Incidental Mutation 'R9094:3110021N24Rik'
ID 691196
Institutional Source Beutler Lab
Gene Symbol 3110021N24Rik
Ensembl Gene ENSMUSG00000094958
Gene Name RIKEN cDNA 3110021N24 gene
Synonyms
MMRRC Submission 068909-MU
Accession Numbers
Essential gene? Not available question?
Stock # R9094 (G1)
Quality Score 158.009
Status Validated
Chromosome 4
Chromosomal Location 108576846-108639101 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 108637744 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 37 (V37A)
Ref Sequence ENSEMBL: ENSMUSP00000136370 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106657] [ENSMUST00000106658] [ENSMUST00000178992]
AlphaFold J3QMN2
Predicted Effect probably benign
Transcript: ENSMUST00000106657
SMART Domains Protein: ENSMUSP00000102268
Gene: ENSMUSG00000034557

DomainStartEndE-ValueType
low complexity region 230 243 N/A INTRINSIC
low complexity region 471 487 N/A INTRINSIC
low complexity region 578 587 N/A INTRINSIC
Blast:FYVE 590 618 7e-6 BLAST
FYVE 663 731 2.38e-26 SMART
Pfam:SARA 745 783 1.3e-22 PFAM
Pfam:DUF3480 1020 1372 1e-178 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106658
SMART Domains Protein: ENSMUSP00000102269
Gene: ENSMUSG00000034557

DomainStartEndE-ValueType
low complexity region 230 243 N/A INTRINSIC
low complexity region 471 487 N/A INTRINSIC
low complexity region 578 587 N/A INTRINSIC
Blast:FYVE 590 618 8e-6 BLAST
FYVE 663 731 2.38e-26 SMART
Pfam:DUF3480 960 1313 5.5e-189 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000178992
AA Change: V37A
SMART Domains Protein: ENSMUSP00000136370
Gene: ENSMUSG00000094958
AA Change: V37A

