Mutagenetix > Incidental Mutation

Incidental Mutation 'R9093:Ap2b1'

691164

Institutional Source

Beutler Lab

Gene Symbol

Ap2b1

Ensembl Gene

ENSMUSG00000035152

Gene Name

adaptor-related protein complex 2, beta 1 subunit

Synonyms

1300012O03Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9093 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

83299024-83405035 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 83324569 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 113 (I113N)

Ref Sequence

ENSEMBL: ENSMUSP00000018875 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018875] [ENSMUST00000065692] [ENSMUST00000176430] [ENSMUST00000176523] [ENSMUST00000176944]

AlphaFold

Q9DBG3

Predicted Effect

probably damaging
Transcript: ENSMUST00000018875
AA Change: I113N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000018875
Gene: ENSMUSG00000035152
AA Change: I113N

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	534	2.6e-173	PFAM
Pfam:HEAT_2	88	157	3.7e-8	PFAM
Pfam:Cnd1	99	268	2.1e-40	PFAM
Pfam:HEAT_2	124	219	1.4e-9	PFAM
low complexity region	625	643	N/A	INTRINSIC
low complexity region	654	675	N/A	INTRINSIC
Alpha_adaptinC2	721	831	2.94e-18	SMART
B2-adapt-app_C	840	950	9.93e-56	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000065692
AA Change: I113N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000070714
Gene: ENSMUSG00000035152
AA Change: I113N

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	534	4.2e-173	PFAM
Pfam:HEAT_2	88	157	2.7e-8	PFAM
Pfam:Cnd1	99	268	1.5e-37	PFAM
low complexity region	625	643	N/A	INTRINSIC
low complexity region	653	665	N/A	INTRINSIC
Alpha_adaptinC2	707	817	2.94e-18	SMART
B2-adapt-app_C	826	936	9.93e-56	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000176430
AA Change: I113N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000134779
Gene: ENSMUSG00000035152
AA Change: I113N

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	534	4e-173	PFAM
Pfam:HEAT_2	88	157	2.8e-8	PFAM
Pfam:Cnd1	99	268	1.5e-37	PFAM
low complexity region	625	643	N/A	INTRINSIC
low complexity region	654	675	N/A	INTRINSIC
Alpha_adaptinC2	721	831	2.94e-18	SMART
B2-adapt-app_C	840	936	7.22e-35	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000176523

SMART Domains

Protein: ENSMUSP00000135445
Gene: ENSMUSG00000035152

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	95	1.1e-26	PFAM
Pfam:Cnd1	69	230	1.5e-26	PFAM
Pfam:HEAT_2	85	182	5.1e-9	PFAM
Pfam:Adaptin_N	90	496	4e-125	PFAM
low complexity region	587	605	N/A	INTRINSIC
low complexity region	616	637	N/A	INTRINSIC
Alpha_adaptinC2	683	793	2.94e-18	SMART
B2-adapt-app_C	802	912	9.93e-56	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000176944
AA Change: I113N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000134798
Gene: ENSMUSG00000035152
AA Change: I113N

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	199	3.4e-67	PFAM
Pfam:DNA_alkylation	18	196	4.6e-8	PFAM
Pfam:HEAT_2	88	185	3.1e-13	PFAM
Pfam:Cnd1	99	198	4.2e-27	PFAM
Pfam:HEAT	122	151	1.4e-5	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

97% (76/78)

