Incidental Mutation 'R9093:Ap2b1'
ID 691164
Institutional Source Beutler Lab
Gene Symbol Ap2b1
Ensembl Gene ENSMUSG00000035152
Gene Name adaptor-related protein complex 2, beta 1 subunit
Synonyms 1300012O03Rik
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9093 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 83189850-83295861 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 83215395 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 113 (I113N)
Ref Sequence ENSEMBL: ENSMUSP00000018875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018875] [ENSMUST00000065692] [ENSMUST00000176430] [ENSMUST00000176523] [ENSMUST00000176944]
AlphaFold Q9DBG3
Predicted Effect probably damaging
Transcript: ENSMUST00000018875
AA Change: I113N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000018875
Gene: ENSMUSG00000035152
AA Change: I113N

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 534 2.6e-173 PFAM
Pfam:HEAT_2 88 157 3.7e-8 PFAM
Pfam:Cnd1 99 268 2.1e-40 PFAM
Pfam:HEAT_2 124 219 1.4e-9 PFAM
low complexity region 625 643 N/A INTRINSIC
low complexity region 654 675 N/A INTRINSIC
Alpha_adaptinC2 721 831 2.94e-18 SMART
B2-adapt-app_C 840 950 9.93e-56 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000065692
AA Change: I113N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000070714
Gene: ENSMUSG00000035152
AA Change: I113N

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 534 4.2e-173 PFAM
Pfam:HEAT_2 88 157 2.7e-8 PFAM
Pfam:Cnd1 99 268 1.5e-37 PFAM
low complexity region 625 643 N/A INTRINSIC
low complexity region 653 665 N/A INTRINSIC
Alpha_adaptinC2 707 817 2.94e-18 SMART
B2-adapt-app_C 826 936 9.93e-56 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000176430
AA Change: I113N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134779
Gene: ENSMUSG00000035152
AA Change: I113N

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 534 4e-173 PFAM
Pfam:HEAT_2 88 157 2.8e-8 PFAM
Pfam:Cnd1 99 268 1.5e-37 PFAM
low complexity region 625 643 N/A INTRINSIC
low complexity region 654 675 N/A INTRINSIC
Alpha_adaptinC2 721 831 2.94e-18 SMART
B2-adapt-app_C 840 936 7.22e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176523
SMART Domains Protein: ENSMUSP00000135445
Gene: ENSMUSG00000035152

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 95 1.1e-26 PFAM
Pfam:Cnd1 69 230 1.5e-26 PFAM
Pfam:HEAT_2 85 182 5.1e-9 PFAM
Pfam:Adaptin_N 90 496 4e-125 PFAM
low complexity region 587 605 N/A INTRINSIC
low complexity region 616 637 N/A INTRINSIC
Alpha_adaptinC2 683 793 2.94e-18 SMART
B2-adapt-app_C 802 912 9.93e-56 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000176944
AA Change: I113N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134798
Gene: ENSMUSG00000035152
AA Change: I113N

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 199 3.4e-67 PFAM
Pfam:DNA_alkylation 18 196 4.6e-8 PFAM
Pfam:HEAT_2 88 185 3.1e-13 PFAM
Pfam:Cnd1 99 198 4.2e-27 PFAM
Pfam:HEAT 122 151 1.4e-5 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 97% (76/78)
