Incidental Mutation 'R9093:Chst15'
ID 691145
Institutional Source Beutler Lab
Gene Symbol Chst15
Ensembl Gene ENSMUSG00000030930
Gene Name carbohydrate (N-acetylgalactosamine 4-sulfate 6-O) sulfotransferase 15
Synonyms MAd5, GalNAcS-6ST, MAd5, 4631426J05Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock # R9093 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 132235780-132317228 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 132268917 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000076682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077472] [ENSMUST00000080215] [ENSMUST00000124096]
AlphaFold Q91XQ5
Predicted Effect probably null
Transcript: ENSMUST00000077472
SMART Domains Protein: ENSMUSP00000076682
Gene: ENSMUSG00000030930

DomainStartEndE-ValueType
transmembrane domain 80 102 N/A INTRINSIC
Pfam:Sulfotransfer_3 254 502 4.2e-10 PFAM
Pfam:Sulfotransfer_1 369 524 1.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080215
SMART Domains Protein: ENSMUSP00000079105
Gene: ENSMUSG00000030930

DomainStartEndE-ValueType
transmembrane domain 80 102 N/A INTRINSIC
Pfam:Sulfotransfer_3 254 499 7.9e-9 PFAM
Pfam:Sulfotransfer_1 369 524 1.2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Chondroitin sulfate (CS) is a glycosaminoglycan which is an important structural component of the extracellular matrix and which links to proteins to form proteoglycans. Chondroitin sulfate E (CS-E) is an isomer of chondroitin sulfate in which the C-4 and C-6 hydroxyl groups are sulfated. This gene encodes a type II transmembrane glycoprotein that acts as a sulfotransferase to transfer sulfate to the C-6 hydroxal group of chondroitin sulfate. This gene has also been identified as being co-expressed with RAG1 in B-cells and as potentially acting as a B-cell surface signaling receptor. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased litter size and abnormal bone marrow-derived mast cell morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik G A 9: 51,290,216 P180L possibly damaging Het
Abcb11 A T 2: 69,239,169 V1294E probably damaging Het
Ada C T 2: 163,735,388 G60D probably benign Het
Aff3 G T 1: 38,252,657 R390S possibly damaging Het
Aldh3b3 T A 19: 3,963,959 N53K possibly damaging Het
Ankrd36 G A 11: 5,639,132 M410I probably benign Het
Ap2b1 T A 11: 83,324,569 I113N probably damaging Het
Art5 G T 7: 102,098,189 H128N probably benign Het
Calhm2 A C 19: 47,133,160 L190R probably benign Het
Catsperg1 G C 7: 29,184,727 T987R probably damaging Het
Ccdc114 G A 7: 45,947,541 V431I possibly damaging Het
Cckar ACCGCCGCCGCCGCCGCCGCCGC ACCGCCGCCGCCGCCGCCGC 5: 53,700,275 probably benign Het
Cdh18 A T 15: 23,473,978 I645F probably damaging Het
Cenpe C T 3: 135,239,880 Q1052* probably null Het
Cfap221 G T 1: 119,936,126 Q563K probably damaging Het
Cfap54 T A 10: 92,815,908 E3093D probably benign Het
Chd4 A G 6: 125,114,011 M1186V probably benign Het
Clca2 T C 3: 145,075,720 T688A probably benign Het
Cmtm1 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG 8: 104,309,702 probably null Het
Cul1 T A 6: 47,518,239 N518K probably damaging Het
E230025N22Rik G T 18: 36,688,899 L247I possibly damaging Het
Eno4 A T 19: 58,953,168 K174* probably null Het
Enpp3 G A 10: 24,795,804 P431S probably benign Het
Fam160a2 T A 7: 105,385,392 T408S probably damaging Het
Fam46b A G 4: 133,487,041 T408A probably damaging Het
Fbxo18 T A 2: 11,759,990 Q444H probably damaging Het
Fbxo31 G A 8: 121,554,397 R337C probably damaging Het
Fbxw14 A G 9: 109,276,182 I305T probably benign Het
Gas2 T A 7: 51,953,221 C216S probably damaging Het
Gjb3 GCCAGATGCGCCCA GCCAGATGCGCCCAGATGCGCCCA 4: 127,326,665 probably null Het
Glp2r T A 11: 67,730,633 R344* probably null Het
Gm17430 A G 18: 9,726,640 Y11H probably damaging Het
Gyg T A 3: 20,122,737 D363V probably damaging Het
Hectd4 A G 5: 121,273,614 N451S probably benign Het
Hif1a T C 12: 73,932,337 Y212H probably benign Het
Hist2h2bb G A 3: 96,269,974 A75T probably benign Het
Hoxd11 A T 2: 74,684,138 *337C probably null Het
Kif24 A G 4: 41,428,691 F90L probably benign Het