MGI Phenotype

PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit cleft palate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810046K07Rik	G	A	9: 51,290,216	P180L	possibly damaging	Het
Abcb11	A	T	2: 69,239,169	V1294E	probably damaging	Het
Ada	C	T	2: 163,735,388	G60D	probably benign	Het
Aff3	G	T	1: 38,252,657	R390S	possibly damaging	Het
Aldh3b3	T	A	19: 3,963,959	N53K	possibly damaging	Het
Ankrd36	G	A	11: 5,639,132	M410I	probably benign	Het
Art5	G	T	7: 102,098,189	H128N	probably benign	Het
Calhm2	A	C	19: 47,133,160	L190R	probably benign	Het
Catsperg1	G	C	7: 29,184,727	T987R	probably damaging	Het
Ccdc114	G	A	7: 45,947,541	V431I	possibly damaging	Het
Cdh18	A	T	15: 23,473,978	I645F	probably damaging	Het
Cenpe	C	T	3: 135,239,880	Q1052*	probably null	Het
Cfap221	G	T	1: 119,936,126	Q563K	probably damaging	Het
Cfap54	T	A	10: 92,815,908	E3093D	probably benign	Het
Chd4	A	G	6: 125,114,011	M1186V	probably benign	Het
Chst15	A	T	7: 132,268,917		probably null	Het
Clca2	T	C	3: 145,075,720	T688A	probably benign	Het
Cmtm1	TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG	TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG	8: 104,309,702		probably null	Het
Cul1	T	A	6: 47,518,239	N518K	probably damaging	Het
E230025N22Rik	G	T	18: 36,688,899	L247I	possibly damaging	Het
Eno4	A	T	19: 58,953,168	K174*	probably null	Het
Enpp3	G	A	10: 24,795,804	P431S	probably benign	Het
Fam160a2	T	A	7: 105,385,392	T408S	probably damaging	Het
Fam46b	A	G	4: 133,487,041	T408A	probably damaging	Het
Fbxo18	T	A	2: 11,759,990	Q444H	probably damaging	Het
Fbxo31	G	A	8: 121,554,397	R337C	probably damaging	Het
Fbxw14	A	G	9: 109,276,182	I305T	probably benign	Het
Gas2	T	A	7: 51,953,221	C216S	probably damaging	Het
Gjb3	GCCAGATGCGCCCA	GCCAGATGCGCCCAGATGCGCCCA	4: 127,326,665		probably null	Het
Glp2r	T	A	11: 67,730,633	R344*	probably null	Het
Gm17430	A	G	18: 9,726,640	Y11H	probably damaging	Het
Gyg	T	A	3: 20,122,737	D363V	probably damaging	Het
Hectd4	A	G	5: 121,273,614	N451S	probably benign	Het
Hif1a	T	C	12: 73,932,337	Y212H	probably benign	Het
Hist2h2bb	G	A	3: 96,269,974	A75T	probably benign	Het
Hoxd11	A	T	2: 74,684,138	*337C	probably null	Het
Kif24	A	G	4: 41,428,691	F90L	probably benign	Het
Klhl20	A	T	1: 161,095,661	C497*	probably null	Het
Loxl1	C	A	9: 58,311,941	A316S	probably benign	Het
Lrig3	C	T	10: 126,010,081	P793L	possibly damaging	Het
Macc1	A	G	12: 119,446,826	D443G	probably benign	Het
Maip1	A	T	1: 57,407,152	Y127F	possibly damaging	Het
Mrm2	A	T	5: 140,328,672	F136Y	probably benign	Het
Nasp	G	T	4: 116,610,820	L323I	probably benign	Het
Ndufb8	A	T	19: 44,550,384	L166Q	probably damaging	Het
Nid2	C	T	14: 19,807,941	T1274I		Het
Nup210	T	A	6: 91,089,890	T160S	probably benign	Het
Nutm2	A	G	13: 50,474,928	K676R	probably damaging	Het
Olfr1154	A	T	2: 87,903,136	I180N	probably benign	Het
Olfr434	A	G	6: 43,217,566	T218A	probably benign	Het
Olfr504	A	T	7: 108,565,247	C183S	probably damaging	Het
Olfr519	T	C	7: 108,894,402	R7G	probably benign	Het
Olfr853	A	G	9: 19,537,618	V104A	probably benign	Het
Olfr877	A	T	9: 37,854,998	Y60F	probably damaging	Het
Olfr988	T	A	2: 85,353,508	R139S	probably benign	Het
Pcdhga12	C	A	18: 37,766,878	N254K	possibly damaging	Het
Pm20d1	G	T	1: 131,816,015	V473F	probably benign	Het
Rab11fip1	A	G	8: 27,143,327	V596A	probably damaging	Het
Rapgef6	C	T	11: 54,597,086	Q13*	probably null	Het
Rasef	T	C	4: 73,780,346	D26G	probably benign	Het
Rbfox2	A	T	15: 77,306,458	V29E	probably benign	Het
Recql4	G	A	15: 76,705,485	P787S	unknown	Het
Rnf19a	A	C	15: 36,253,304		probably benign	Het
Rnf214	A	G	9: 45,899,756	I203T	probably damaging	Het
Rnmt	A	C	18: 68,318,075	E396D	probably benign	Het
Scn4a	G	A	11: 106,319,812	S1793L	probably benign	Het
Sdcbp	G	T	4: 6,386,709		probably null	Het
Slfn3	A	G	11: 83,213,122	N273S	probably damaging	Het
Slk	A	G	19: 47,615,444	D209G		Het
Tmem135	T	A	7: 89,147,996	M351L	probably benign	Het
Tmem64	A	G	4: 15,266,391	H147R	probably benign	Het
Tnfsf4	T	C	1: 161,417,058	L106P	probably damaging	Het
Tonsl	A	T	15: 76,631,070	C1039S	probably damaging	Het
Ube4a	A	T	9: 44,953,164	F44I	possibly damaging	Het
Vmn2r40	A	G	7: 8,908,173	L707P		Het
Vmn2r87	G	A	10: 130,472,296	T691I	probably benign	Het
Wbp11	A	T	6: 136,826,046	S7T	possibly damaging	Het
Zfp386	C	A	12: 116,060,258	S532*	probably null	Het