MGI Phenotype PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,069,513 (GRCm39) V1294E probably damaging Het
Ada C T 2: 163,577,308 (GRCm39) G60D probably benign Het
Aff3 G T 1: 38,291,738 (GRCm39) R390S possibly damaging Het
Aldh3b3 T A 19: 4,013,959 (GRCm39) N53K possibly damaging Het
Ankrd36 G A 11: 5,589,132 (GRCm39) M410I probably benign Het
Art5 G T 7: 101,747,396 (GRCm39) H128N probably benign Het
Calhm2 A C 19: 47,121,599 (GRCm39) L190R probably benign Het
Catsperg1 G C 7: 28,884,152 (GRCm39) T987R probably damaging Het
Cdh18 A T 15: 23,474,064 (GRCm39) I645F probably damaging Het
Cenpe C T 3: 134,945,641 (GRCm39) Q1052* probably null Het
Cfap221 G T 1: 119,863,856 (GRCm39) Q563K probably damaging Het
Cfap54 T A 10: 92,651,770 (GRCm39) E3093D probably benign Het
Chd4 A G 6: 125,090,974 (GRCm39) M1186V probably benign Het
Chst15 A T 7: 131,870,646 (GRCm39) probably null Het
Clca3a2 T C 3: 144,781,481 (GRCm39) T688A probably benign Het
Cmtm1 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG 8: 105,036,334 (GRCm39) probably null Het
Cul1 T A 6: 47,495,173 (GRCm39) N518K probably damaging Het
E230025N22Rik G T 18: 36,821,952 (GRCm39) L247I possibly damaging Het
Eno4 A T 19: 58,941,600 (GRCm39) K174* probably null Het
Enpp3 G A 10: 24,671,702 (GRCm39) P431S probably benign Het
Fbh1 T A 2: 11,764,801 (GRCm39) Q444H probably damaging Het
Fbxo31 G A 8: 122,281,136 (GRCm39) R337C probably damaging Het
Fbxw14 A G 9: 109,105,250 (GRCm39) I305T probably benign Het
Fhip1b T A 7: 105,034,599 (GRCm39) T408S probably damaging Het
Gas2 T A 7: 51,602,969 (GRCm39) C216S probably damaging Het
Gjb3 GCCAGATGCGCCCA GCCAGATGCGCCCAGATGCGCCCA 4: 127,220,458 (GRCm39) probably null Het
Glp2r T A 11: 67,621,459 (GRCm39) R344* probably null Het
Gm17430 A G 18: 9,726,640 (GRCm39) Y11H probably damaging Het
Gyg1 T A 3: 20,176,901 (GRCm39) D363V probably damaging Het
H2bc18 G A 3: 96,177,290 (GRCm39) A75T probably benign Het
Hectd4 A G 5: 121,411,677 (GRCm39) N451S probably benign Het
Hif1a T C 12: 73,979,111 (GRCm39) Y212H probably benign Het
Hoxd11 A T 2: 74,514,482 (GRCm39) *337C probably null Het
Kif24 A G 4: 41,428,691 (GRCm39) F90L probably benign Het
Klhl20 A T 1: 160,923,231 (GRCm39) C497* probably null Het
Loxl1 C A 9: 58,219,224 (GRCm39) A316S probably benign Het
Lrig3 C T 10: 125,845,950 (GRCm39) P793L possibly damaging Het
Macc1 A G 12: 119,410,561 (GRCm39) D443G probably benign Het
Maip1 A T 1: 57,446,311 (GRCm39) Y127F possibly damaging Het
Mrm2 A T 5: 140,314,427 (GRCm39) F136Y probably benign Het
Nasp G T 4: 116,468,017 (GRCm39) L323I probably benign Het
Ndufb8 A T 19: 44,538,823 (GRCm39) L166Q probably damaging Het
Nid2 C T 14: 19,858,009 (GRCm39) T1274I Het
Nup210 T A 6: 91,066,872 (GRCm39) T160S probably benign Het
Nutm2 A G 13: 50,628,964 (GRCm39) K676R probably damaging Het
Odad1 G A 7: 45,596,965 (GRCm39) V431I possibly damaging Het
Or10a3n T C 7: 108,493,609 (GRCm39) R7G probably benign Het
Or2a20 A G 6: 43,194,500 (GRCm39) T218A probably benign Het
