Incidental Mutation 'R9093:Or8b9'
ID 691150
Institutional Source Beutler Lab
Gene Symbol Or8b9
Ensembl Gene ENSMUSG00000066749
Gene Name olfactory receptor family 8 subfamily B member 9
Synonyms Olfr877, MOR161-5, GA_x6K02T2PVTD-31540342-31541277
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.076) question?
Stock # R9093 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 37766116-37767051 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 37766294 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 60 (Y60F)
Ref Sequence ENSEMBL: ENSMUSP00000150698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086063] [ENSMUST00000213956]
AlphaFold Q8VF62
Predicted Effect probably damaging
Transcript: ENSMUST00000086063
AA Change: Y60F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000083230
Gene: ENSMUSG00000066749
AA Change: Y60F

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.4e-49 PFAM
Pfam:7tm_1 41 291 6.5e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213956
AA Change: Y60F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,069,513 (GRCm39) V1294E probably damaging Het
Ada C T 2: 163,577,308 (GRCm39) G60D probably benign Het
Aff3 G T 1: 38,291,738 (GRCm39) R390S possibly damaging Het
Aldh3b3 T A 19: 4,013,959 (GRCm39) N53K possibly damaging Het
Ankrd36 G A 11: 5,589,132 (GRCm39) M410I probably benign Het
Ap2b1 T A 11: 83,215,395 (GRCm39) I113N probably damaging Het
Art5 G T 7: 101,747,396 (GRCm39) H128N probably benign Het
Calhm2 A C 19: 47,121,599 (GRCm39) L190R probably benign Het
Catsperg1 G C 7: 28,884,152 (GRCm39) T987R probably damaging Het
Cdh18 A T 15: 23,474,064 (GRCm39) I645F probably damaging Het
Cenpe C T 3: 134,945,641 (GRCm39) Q1052* probably null Het
Cfap221 G T 1: 119,863,856 (GRCm39) Q563K probably damaging Het
Cfap54 T A 10: 92,651,770 (GRCm39) E3093D probably benign Het
Chd4 A G 6: 125,090,974 (GRCm39) M1186V probably benign Het
Chst15 A T 7: 131,870,646 (GRCm39) probably null Het
Clca3a2 T C 3: 144,781,481 (GRCm39) T688A probably benign Het
Cmtm1 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG 8: 105,036,334 (GRCm39) probably null Het
Cul1 T A 6: 47,495,173 (GRCm39) N518K probably damaging Het
E230025N22Rik G T 18: 36,821,952 (GRCm39) L247I possibly damaging Het
Eno4 A T 19: 58,941,600 (GRCm39) K174* probably null Het
Enpp3 G A 10: 24,671,702 (GRCm39) P431S probably benign Het
Fbh1 T A 2: 11,764,801 (GRCm39) Q444H probably damaging Het
Fbxo31 G A 8: 122,281,136 (GRCm39) R337C probably damaging Het
Fbxw14 A G 9: 109,105,250 (GRCm39) I305T probably benign Het
Fhip1b T A 7: 105,034,599 (GRCm39) T408S probably damaging Het
Gas2 T A 7: 51,602,969 (GRCm39) C216S probably damaging Het
Gjb3 GCCAGATGCGCCCA GCCAGATGCGCCCAGATGCGCCCA 4: 127,220,458 (GRCm39) probably null Het
Glp2r T A 11: 67,621,459 (GRCm39) R344* probably null Het
Gm17430 A G 18: 9,726,640 (GRCm39) Y11H probably damaging Het
Gyg1 T A 3: 20,176,901 (GRCm39) D363V probably damaging Het
H2bc18 G A 3: 96,177,290 (GRCm39) A75T probably benign Het
Hectd4 A G 5: 121,411,677 (GRCm39) N451S probably benign Het
Hif1a T C 12: 73,979,111 (GRCm39) Y212H probably benign Het
Hoxd11 A T 2: 74,514,482 (GRCm39) *337C probably null Het
Kif24 A G 4: 41,428,691 (GRCm39) F90L probably benign Het
Klhl20 A T 1: 160,923,231 (GRCm39) C497* probably null Het
Loxl1 C A 9: 58,219,224 (GRCm39) A316S probably benign Het
Lrig3 C T 10: 125,845,950 (GRCm39) P793L possibly damaging Het
Macc1 A G 12: 119,410,561 (GRCm39) D443G probably benign Het
Maip1 A T 1: 57,446,311 (GRCm39) Y127F possibly damaging Het
Mrm2 A T 5: 140,314,427 (GRCm39) F136Y probably benign Het
Nasp G T 4: 116,468,017 (GRCm39) L323I probably benign Het
Ndufb8 A T 19: 44,538,823 (GRCm39) L166Q probably damaging Het
Nid2 C T 14: 19,858,009 (GRCm39) T1274I Het
Nup210 T A 6: 91,066,872 (GRCm39) T160S probably benign Het
Nutm2 A G 13: 50,628,964 (GRCm39) K676R probably damaging Het