Other mutations in Ap2b1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00864:Ap2b1	APN	11	83333158	missense	probably damaging	0.99
IGL01583:Ap2b1	APN	11	83324611	missense	possibly damaging	0.61
IGL01753:Ap2b1	APN	11	83321973	missense	probably damaging	1.00
IGL01992:Ap2b1	APN	11	83335530	missense	probably damaging	1.00
IGL02192:Ap2b1	APN	11	83346766	missense	possibly damaging	0.48
IGL02315:Ap2b1	APN	11	83336799	missense	probably damaging	0.96
IGL03235:Ap2b1	APN	11	83341384	missense	probably benign	0.41
P0045:Ap2b1	UTSW	11	83368026	missense	probably damaging	1.00
R0121:Ap2b1	UTSW	11	83321967	missense	possibly damaging	0.66
R0334:Ap2b1	UTSW	11	83367874	splice site	probably benign
R1222:Ap2b1	UTSW	11	83346738	missense	probably benign	0.06
R1297:Ap2b1	UTSW	11	83333109	missense	probably damaging	1.00
R1653:Ap2b1	UTSW	11	83346831	missense	probably damaging	1.00
R1719:Ap2b1	UTSW	11	83324604	missense	probably damaging	1.00
R1885:Ap2b1	UTSW	11	83390735	missense	probably damaging	0.99
R1886:Ap2b1	UTSW	11	83390735	missense	probably damaging	0.99
R1965:Ap2b1	UTSW	11	83346895	missense	probably benign	0.00
R1966:Ap2b1	UTSW	11	83346895	missense	probably benign	0.00
R2046:Ap2b1	UTSW	11	83336386	missense	probably benign	0.14
R2086:Ap2b1	UTSW	11	83351118	missense	possibly damaging	0.88
R2132:Ap2b1	UTSW	11	83324761	splice site	probably benign
R3615:Ap2b1	UTSW	11	83324565	missense	possibly damaging	0.84
R3616:Ap2b1	UTSW	11	83324565	missense	possibly damaging	0.84
R3983:Ap2b1	UTSW	11	83390716	missense	probably damaging	1.00
R4124:Ap2b1	UTSW	11	83365645	critical splice acceptor site	probably null
R4125:Ap2b1	UTSW	11	83365645	critical splice acceptor site	probably null
R4198:Ap2b1	UTSW	11	83342603	missense	probably damaging	1.00
R4202:Ap2b1	UTSW	11	83335604	critical splice donor site	probably null
R4543:Ap2b1	UTSW	11	83324650	missense	probably damaging	1.00
R4583:Ap2b1	UTSW	11	83397779	missense	probably benign	0.00
R4589:Ap2b1	UTSW	11	83333011	nonsense	probably null
R4916:Ap2b1	UTSW	11	83390706	missense	probably damaging	1.00
R5005:Ap2b1	UTSW	11	83339392	missense	probably damaging	1.00
R5385:Ap2b1	UTSW	11	83342601	missense	probably damaging	1.00
R5510:Ap2b1	UTSW	11	83336737	splice site	probably null
R5738:Ap2b1	UTSW	11	83336430	splice site	probably null
R6023:Ap2b1	UTSW	11	83335398	missense	probably damaging	0.99
R6269:Ap2b1	UTSW	11	83346673	missense	probably damaging	1.00
R6383:Ap2b1	UTSW	11	83346825	missense	probably damaging	1.00
R6416:Ap2b1	UTSW	11	83308239	start codon destroyed	probably null	1.00
R6502:Ap2b1	UTSW	11	83342679	missense	probably damaging	0.97
R6810:Ap2b1	UTSW	11	83335491	missense	possibly damaging	0.89
R6969:Ap2b1	UTSW	11	83389726	missense	probably damaging	0.99
R7238:Ap2b1	UTSW	11	83333122	missense	possibly damaging	0.91
R7241:Ap2b1	UTSW	11	83351105	missense	probably benign	0.16
R7429:Ap2b1	UTSW	11	83367998	missense	probably benign	0.00
R7588:Ap2b1	UTSW	11	83324522	missense	probably benign	0.00
R7635:Ap2b1	UTSW	11	83389728	missense	probably benign	0.09
R7651:Ap2b1	UTSW	11	83339430	critical splice donor site	probably null
R7753:Ap2b1	UTSW	11	83367907	nonsense	probably null
R8468:Ap2b1	UTSW	11	83351065	missense	probably damaging	1.00
R8943:Ap2b1	UTSW	11	83346753	missense	probably damaging	1.00
R9621:Ap2b1	UTSW	11	83402598	missense	probably damaging	1.00
X0064:Ap2b1	UTSW	11	83324569	missense	probably damaging	1.00
Z1177:Ap2b1	UTSW	11	83365753	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TCCAGGCTCTCGAGTAGACAAC -3'
(R):5'- ATGAGATCCCGCAGAGAATCC -3'

Sequencing Primer
(F):5'- GAATGCCATGAGAGATTGGATTCTC -3'
(R):5'- GAGAATCCAGAAATCCCTGATCTTC -3'

Posted On

2021-12-30