Or56b1b A T 7: 108,164,454 (GRCm39) C183S probably damaging Het
Or5ak20 T A 2: 85,183,852 (GRCm39) R139S probably benign Het
Or7g33 A G 9: 19,448,914 (GRCm39) V104A probably benign Het
Or8b9 A T 9: 37,766,294 (GRCm39) Y60F probably damaging Het
Or9m1 A T 2: 87,733,480 (GRCm39) I180N probably benign Het
Pcdhga12 C A 18: 37,899,931 (GRCm39) N254K possibly damaging Het
Pm20d1 G T 1: 131,743,753 (GRCm39) V473F probably benign Het
Pou2af2 G A 9: 51,201,516 (GRCm39) P180L possibly damaging Het
Rab11fip1 A G 8: 27,633,355 (GRCm39) V596A probably damaging Het
Rapgef6 C T 11: 54,487,912 (GRCm39) Q13* probably null Het
Rasef T C 4: 73,698,583 (GRCm39) D26G probably benign Het
Rbfox2 A T 15: 77,190,658 (GRCm39) V29E probably benign Het
Recql4 G A 15: 76,589,685 (GRCm39) P787S unknown Het
Rnf19a A C 15: 36,253,450 (GRCm39) probably benign Het
Rnf214 A G 9: 45,811,054 (GRCm39) I203T probably damaging Het
Rnmt A C 18: 68,451,146 (GRCm39) E396D probably benign Het
Scn4a G A 11: 106,210,638 (GRCm39) S1793L probably benign Het
Sdcbp G T 4: 6,386,709 (GRCm39) probably null Het
Slfn3 A G 11: 83,103,948 (GRCm39) N273S probably damaging Het
Slk A G 19: 47,603,883 (GRCm39) D209G Het
Tent5b A G 4: 133,214,352 (GRCm39) T408A probably damaging Het
Tmem135 T A 7: 88,797,204 (GRCm39) M351L probably benign Het
Tmem64 A G 4: 15,266,391 (GRCm39) H147R probably benign Het
Tnfsf4 T C 1: 161,244,629 (GRCm39) L106P probably damaging Het
Tonsl A T 15: 76,515,270 (GRCm39) C1039S probably damaging Het
Ube4a A T 9: 44,864,462 (GRCm39) F44I possibly damaging Het
Vmn2r40 A G 7: 8,911,172 (GRCm39) L707P Het
Vmn2r87 G A 10: 130,308,165 (GRCm39) T691I probably benign Het
Wbp11 A T 6: 136,803,044 (GRCm39) S7T possibly damaging Het
Zfp386 C A 12: 116,023,878 (GRCm39) S532* probably null Het
Other mutations in Ap2b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00864:Ap2b1 APN 11 83,223,984 (GRCm39) missense probably damaging 0.99
IGL01583:Ap2b1 APN 11 83,215,437 (GRCm39) missense possibly damaging 0.61
IGL01753:Ap2b1 APN 11 83,212,799 (GRCm39) missense probably damaging 1.00
IGL01992:Ap2b1 APN 11 83,226,356 (GRCm39) missense probably damaging 1.00
IGL02192:Ap2b1 APN 11 83,237,592 (GRCm39) missense possibly damaging 0.48
IGL02315:Ap2b1 APN 11 83,227,625 (GRCm39) missense probably damaging 0.96
IGL03235:Ap2b1 APN 11 83,232,210 (GRCm39) missense probably benign 0.41
P0045:Ap2b1 UTSW 11 83,258,852 (GRCm39) missense probably damaging 1.00
R0121:Ap2b1 UTSW 11 83,212,793 (GRCm39) missense possibly damaging 0.66
R0334:Ap2b1 UTSW 11 83,258,700 (GRCm39) splice site probably benign
R1222:Ap2b1 UTSW 11 83,237,564 (GRCm39) missense probably benign 0.06
R1297:Ap2b1 UTSW 11 83,223,935 (GRCm39) missense probably damaging 1.00
R1653:Ap2b1 UTSW 11 83,237,657 (GRCm39) missense probably damaging 1.00
R1719:Ap2b1 UTSW 11 83,215,430 (GRCm39) missense probably damaging 1.00
R1885:Ap2b1 UTSW 11 83,281,561 (GRCm39) missense probably damaging 0.99
R1886:Ap2b1 UTSW 11 83,281,561 (GRCm39) missense probably damaging 0.99