DomainStartEndE-ValueType
low complexity region 54 74 N/A INTRINSIC
low complexity region 87 102 N/A INTRINSIC
low complexity region 114 148 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 96% (67/70)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik G A 14: 32,382,614 (GRCm39) S1117L possibly damaging Het
Abi3bp A G 16: 56,456,590 (GRCm39) I1021V probably benign Het
Agrn C A 4: 156,253,264 (GRCm39) K1848N probably benign Het
Anln A G 9: 22,249,283 (GRCm39) V1005A probably benign Het
Arb2a A G 13: 78,311,725 (GRCm39) K356R possibly damaging Het
Arid3b A G 9: 57,741,327 (GRCm39) Y40H probably damaging Het
Bco1 A C 8: 117,859,917 (GRCm39) D540A probably benign Het
Blnk A G 19: 40,982,482 (GRCm39) I7T probably benign Het
Brca2 T G 5: 150,475,770 (GRCm39) D2493E probably benign Het
Bsn T A 9: 107,988,052 (GRCm39) M2567L unknown Het
Cacna1e T A 1: 154,355,064 (GRCm39) Y693F possibly damaging Het
Catsperg1 G C 7: 28,884,152 (GRCm39) T987R probably damaging Het
Cpa4 G T 6: 30,574,393 (GRCm39) D61Y possibly damaging Het
Cpne1 A C 2: 155,921,080 (GRCm39) V70G probably damaging Het
Dnase1l3 A T 14: 7,987,306 (GRCm38) N81K probably damaging Het
Duxf3 GCCC GCC 10: 58,066,944 (GRCm39) probably null Het
Fbxo31 G A 8: 122,281,136 (GRCm39) R337C probably damaging Het
Fbxo34 C G 14: 47,767,928 (GRCm39) H480Q probably benign Het
Frmd4b T C 6: 97,398,559 (GRCm39) E96G Het
Gdpgp1 T A 7: 79,888,216 (GRCm39) D82E probably benign Het
Gjb3 GCCAGATGCGCCCA GCCAGATGCGCCCAGATGCGCCCA 4: 127,220,458 (GRCm39) probably null Het
Grpel1 A G 5: 36,626,823 (GRCm39) N35S probably benign Het
Il12rb1 A G 8: 71,273,291 (GRCm39) T665A possibly damaging Het
Il16 T C 7: 83,301,559 (GRCm39) T886A probably benign Het
Insig1 T A 5: 28,278,570 (GRCm39) C128* probably null Het
Kcnk10 T A 12: 98,484,775 (GRCm39) E120D probably benign Het
Kctd1 T C 18: 15,195,369 (GRCm39) N418S possibly damaging Het
Kifbp A G 10: 62,395,037 (GRCm39) V535A probably damaging Het
Klhl20 T A 1: 160,933,055 (GRCm39) H251L probably damaging Het
Ldlrad3 T C 2: 101,888,326 (GRCm39) D127G probably damaging Het
Lrp3 T C 7: 34,903,182 (GRCm39) Y388C probably damaging Het
Lrrc4 G A 6: 28,830,206 (GRCm39) R47W possibly damaging Het
Luzp1 A T 4: 136,272,562 (GRCm39) D1022V probably damaging Het
Mllt1 C A 17: 57,212,737 (GRCm39) R132L probably damaging Het
Ncoa1 G T 12: 4,345,494 (GRCm39) H618N possibly damaging Het
Nelfcd T C 2: 174,265,861 (GRCm39) S318P probably damaging Het
Ngly1 A C 14: 16,280,721 (GRCm38) T301P probably damaging Het
Npy5r G A 8: 67,133,560 (GRCm39) T411I probably damaging Het
Or55b10 T C 7: 102,143,568 (GRCm39) E138G possibly damaging Het
Or5d46 A G 2: 88,170,248 (GRCm39) N113S probably benign Het
Pcdha6 T A 18: 37,101,593 (GRCm39) I262N probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 (GRCm39) probably benign Het
Pm20d1 C A 1: 131,730,481 (GRCm39) A245D possibly damaging Het
Rars1 T C 11: 35,718,182 (GRCm39) probably benign Het
Rbms2 T A 10: 127,987,107 (GRCm39) I62F probably damaging Het
Rev3l A T 10: 39,700,809 (GRCm39) T1769S probably benign Het
Rexo1 A G 10: 80,378,854 (GRCm39) Y1061H probably damaging Het
Rgs3 A T 4: 62,500,240 (GRCm39) I26F probably damaging Het
Rsf1 G GACGGCGGCC 7: 97,229,116 (GRCm39) probably benign Het
Rtkn A T 6: 83,128,018 (GRCm39) N406Y possibly damaging Het
Rtn4r A T 16: 17,969,708 (GRCm39) I379F possibly damaging Het
Sez6 G A 11: 77,865,121 (GRCm39) E623K possibly damaging Het
Slmap T C 14: 26,137,355 (GRCm39) probably benign Het
Sorl1 A T 9: 41,975,050 (GRCm39) N519K possibly damaging Het
Srebf2 A T 15: 82,056,975 (GRCm39) I237F possibly damaging Het
Szt2 T C 4: 118,242,651 (GRCm39) S1479G possibly damaging Het
Tbc1d24 C A 17: 24,400,274 (GRCm39) E537* probably null Het
Ttf1 T A 2: 28,957,080 (GRCm39) I450K probably benign Het
Ube2e2 A G 14: 18,893,288 (GRCm38) S2P unknown Het
Utp20 T C 10: 88,611,180 (GRCm39) N1379S probably damaging Het
Vmn2r25 C T 6: 123,805,391 (GRCm39) V489I probably benign Het
Wfdc8 C T 2: 164,439,245 (GRCm39) R379H unknown Het
Zeb2 C T 2: 45,003,136 (GRCm39) probably benign Het
Zfp3 C T 11: 70,663,241 (GRCm39) T400I probably benign Het
Zfp760 T C 17: 21,941,932 (GRCm39) I369T possibly damaging Het
Other mutations in 3110021N24Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
RF019:3110021N24Rik UTSW 4 108,637,827 (GRCm39) frame shift probably null
RF058:3110021N24Rik UTSW 4 108,637,826 (GRCm39) small deletion probably benign
Predicted Primers PCR Primer
(F):5'- AGCCCGATCTTCACGTACCC -3'
(R):5'- AAAGGTGCTGGGGTCTGAC -3'

Sequencing Primer
(F):5'- CCTTCAATCTCCCGGGGAC -3'
(R):5'- GTTCCCTGCCGCTCGTG -3'
Posted On 2021-12-30