Odad1 G A 7: 45,596,965 (GRCm39) V431I possibly damaging Het
Or10a3n T C 7: 108,493,609 (GRCm39) R7G probably benign Het
Or2a20 A G 6: 43,194,500 (GRCm39) T218A probably benign Het
Or56b1b A T 7: 108,164,454 (GRCm39) C183S probably damaging Het
Or5ak20 T A 2: 85,183,852 (GRCm39) R139S probably benign Het
Or7g33 A G 9: 19,448,914 (GRCm39) V104A probably benign Het
Or9m1 A T 2: 87,733,480 (GRCm39) I180N probably benign Het
Pcdhga12 C A 18: 37,899,931 (GRCm39) N254K possibly damaging Het
Pm20d1 G T 1: 131,743,753 (GRCm39) V473F probably benign Het
Pou2af2 G A 9: 51,201,516 (GRCm39) P180L possibly damaging Het
Rab11fip1 A G 8: 27,633,355 (GRCm39) V596A probably damaging Het
Rapgef6 C T 11: 54,487,912 (GRCm39) Q13* probably null Het
Rasef T C 4: 73,698,583 (GRCm39) D26G probably benign Het
Rbfox2 A T 15: 77,190,658 (GRCm39) V29E probably benign Het
Recql4 G A 15: 76,589,685 (GRCm39) P787S unknown Het
Rnf19a A C 15: 36,253,450 (GRCm39) probably benign Het
Rnf214 A G 9: 45,811,054 (GRCm39) I203T probably damaging Het
Rnmt A C 18: 68,451,146 (GRCm39) E396D probably benign Het
Scn4a G A 11: 106,210,638 (GRCm39) S1793L probably benign Het
Sdcbp G T 4: 6,386,709 (GRCm39) probably null Het
Slfn3 A G 11: 83,103,948 (GRCm39) N273S probably damaging Het
Slk A G 19: 47,603,883 (GRCm39) D209G Het
Tent5b A G 4: 133,214,352 (GRCm39) T408A probably damaging Het
Tmem135 T A 7: 88,797,204 (GRCm39) M351L probably benign Het
Tmem64 A G 4: 15,266,391 (GRCm39) H147R probably benign Het
Tnfsf4 T C 1: 161,244,629 (GRCm39) L106P probably damaging Het
Tonsl A T 15: 76,515,270 (GRCm39) C1039S probably damaging Het
Ube4a A T 9: 44,864,462 (GRCm39) F44I possibly damaging Het
Vmn2r40 A G 7: 8,911,172 (GRCm39) L707P Het
Vmn2r87 G A 10: 130,308,165 (GRCm39) T691I probably benign Het
Wbp11 A T 6: 136,803,044 (GRCm39) S7T possibly damaging Het
Zfp386 C A 12: 116,023,878 (GRCm39) S532* probably null Het
Other mutations in Or8b9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01862:Or8b9 APN 9 37,766,477 (GRCm39) missense probably damaging 1.00
IGL02108:Or8b9 APN 9 37,766,234 (GRCm39) missense possibly damaging 0.88
IGL02474:Or8b9 APN 9 37,766,656 (GRCm39) missense probably benign 0.08
R0006:Or8b9 UTSW 9 37,766,516 (GRCm39) missense possibly damaging 0.95
R0893:Or8b9 UTSW 9 37,766,492 (GRCm39) missense probably damaging 1.00
R1051:Or8b9 UTSW 9 37,766,657 (GRCm39) missense probably damaging 0.99
R1432:Or8b9 UTSW 9 37,766,548 (GRCm39) missense possibly damaging 0.79
R1718:Or8b9 UTSW 9 37,766,749 (GRCm39) missense probably benign 0.03
R1864:Or8b9 UTSW 9 37,766,560 (GRCm39) missense probably damaging 1.00
R4120:Or8b9 UTSW 9 37,766,705 (GRCm39) missense possibly damaging 0.66
R4507:Or8b9 UTSW 9 37,766,201 (GRCm39) missense possibly damaging 0.90
R4900:Or8b9 UTSW 9 37,766,608 (GRCm39) missense probably benign
R5406:Or8b9 UTSW 9 37,766,515 (GRCm39) missense probably benign 0.02
R6813:Or8b9 UTSW 9 37,766,810 (GRCm39) missense possibly damaging 0.83
R7061:Or8b9 UTSW 9 37,766,942 (GRCm39) missense possibly damaging 0.88
R7315:Or8b9 UTSW 9 37,766,543 (GRCm39) missense probably benign
R7500:Or8b9 UTSW 9 37,766,314 (GRCm39) missense probably damaging 1.00
R8021:Or8b9 UTSW 9 37,766,592 (GRCm39) missense probably damaging 1.00
R8188:Or8b9 UTSW 9 37,766,407 (GRCm39) missense probably benign 0.01
R9331:Or8b9 UTSW 9 37,766,710 (GRCm39) missense probably benign 0.03
R9373:Or8b9 UTSW 9 37,766,750 (GRCm39) missense probably damaging 0.97
R9696:Or8b9 UTSW 9 37,766,671 (GRCm39) missense probably benign 0.35
Z1088:Or8b9 UTSW 9 37,766,614 (GRCm39) missense probably benign 0.31
Z1177:Or8b9 UTSW 9 37,766,794 (GRCm39) missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- CTCTTCCCAGACACTCCTAGAG -3'
(R):5'- GCAACATAGCGGTCATATGCC -3'

Sequencing Primer
(F):5'- TCCTAGAGGAGAATGGCTGC -3'
(R):5'- CCATTGCTGACAGGATGTAAGACTC -3'
Posted On 2021-12-30