Klhl20 A T 1: 161,095,661 C497* probably null Het
Loxl1 C A 9: 58,311,941 A316S probably benign Het
Lrig3 C T 10: 126,010,081 P793L possibly damaging Het
Macc1 A G 12: 119,446,826 D443G probably benign Het
Maip1 A T 1: 57,407,152 Y127F possibly damaging Het
Mrm2 A T 5: 140,328,672 F136Y probably benign Het
Nasp G T 4: 116,610,820 L323I probably benign Het
Ndufb8 A T 19: 44,550,384 L166Q probably damaging Het
Nid2 C T 14: 19,807,941 T1274I Het
Nln TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC 13: 104,050,416 probably null Het
Nup210 T A 6: 91,089,890 T160S probably benign Het
Nutm2 A G 13: 50,474,928 K676R probably damaging Het
Olfr1154 A T 2: 87,903,136 I180N probably benign Het
Olfr434 A G 6: 43,217,566 T218A probably benign Het
Olfr504 A T 7: 108,565,247 C183S probably damaging Het
Olfr519 T C 7: 108,894,402 R7G probably benign Het
Olfr853 A G 9: 19,537,618 V104A probably benign Het
Olfr877 A T 9: 37,854,998 Y60F probably damaging Het
Olfr988 T A 2: 85,353,508 R139S probably benign Het
Pcdhga12 C A 18: 37,766,878 N254K possibly damaging Het
Pm20d1 G T 1: 131,816,015 V473F probably benign Het
Rab11fip1 A G 8: 27,143,327 V596A probably damaging Het
Rapgef6 C T 11: 54,597,086 Q13* probably null Het
Rasef T C 4: 73,780,346 D26G probably benign Het
Rbfox2 A T 15: 77,306,458 V29E probably benign Het
Recql4 G A 15: 76,705,485 P787S unknown Het
Rnf214 A G 9: 45,899,756 I203T probably damaging Het
Rnmt A C 18: 68,318,075 E396D probably benign Het
Scn4a G A 11: 106,319,812 S1793L probably benign Het
Sdcbp G T 4: 6,386,709 probably null Het
Slfn3 A G 11: 83,213,122 N273S probably damaging Het
Slk A G 19: 47,615,444 D209G Het
Tmem135 T A 7: 89,147,996 M351L probably benign Het
Tmem64 A G 4: 15,266,391 H147R probably benign Het
Tnfsf4 T C 1: 161,417,058 L106P probably damaging Het
Tonsl A T 15: 76,631,070 C1039S probably damaging Het
Ube4a A T 9: 44,953,164 F44I possibly damaging Het
Vmn2r40 A G 7: 8,908,173 L707P Het
Vmn2r87 G A 10: 130,472,296 T691I probably benign Het
Wbp11 A T 6: 136,826,046 S7T possibly damaging Het
Zfp386 C A 12: 116,060,258 S532* probably null Het
Other mutations in Chst15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01710:Chst15 APN 7 132270507 missense probably benign 0.22
IGL01879:Chst15 APN 7 132270265 missense possibly damaging 0.94
IGL02355:Chst15 APN 7 132266672 missense probably benign 0.26
IGL02362:Chst15 APN 7 132266672 missense probably benign 0.26
IGL02826:Chst15 APN 7 132266746 missense probably damaging 1.00
IGL02860:Chst15 APN 7 132269102 missense probably benign
IGL02972:Chst15 APN 7 132269173 missense probably damaging 1.00
IGL03266:Chst15 APN 7 132270076 missense probably damaging 1.00
IGL03331:Chst15 APN 7 132262713 missense probably damaging 1.00
IGL03375:Chst15 APN 7 132270457 nonsense probably null
R1476:Chst15 UTSW 7 132270273 missense possibly damaging 0.95
R1501:Chst15 UTSW 7 132269069 nonsense probably null
R1518:Chst15 UTSW 7 132270126 missense probably damaging 1.00
R1943:Chst15 UTSW 7 132262850 splice site probably null
R2164:Chst15 UTSW 7 132270385 missense probably damaging 0.97
R3947:Chst15 UTSW 7 132247875 missense probably damaging 1.00
R4921:Chst15 UTSW 7 132247884 missense probably benign 0.01
R5817:Chst15 UTSW 7 132269144 missense probably damaging 0.99
R5817:Chst15 UTSW 7 132269147 missense probably damaging 0.99
R5917:Chst15 UTSW 7 132270517 missense probably benign
R6930:Chst15 UTSW 7 132269030 missense possibly damaging 0.95
R7159:Chst15 UTSW 7 132270258 missense probably damaging 1.00
R7911:Chst15 UTSW 7 132270522 missense probably benign 0.12
R8282:Chst15 UTSW 7 132270150 missense probably benign
R8342:Chst15 UTSW 7 132247886 missense probably benign 0.15
R9011:Chst15 UTSW 7 132270517 missense probably benign
R9329:Chst15 UTSW 7 132266791 missense possibly damaging 0.46
R9352:Chst15 UTSW 7 132270528 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTTTAGCCTCTAGAATCATGAAC -3'
(R):5'- CTCTGCGCAAGGTTTTCTGG -3'

Sequencing Primer
(F):5'- ACACTGGTGTTTTGTCGTTATATTAC -3'
(R):5'- AAGGTTTTCTGGGGCCACC -3'
Posted On 2021-12-30