0.53
R8292:Hectd4 UTSW 5 121,455,288 (GRCm39) missense possibly damaging 0.66
R8348:Hectd4 UTSW 5 121,358,319 (GRCm39) start gained probably benign
R8397:Hectd4 UTSW 5 121,397,957 (GRCm39) missense probably damaging 0.98
R8436:Hectd4 UTSW 5 121,481,210 (GRCm39) missense probably benign 0.00
R8436:Hectd4 UTSW 5 121,446,421 (GRCm39) missense possibly damaging 0.90
R8443:Hectd4 UTSW 5 121,467,172 (GRCm39) missense possibly damaging 0.72
R8448:Hectd4 UTSW 5 121,358,319 (GRCm39) start gained probably benign
R8516:Hectd4 UTSW 5 121,487,073 (GRCm39) missense possibly damaging 0.53
R8519:Hectd4 UTSW 5 121,442,489 (GRCm39) nonsense probably null
R8553:Hectd4 UTSW 5 121,491,661 (GRCm39) missense possibly damaging 0.73
R8557:Hectd4 UTSW 5 121,448,714 (GRCm39) missense possibly damaging 0.66
R8725:Hectd4 UTSW 5 121,488,557 (GRCm39) missense probably damaging 1.00
R8751:Hectd4 UTSW 5 121,501,838 (GRCm39) nonsense probably null
R8769:Hectd4 UTSW 5 121,419,936 (GRCm39) missense possibly damaging 0.53
R8803:Hectd4 UTSW 5 121,461,994 (GRCm39) missense probably benign 0.01
R8887:Hectd4 UTSW 5 121,433,541 (GRCm39) missense probably benign 0.44
R8982:Hectd4 UTSW 5 121,466,305 (GRCm39) missense probably benign 0.02
R8988:Hectd4 UTSW 5 121,415,819 (GRCm39) missense possibly damaging 0.86
R8991:Hectd4 UTSW 5 121,496,347 (GRCm39) missense probably benign 0.33
R8994:Hectd4 UTSW 5 121,441,629 (GRCm39) missense probably benign 0.33
R8995:Hectd4 UTSW 5 121,392,422 (GRCm39) missense possibly damaging 0.96
R9049:Hectd4 UTSW 5 121,451,955 (GRCm39) missense possibly damaging 0.92
R9106:Hectd4 UTSW 5 121,467,619 (GRCm39) missense possibly damaging 0.53
R9137:Hectd4 UTSW 5 121,496,238 (GRCm39) missense possibly damaging 0.53
R9146:Hectd4 UTSW 5 121,487,097 (GRCm39) missense probably benign 0.33
R9154:Hectd4 UTSW 5 121,391,967 (GRCm39) missense
R9162:Hectd4 UTSW 5 121,445,042 (GRCm39) missense possibly damaging 0.66
R9166:Hectd4 UTSW 5 121,446,690 (GRCm39) missense probably damaging 0.96
R9183:Hectd4 UTSW 5 121,437,551 (GRCm39) missense possibly damaging 0.51
R9207:Hectd4 UTSW 5 121,433,496 (GRCm39) missense possibly damaging 0.86
R9291:Hectd4 UTSW 5 121,487,028 (GRCm39) missense probably benign 0.14
R9300:Hectd4 UTSW 5 121,486,952 (GRCm39) missense probably benign 0.33
R9314:Hectd4 UTSW 5 121,437,708 (GRCm39) critical splice donor site probably null
R9381:Hectd4 UTSW 5 121,472,492 (GRCm39) missense possibly damaging 0.53
R9432:Hectd4 UTSW 5 121,460,864 (GRCm39) missense probably benign 0.01
R9491:Hectd4 UTSW 5 121,452,981 (GRCm39) missense probably damaging 0.97
R9532:Hectd4 UTSW 5 121,502,616 (GRCm39) missense probably benign 0.00
R9557:Hectd4 UTSW 5 121,459,617 (GRCm39) missense possibly damaging 0.66
R9561:Hectd4 UTSW 5 121,472,532 (GRCm39) missense possibly damaging 0.53
R9593:Hectd4 UTSW 5 121,424,844 (GRCm39) nonsense probably null
R9704:Hectd4 UTSW 5 121,448,744 (GRCm39) missense probably benign 0.00
R9705:Hectd4 UTSW 5 121,448,744 (GRCm39) missense probably benign 0.00
R9712:Hectd4 UTSW 5 121,448,744 (GRCm39) missense probably benign 0.00
R9713:Hectd4 UTSW 5 121,448,744 (GRCm39) missense probably benign 0.00
R9726:Hectd4 UTSW 5 121,448,744 (GRCm39) missense probably benign 0.00
R9732:Hectd4 UTSW 5 121,392,254 (GRCm39) nonsense probably null
R9750:Hectd4 UTSW 5 121,448,744 (GRCm39) missense probably benign 0.00
R9752:Hectd4 UTSW 5 121,472,415 (GRCm39) missense possibly damaging 0.85
R9752:Hectd4 UTSW 5 121,448,744 (GRCm39) missense probably benign 0.00
R9772:Hectd4 UTSW 5 121,448,744 (GRCm39) missense probably benign 0.00
X0026:Hectd4 UTSW 5 121,487,700 (GRCm39) missense probably benign 0.04
X0027:Hectd4 UTSW 5 121,459,467 (GRCm39) missense probably benign 0.27
Z1088:Hectd4 UTSW 5 121,433,566 (GRCm39) splice site probably null
Z1177:Hectd4 UTSW 5 121,496,383 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TATGGGCTGCCATGAAAGATG -3'
(R):5'- CCTTCAGCGTGTTGGAGATG -3'

Sequencing Primer
(F):5'- CTGCCATGAAAGATGACAGCTCTG -3'
(R):5'- TGGTGGAGCCAGTCAGG -3'
Posted On 2021-12-30