R1965:Ap2b1 UTSW 11 83,237,721 (GRCm39) missense probably benign 0.00
R1966:Ap2b1 UTSW 11 83,237,721 (GRCm39) missense probably benign 0.00
R2046:Ap2b1 UTSW 11 83,227,212 (GRCm39) missense probably benign 0.14
R2086:Ap2b1 UTSW 11 83,241,944 (GRCm39) missense possibly damaging 0.88
R2132:Ap2b1 UTSW 11 83,215,587 (GRCm39) splice site probably benign
R3615:Ap2b1 UTSW 11 83,215,391 (GRCm39) missense possibly damaging 0.84
R3616:Ap2b1 UTSW 11 83,215,391 (GRCm39) missense possibly damaging 0.84
R3983:Ap2b1 UTSW 11 83,281,542 (GRCm39) missense probably damaging 1.00
R4124:Ap2b1 UTSW 11 83,256,471 (GRCm39) critical splice acceptor site probably null
R4125:Ap2b1 UTSW 11 83,256,471 (GRCm39) critical splice acceptor site probably null
R4198:Ap2b1 UTSW 11 83,233,429 (GRCm39) missense probably damaging 1.00
R4202:Ap2b1 UTSW 11 83,226,430 (GRCm39) critical splice donor site probably null
R4543:Ap2b1 UTSW 11 83,215,476 (GRCm39) missense probably damaging 1.00
R4583:Ap2b1 UTSW 11 83,288,605 (GRCm39) missense probably benign 0.00
R4589:Ap2b1 UTSW 11 83,223,837 (GRCm39) nonsense probably null
R4916:Ap2b1 UTSW 11 83,281,532 (GRCm39) missense probably damaging 1.00
R5005:Ap2b1 UTSW 11 83,230,218 (GRCm39) missense probably damaging 1.00
R5385:Ap2b1 UTSW 11 83,233,427 (GRCm39) missense probably damaging 1.00
R5510:Ap2b1 UTSW 11 83,227,563 (GRCm39) splice site probably null
R5738:Ap2b1 UTSW 11 83,227,256 (GRCm39) splice site probably null
R6023:Ap2b1 UTSW 11 83,226,224 (GRCm39) missense probably damaging 0.99
R6269:Ap2b1 UTSW 11 83,237,499 (GRCm39) missense probably damaging 1.00
R6383:Ap2b1 UTSW 11 83,237,651 (GRCm39) missense probably damaging 1.00
R6416:Ap2b1 UTSW 11 83,199,065 (GRCm39) start codon destroyed probably null 1.00
R6502:Ap2b1 UTSW 11 83,233,505 (GRCm39) missense probably damaging 0.97
R6810:Ap2b1 UTSW 11 83,226,317 (GRCm39) missense possibly damaging 0.89
R6969:Ap2b1 UTSW 11 83,280,552 (GRCm39) missense probably damaging 0.99
R7238:Ap2b1 UTSW 11 83,223,948 (GRCm39) missense possibly damaging 0.91
R7241:Ap2b1 UTSW 11 83,241,931 (GRCm39) missense probably benign 0.16
R7429:Ap2b1 UTSW 11 83,258,824 (GRCm39) missense probably benign 0.00
R7588:Ap2b1 UTSW 11 83,215,348 (GRCm39) missense probably benign 0.00
R7635:Ap2b1 UTSW 11 83,280,554 (GRCm39) missense probably benign 0.09
R7651:Ap2b1 UTSW 11 83,230,256 (GRCm39) critical splice donor site probably null
R7753:Ap2b1 UTSW 11 83,258,733 (GRCm39) nonsense probably null
R8468:Ap2b1 UTSW 11 83,241,891 (GRCm39) missense probably damaging 1.00
R8943:Ap2b1 UTSW 11 83,237,579 (GRCm39) missense probably damaging 1.00
R9621:Ap2b1 UTSW 11 83,293,424 (GRCm39) missense probably damaging 1.00
X0064:Ap2b1 UTSW 11 83,215,395 (GRCm39) missense probably damaging 1.00
Z1177:Ap2b1 UTSW 11 83,256,579 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCCAGGCTCTCGAGTAGACAAC -3'
(R):5'- ATGAGATCCCGCAGAGAATCC -3'

Sequencing Primer
(F):5'- GAATGCCATGAGAGATTGGATTCTC -3'
(R):5'- GAGAATCCAGAAATCCCTGATCTTC -3'
Posted On 2021-12-30